ID: 966994675

View in Genome Browser
Species Human (GRCh38)
Location 3:185267981-185268003
Sequence GTGGGCAACTGGACTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966994667_966994675 21 Left 966994667 3:185267937-185267959 CCCCCTAACATACAATTATATGA 0: 1
1: 1
2: 0
3: 17
4: 175
Right 966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG 0: 1
1: 0
2: 0
3: 8
4: 90
966994668_966994675 20 Left 966994668 3:185267938-185267960 CCCCTAACATACAATTATATGAC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG 0: 1
1: 0
2: 0
3: 8
4: 90
966994669_966994675 19 Left 966994669 3:185267939-185267961 CCCTAACATACAATTATATGACA 0: 1
1: 0
2: 1
3: 14
4: 421
Right 966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG 0: 1
1: 0
2: 0
3: 8
4: 90
966994670_966994675 18 Left 966994670 3:185267940-185267962 CCTAACATACAATTATATGACAT 0: 1
1: 0
2: 1
3: 31
4: 471
Right 966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966994675 Original CRISPR GTGGGCAACTGGACTTATAT TGG Intronic
911902915 1:103527643-103527665 GTGAGAAACTGAAATTATATTGG + Intronic
912374740 1:109201014-109201036 GTGGGGAAATGGAATTGTATCGG - Intronic
918205321 1:182303205-182303227 GTGGGTACCTGGACAAATATTGG + Intergenic
920010795 1:202866162-202866184 GCAGGCAGCTGGCCTTATATTGG - Intergenic
923334873 1:232959426-232959448 GTGTGAAAATGGACTAATATAGG + Intronic
924633726 1:245765631-245765653 GTGGGAAATTGGACTTACACTGG + Intronic
1065265005 10:23965748-23965770 GTGGTGACCTGGAGTTATATAGG + Intronic
1066174541 10:32890402-32890424 TTGGGCAACTGGACATCCATAGG + Intergenic
1073009716 10:100349640-100349662 GTGGGCAACAGTACTTTTTTAGG + Intronic
1075267600 10:121016780-121016802 TTGGTCAACTGTATTTATATGGG - Intergenic
1078412874 11:11142070-11142092 GTGGGCTAATGTGCTTATATTGG + Intergenic
1079433598 11:20421943-20421965 GAGTGCAACTGAACTTAGATAGG - Intronic
1086590432 11:88508911-88508933 GTGGGCAACTGGATCTCTTTGGG + Exonic
1088344524 11:108807699-108807721 GTAGGCACCTGGACTTTTCTGGG + Intronic
1089843303 11:121437778-121437800 GTGGGCCACAGGGCTTATAGGGG + Intergenic
1092998829 12:13976910-13976932 GTGGGCAAATGGACTGAAATTGG - Intronic
1095344036 12:41127840-41127862 GTTGGAAATTGGACATATATAGG - Intergenic
1095423574 12:42050729-42050751 GTGAGCCACTGCACTTAGATGGG - Intergenic
1097335243 12:58375436-58375458 ATGGGCAGCTGGCCTTATAAGGG + Intergenic
1098682676 12:73377790-73377812 GTGGACAACTGGATTGATAGTGG - Intergenic
1099610815 12:84866835-84866857 TTGGGCAAATAGAATTATATAGG - Intronic
1112975051 13:105307173-105307195 ATGGGCAAATGGACTTAAGTAGG - Intergenic
1114067524 14:19076173-19076195 TTGGGCATCTAGACTAATATTGG - Intergenic
1114076422 14:19163753-19163775 GTGGGCATCAGGCCTGATATTGG - Intergenic
1114085746 14:19235816-19235838 GTGGGCATCAGGCCTGATATTGG + Intergenic
1114094733 14:19323856-19323878 TTGGGCATCTAGACTAATATTGG + Intergenic
1120092437 14:80348408-80348430 GTGTGCAAATGGACTAATACAGG - Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1155433146 18:25783017-25783039 GTGGGCAGATGGATCTATATGGG - Intergenic
1156060527 18:33069453-33069475 CTGGGAAACTAGACTTCTATAGG + Intronic
1157267836 18:46244285-46244307 GTGGTAAACTGAACTTATTTAGG + Intronic
1159761778 18:72435460-72435482 GAGGGCAAATGTACTGATATAGG - Intergenic
1159892627 18:73966832-73966854 GTGTGAAAATGGACTAATATAGG + Intergenic
1162088456 19:8262290-8262312 CTGGGCAACTGGACAGATCTGGG + Exonic
1163498858 19:17663549-17663571 GTAGGCAACTGGAATTATTTTGG - Exonic
1166812505 19:45522606-45522628 GGGGGCAACAGGGCTTTTATGGG + Intronic
925494954 2:4436368-4436390 GTGGGAAAATGGACTAATACAGG - Intergenic
926856004 2:17256790-17256812 GTGGGCAAGTGGCCTTATTGGGG + Intergenic
927774303 2:25890247-25890269 GTGAGAAAATGGACTTCTATGGG - Intergenic
928115920 2:28545229-28545251 CTGGGAAACCGGACTTGTATGGG - Intronic
928738905 2:34326200-34326222 GAGGACAACAGGGCTTATATGGG - Intergenic
931437279 2:62259215-62259237 GTGGACAACAGGACTTAAAATGG + Intergenic
