ID: 966996199

View in Genome Browser
Species Human (GRCh38)
Location 3:185283032-185283054
Sequence CCTGCGGGCGGATCTGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966996192_966996199 -10 Left 966996192 3:185283019-185283041 CCCCGACAGGTAACCTGCGGGCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 39
966996189_966996199 -2 Left 966996189 3:185283011-185283033 CCTAGGATCCCCGACAGGTAACC 0: 1
1: 0
2: 0
3: 1
4: 43
Right 966996199 3:185283032-185283054 CCTGCGGGCGGATCTGAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966996199 Original CRISPR CCTGCGGGCGGATCTGAACG GGG Intronic