ID: 966996199

View in Genome Browser
Species Human (GRCh38)
Location 3:185283032-185283054
Sequence CCTGCGGGCGGATCTGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966996189_966996199 -2 Left 966996189 3:185283011-185283033 CCTAGGATCCCCGACAGGTAACC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 39
966996192_966996199 -10 Left 966996192 3:185283019-185283041 CCCCGACAGGTAACCTGCGGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966996199 Original CRISPR CCTGCGGGCGGATCTGAACG GGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
902870758 1:19312337-19312359 CCTGGCGGCGGATCTGGACGTGG + Exonic
907028833 1:51150817-51150839 CCTGCAGGCTGATGTGAAAGAGG + Intergenic
1067416496 10:46106717-46106739 CCAGCGCGCGGCTCTGAACTTGG - Intergenic
1067436626 10:46283196-46283218 CCAGCGCGCGGCTCTGAACTTGG - Intergenic
1090267153 11:125360299-125360321 ACTGGGGCCGGATCTGAACAGGG + Intronic
1093435354 12:19129799-19129821 CATGGCGGCGGATCTGAACCTGG + Exonic
1098268333 12:68746135-68746157 GCTGCGGGCGGAGATGAGCGGGG + Exonic
1106248218 13:27966272-27966294 CCTGCAGGCGCATTTGAATGGGG + Intronic
1129739134 15:77981547-77981569 CCTGCGTGCGTATGTGAAGGTGG - Intergenic
1129846825 15:78771642-78771664 CCTGCGTGCGTATGTGAAGGTGG + Exonic
1131154691 15:90067668-90067690 CCCGAGGCCGGAGCTGAACGTGG + Exonic
1132519829 16:381968-381990 CCTGCGGGCGGAAGTGCCCGGGG - Exonic
1142956579 17:3527053-3527075 CCAGGTGGCGGATCTGAAAGGGG + Intronic
1143537279 17:7549062-7549084 CCGGCGGGCGGATCGGGCCGGGG - Exonic
1146924842 17:36736997-36737019 CCTTCTGGAGGATCTGAAGGAGG - Intergenic
1147674393 17:42194533-42194555 CCTGAGGGAGGAGCTGAAGGAGG + Intergenic
1151438672 17:74114445-74114467 CCTCCAGGCAGATCTGAACTGGG + Intergenic
1151857875 17:76736323-76736345 CCTTCGTGCGGATCTGGACTTGG + Exonic
1152160521 17:78665703-78665725 GCTGCGGGCGGCTGTGATCGTGG + Intergenic
1152419395 17:80183965-80183987 CCTGCAGGAGGAGCTGAACCAGG + Exonic
1157848927 18:51030049-51030071 CCGGCGGGCGGCTCTGAATCTGG - Intronic
1160568619 18:79801673-79801695 CCTTCAGGCTGATCTGAATGTGG + Intergenic
1162922620 19:13912521-13912543 CCTGCAGGCGGAGCTAAATGAGG + Exonic
1167636536 19:50659112-50659134 CCTGGGGGCGGAGCCGAACGAGG + Exonic
931163540 2:59720105-59720127 CCTGTGTGGGGTTCTGAACGTGG + Intergenic
932199082 2:69809980-69810002 CCAGGGGTCCGATCTGAACGTGG - Intronic
1172759803 20:37314106-37314128 GCTGTGGGCGGAACTGAAGGGGG + Intronic
1185087599 22:48749200-48749222 CCTGCTGGAGGATCTGAGGGAGG - Intronic
1185218163 22:49615420-49615442 CCTGCACGTGGATCTGGACGGGG + Intronic
966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG + Intronic
1002175785 5:177400378-177400400 CCTGCAGGCGGGCCTGAGCGTGG - Exonic
1002399976 5:178986292-178986314 CCTGCGGGCGGCACAGACCGCGG + Exonic
1005832191 6:29680209-29680231 CCTGCGGGCTTATCTGTACCCGG + Intronic
1011545466 6:88477849-88477871 GCTGAGGGCGGATCTGCATGGGG + Intergenic
1014944040 6:127475904-127475926 CCTGCAGGAGGAGCTGAAGGCGG - Exonic
1018995074 6:168704303-168704325 CCTGCGGAGGGATCTAACCGCGG - Intergenic
1029672035 7:102039974-102039996 CCTGCATGCAGCTCTGAACGTGG - Intronic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1045231428 8:100310226-100310248 GCTGCGGGCGGCTCTGGACGCGG + Intronic
1048970765 8:139643824-139643846 CCTGCGGGCCTACCTGAAGGTGG - Intronic
1061444933 9:130632353-130632375 CCTGCTGGCTGAGTTGAACGAGG - Intronic
1061817321 9:133205083-133205105 CCTGAGGGCGGCTCTGCAGGAGG + Intergenic