931782997 2:65595975-65595997 GTGGAAAACTGAACTGATATTGG - Intergenic
937792895 2:125981277-125981299 GTGGGCAACTGTACATAAATAGG - Intergenic
938485168 2:131698777-131698799 GTGGGCATCTAGACTAATATTGG - Intergenic
938491018 2:131761268-131761290 GTGGGCATCAGGCCTGATATTGG - Intronic
940025252 2:149199926-149199948 GTTGGCAACTGGAGATATTTTGG - Intronic
943336500 2:186621682-186621704 GTAGGCAAGTAAACTTATATTGG + Intronic
943945938 2:194064619-194064641 GTGTGAAAATGGACTAATATAGG - Intergenic
1170407259 20:16051102-16051124 GTAGGCATCTGGCCTTATACTGG - Exonic
1177765365 21:25451126-25451148 GTGTGAAAATGGACTAATATAGG - Intergenic
1180292228 22:10857377-10857399 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180485999 22:15798740-15798762 TTGGGCATCTAGACTAATATTGG - Intergenic
1180495033 22:15886799-15886821 GTGGGCATCAGGCCTGATATTGG - Intergenic
1184116840 22:42427156-42427178 GTGGGCAACAGGACCCAGATGGG - Intronic
952185476 3:30963351-30963373 GAGGGCAATTGAACTTATTTGGG - Intergenic
955988438 3:64599603-64599625 GTGGGCAACTGGACTTTCCTGGG + Intronic
963311517 3:143715166-143715188 GTGTGAAAATGGACTAATATAGG + Intronic
963548222 3:146687476-146687498 TTGGGAAACTGATCTTATATAGG - Intergenic
964946698 3:162233827-162233849 GTGGGCAACTGTTCCTATGTTGG + Intergenic
966394116 3:179484205-179484227 TTGAGAAACTAGACTTATATAGG + Intergenic
966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG + Intronic
971972598 4:33639021-33639043 GTGGGAAAATGGACTAATACAGG + Intergenic
972309019 4:37862587-37862609 GTGCCCAACTGGAGTTATTTTGG - Exonic
976437160 4:85031136-85031158 GTGGGCAACTGCATTTTAATGGG + Intergenic
977622670 4:99154888-99154910 GTGGACAATTGGCCTTATATTGG + Intronic
981191348 4:141868141-141868163 TGGGGCAATTGGACTTACATGGG + Intergenic
983089391 4:163486214-163486236 GTGTGAAAATGGACTAATATAGG - Intergenic
986821268 5:11469353-11469375 GTGGGTGACTGAACTGATATTGG - Intronic
987341981 5:16947355-16947377 GTGTGAAAATGGACTAATATAGG + Intergenic
996330911 5:122327745-122327767 GTGTGAAAACGGACTTATATAGG + Intronic
998670868 5:144351883-144351905 GTGGGGAACTGGAAAGATATTGG + Intronic
999100291 5:149018344-149018366 GTGGGAAAATGGACTAATATAGG - Intronic
1000772712 5:165376713-165376735 GAGGGCAACTGGAATAATAGAGG + Intergenic
1000781843 5:165492162-165492184 GTGAGCATGTGGACTTTTATTGG + Intergenic
1002801450 6:525854-525876 GTGGGGGACTGTACATATATTGG - Intronic
1003027624 6:2570721-2570743 GTAGACAAGTGGACATATATAGG - Intergenic
1009535082 6:64872114-64872136 GTTGTCAACTGTACTTATTTAGG - Intronic
1013934892 6:115582508-115582530 GTGGGTGACTGAACTTATAATGG - Intergenic
1014077779 6:117256573-117256595 GTGTGGAAATGGACTAATATAGG + Intergenic
1014182283 6:118398226-118398248 GAGGGCAACTGCACTTAAAAAGG + Intergenic
1017956877 6:159185963-159185985 TTGGGAAACTGGACTTGAATGGG + Intronic
1020034509 7:4956898-4956920 GTGGGCACTTGGACTTGTAAAGG - Intronic
1028308939 7:89304777-89304799 GTGGGGACTTGGACTTAGATGGG - Intronic
1029010539 7:97256976-97256998 GTGGGAAACTTGAGTTTTATTGG - Intergenic
1031183367 7:118444963-118444985 GTTGACAACAGGACATATATTGG + Intergenic
1046617128 8:116489983-116490005 GTGTGAAAATGGACTAATATAGG - Intergenic
1049455737 8:142685882-142685904 GCGGGCAATTCGCCTTATATTGG - Intergenic
1049482277 8:142831825-142831847 GTGGGCAATTCGCCTTATATTGG + Intergenic
1054326135 9:63713540-63713562 GTGGGCATCAGGCCTGATATTGG - Intergenic
1058291636 9:103249084-103249106 TGGGGCAATTGGACTTGTATAGG + Intergenic
1059846253 9:118280269-118280291 GTTGGGATTTGGACTTATATTGG - Intergenic
1061636107 9:131909461-131909483 GTGGGCCCCTGGACTTAAACAGG + Intronic
1186826166 X:13341947-13341969 GTGGGCAAGTGGAGTGATACCGG + Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1192273548 X:69607537-69607559 GTGGGCAGCTGGAGTCATTTTGG + Intergenic
1192539813 X:71958276-71958298 GTGGCCAAATGGACTTAGCTGGG + Intergenic
1199240635 X:145544227-145544249 GTGTGAAAATGGACTAATATAGG - Intergenic