ID: 967001088

View in Genome Browser
Species Human (GRCh38)
Location 3:185335617-185335639
Sequence ATAAGGAATCTGAACATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 9, 3: 40, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967001088 Original CRISPR ATAAGGAATCTGAACATCCT TGG (reversed) Intronic
900551364 1:3257838-3257860 ATAAGAAACTTGAGCATCCTTGG + Intronic
900742567 1:4339588-4339610 ATAAGGAATCTGAGGTTCCAAGG - Intergenic
901521481 1:9788268-9788290 ATAAAGAATTTGACCATTCTAGG + Intronic
902157045 1:14496335-14496357 CTGAGGAATGTGAACATTCTGGG + Intergenic
902173226 1:14629831-14629853 CTAAGGAAGCTGCACACCCTGGG + Intronic
902695002 1:18134347-18134369 ACAAGGAATCAGAACATCTCTGG - Intronic
903163679 1:21506871-21506893 AGAAGGAATCTGAACCTCGATGG + Intergenic
903292759 1:22325319-22325341 ATAAGGAAACTGAATCTCCTAGG - Intergenic
903426999 1:23261170-23261192 ATAAGGGGTCTGTACAGCCTGGG + Intergenic
903940758 1:26929560-26929582 ATAAGGGACTTGAGCATCCTCGG + Intronic
906467097 1:46091768-46091790 AAATGGACTTTGAACATCCTTGG - Intronic
907167013 1:52421679-52421701 ATCAGGGACCTGAGCATCCTTGG - Intronic
909067501 1:70953265-70953287 ATAAGGGATTTGAGCATCCTGGG + Intronic
910425798 1:87119114-87119136 ATTAGGAATGTGGACATCTTTGG - Intronic
911218215 1:95218723-95218745 ATCAGGAATTTGAGCACCCTTGG + Intronic
912338126 1:108882323-108882345 ATAAGGAACTTGAGCATCCATGG - Intronic
912459384 1:109820909-109820931 ATCAGGAACCTGAGCATCCGTGG + Intergenic
912768905 1:112444054-112444076 ATCAGCAATGTGAACATCATAGG - Intronic
912936513 1:114007847-114007869 ACAAGGAATCTTAACCTCTTTGG + Intergenic
913277177 1:117149709-117149731 AAAAGTACTCTGAACATACTTGG + Intronic
916361095 1:163969991-163970013 ATAAGGAAACTATACCTCCTGGG - Intergenic
917309740 1:173666440-173666462 ATAAGGCACTTGAACATCCATGG - Intronic
917598674 1:176554120-176554142 ATAAGGAAACAGGACATGCTGGG + Intronic
918088432 1:181265103-181265125 ATAAGAAATCTGACTACCCTGGG - Intergenic
918117324 1:181508531-181508553 ATAAGCCTTCTGAACAGCCTAGG - Intronic
918540766 1:185630023-185630045 GTAAGGGATATGAGCATCCTTGG - Intergenic
918669240 1:187193635-187193657 ATAAGTAAACTGCACATCATGGG + Intergenic
919319310 1:196014759-196014781 ATAAGGGATTTGAACATCCATGG + Intergenic
921264676 1:213412369-213412391 ATGAGGAAACTGAGCATGCTGGG + Intergenic
923173367 1:231438399-231438421 ATAAGGAACTTGAGCATCCATGG + Intergenic
923581344 1:235217707-235217729 AGAAGGACACTGAACATTCTTGG + Intronic
924405568 1:243742128-243742150 ATAAGGGACTTGAGCATCCTTGG + Intronic
924425964 1:243950510-243950532 ACAAGGTATCTGATCATCTTGGG + Intergenic
1063738253 10:8787120-8787142 ATCAGGTATCTGGGCATCCTTGG + Intergenic
1063785469 10:9378637-9378659 GGAAGGAATCTGAAGATCCAGGG - Intergenic
1065541552 10:26774065-26774087 ATGAGGGATTTGAGCATCCTTGG - Intronic
1069264553 10:66442255-66442277 ATAAGGAACTTGAACATCCATGG + Intronic
1069650815 10:70046799-70046821 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1069782912 10:70968016-70968038 AGCATGTATCTGAACATCCTCGG - Intergenic
1071035899 10:81245195-81245217 ATAAGGAACTTGAAAGTCCTTGG - Intergenic
1071062198 10:81585200-81585222 ATCAGGATTCTGGGCATCCTAGG + Intergenic
1072666491 10:97396697-97396719 ATAAGGGACCTGAGCATCCTCGG - Intronic
1074131334 10:110580200-110580222 ATAAGGGACTTGAGCATCCTTGG + Intronic
1074205946 10:111282723-111282745 ATAAGAAATTTGTACTTCCTGGG - Intergenic
1074351992 10:112746913-112746935 ATAAGGACTGTAAACATTCTTGG - Intronic
1076676561 10:132150003-132150025 ATGAAGAAGCTGGACATCCTGGG + Exonic
1077585514 11:3448788-3448810 ATAATGAATCTGAACATCACTGG - Intergenic
1077933569 11:6758869-6758891 AGTAGGAATGTGAACATCTTTGG + Intergenic
1077991563 11:7416711-7416733 ATAAGGGACCTGAGCATCCTTGG + Intronic
1078293943 11:10046134-10046156 ATAAAACATTTGAACATCCTCGG + Intronic
1078306591 11:10194404-10194426 ATAAGGAACTTGAGCATCCATGG + Intronic
1078508010 11:11966395-11966417 CTAAGGAGTCTGAACATCGTGGG + Intronic
1079050244 11:17149421-17149443 ATCAGGGATTTGAGCATCCTGGG + Intronic
1079592775 11:22200981-22201003 ATAAGGGACTTGAGCATCCTTGG - Intronic
1081018835 11:37917106-37917128 ATCAGGAATTTAAACATCCCTGG - Intergenic
1081300416 11:41444437-41444459 ATAAGGAACGTGAGCATCCATGG + Intronic
1082203510 11:49403468-49403490 ATAAGGAAACTGAAGAGACTGGG + Intergenic
1082693387 11:56331793-56331815 ATAAAGAAACTCACCATCCTGGG + Intergenic
1084830436 11:71764741-71764763 ATAATGAATCTGAACATCACTGG + Intergenic
1085231815 11:74978543-74978565 ATAAGGGACTTGAGCATCCTTGG - Exonic
1085347442 11:75777245-75777267 ATAAGGAATCTAAATAACTTAGG - Intronic
1085726066 11:78955679-78955701 TTAATGTAACTGAACATCCTGGG - Intronic
1085801212 11:79591413-79591435 TCAAGTAATCTGAACATTCTAGG - Intergenic
1086576612 11:88345708-88345730 ATCAGGCATCTGAATATTCTAGG + Intergenic
1086651522 11:89296644-89296666 ATAAGGAAACTGAAGAGACTGGG - Intergenic
1087947414 11:104179950-104179972 ATTAGCAATCTGACCATCTTTGG - Intergenic
1088604871 11:111519113-111519135 ATGAGGAAGCTGAGCATCCCAGG - Intronic
1088968403 11:114749396-114749418 ATAAGGGATTTGAACATCTGTGG - Intergenic
1089424278 11:118358659-118358681 GTAAGGAACTTGAGCATCCTTGG + Intergenic
1090191795 11:124776280-124776302 ATAAAGAGACTGAACTTCCTTGG - Intronic
1090557314 11:127890450-127890472 ATCAGTACTCTGAATATCCTTGG + Intergenic
1091442020 12:518348-518370 ATAAGGGACCTGAGTATCCTCGG - Intronic
1092054798 12:5499951-5499973 ATATGGAAAGTGAACATTCTTGG + Intronic
1092120424 12:6039820-6039842 GTGAGGAAACTGGACATCCTGGG + Intronic
1092760693 12:11808614-11808636 ATAAGGGATTTGAGCATCCTTGG + Intronic
1092888200 12:12943980-12944002 ATGAGGAATCTGAGGCTCCTAGG + Intronic
1093132600 12:15410241-15410263 ATCAGGTATCTGAGCATCCATGG - Intronic
1095457801 12:42407648-42407670 ATAAGGGATTTGAGCATCCATGG - Intronic
1097125848 12:56774282-56774304 ATAAGGGATTTGAGCATCCTCGG - Intronic
1097658581 12:62400302-62400324 ATAAGGAATTTGAACATCTGTGG - Intronic
1097879347 12:64672915-64672937 AGCAGGAATCTGAACATCAAGGG - Intronic
1098190364 12:67941671-67941693 TTAAAGAATCTCAACCTCCTGGG - Intergenic
1098451730 12:70626684-70626706 ATAAGGAATTTGAGCATCCTTGG + Intronic
1098482436 12:70981281-70981303 ATTAGGAATCTAAAGATCTTTGG + Intergenic
1098691574 12:73495781-73495803 ATAGGGAATTTGAAAATCCTGGG - Intergenic
1098896687 12:76070741-76070763 ATAAGGGACTTGAACATCCCAGG - Intronic
1099121657 12:78697060-78697082 ATAAGGAGTTTGAACATCCTTGG - Intergenic
1100019660 12:90053892-90053914 TTAAAGAATCAGAAAATCCTAGG + Intergenic
1101096046 12:101342070-101342092 ATAAGGGACTTAAACATCCTTGG + Intronic
1104307915 12:127626534-127626556 ATGAGGGACTTGAACATCCTTGG + Intergenic
1104827678 12:131725249-131725271 ATGAGGAGTCCGAACAGCCTGGG + Intronic
1104871701 12:132003402-132003424 ATAAGGGACTTGAGCATCCTTGG + Intronic
1105055156 12:133091884-133091906 ATAATGAATCTGAACATCACTGG - Intronic
1105995978 13:25672268-25672290 AAAGGGAGTCAGAACATCCTTGG - Intronic
1106354594 13:28968522-28968544 ATAAGGAATCTAAAGTTCCTGGG + Intronic
1106749100 13:32739856-32739878 ATAAGAAATCTGAAAATTATGGG - Intronic
1106788244 13:33128982-33129004 TTAATGAATCTGAGCCTCCTGGG - Exonic
1106852891 13:33814213-33814235 ATAAGGAATTTGAACATCCATGG + Intergenic
1107562202 13:41567572-41567594 AAAAGGAATCAAAAAATCCTTGG - Exonic
1109656322 13:65395608-65395630 ATAAGGAATTTGACTATCTTGGG + Intergenic
1109818262 13:67617079-67617101 ATAAGGGACTTGAACATCCATGG + Intergenic
1110348271 13:74475066-74475088 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1110454226 13:75672086-75672108 ATAAGGAACTTGAACATCCAGGG - Intronic
1110710007 13:78640276-78640298 ATCAGGAACTTGAACATCCATGG - Intronic
1110901333 13:80829313-80829335 AAGAGTAATTTGAACATCCTTGG + Intergenic
1111572575 13:90106599-90106621 ACAAGGAGTCTGAACTTCCCTGG + Intergenic
1112115692 13:96350713-96350735 ATAACGAAATTGAAAATCCTTGG + Intronic
1112770009 13:102784708-102784730 ATAAGGAACCCAAACATCCATGG + Intronic
1114033221 14:18594525-18594547 ATAAGGGACTTGAACATCCCAGG - Intergenic
1114125720 14:19723240-19723262 ATAAGGGACTTGAACATCCCAGG + Intronic
1114151364 14:20043408-20043430 ATATGGAACATGAACATACTAGG - Intergenic
1114936952 14:27550328-27550350 ATAAGGAATCTCAAGTTTCTAGG - Intergenic
1117078476 14:52127587-52127609 GTAAGGAATCAGAAGATCATGGG + Intergenic
1117367130 14:55040326-55040348 TTAAGGGATTTGAACATCCATGG - Intronic
1118467092 14:66040870-66040892 AAAAGGAATGTGAACATTTTAGG + Intergenic
1118510930 14:66472353-66472375 ATTTGGTAACTGAACATCCTTGG + Intergenic
1120195594 14:81478930-81478952 ACAAGGGCTCTGAACATCTTAGG + Intronic
1120345863 14:83289326-83289348 ATAAGGAATTTAAGCATTCTTGG - Intergenic
1122067197 14:99181951-99181973 ATAAGGAATCTACACATCTGAGG - Intronic
1123568961 15:21582539-21582561 ATAAGGGACTTGAACATCCCAGG + Intergenic
1123605070 15:22017860-22017882 ATAAGGGACTTGAACATCCCAGG + Intergenic
1123927961 15:25137054-25137076 ATAAGGGACTTGAACATCCATGG + Intergenic
1124225625 15:27891486-27891508 ATAAGGGACCTGAACATCTATGG - Intronic
1124457408 15:29857056-29857078 ATAAGGAACTTGAACATCCATGG + Intronic
1124939167 15:34202025-34202047 ATCAGGGATTTGAGCATCCTCGG + Intronic
1127163560 15:56218496-56218518 ATAAGGAATTTGAACATCCCTGG + Intronic
1127292951 15:57586498-57586520 GCAAGGAACCTGAATATCCTTGG - Intergenic
1127764051 15:62167407-62167429 ATAAGGAAATTGAACATCTGAGG + Intergenic
1128742532 15:70093903-70093925 AGAAGGAAGCTGAAGCTCCTGGG - Intronic
1129002333 15:72345103-72345125 ATAAGGGACTTGAGCATCCTTGG - Intronic
1202977315 15_KI270727v1_random:309629-309651 ATAAGGGACTTGAACATCCCAGG + Intergenic
1133068556 16:3229162-3229184 ATAATGAATTTGAGCATCCATGG + Intronic
1133189631 16:4124014-4124036 ATGATGAACCTGAACTTCCTCGG + Intergenic
1133491095 16:6268910-6268932 ATCAGGAACTTGAACATCCATGG - Intronic
1135963504 16:27016948-27016970 ATAAGGAACTTGAGCATCCATGG - Intergenic
1138639918 16:58377170-58377192 GTAAGGAAACTGACCATTCTGGG - Intronic
1139076505 16:63456537-63456559 ATAAGGGACATGAACATCCACGG + Intergenic
1139198973 16:64952953-64952975 ATAAGGACTTTGAACATCCTTGG - Intronic
1139232811 16:65302739-65302761 ATAAGGAATATGAGCATCTTTGG - Intergenic
1139241326 16:65395313-65395335 ATAAGGAAACTGAAGCTCCGAGG + Intergenic
1140166672 16:72559349-72559371 ATAAGGAACTTGGACATCCATGG - Intergenic
1140534272 16:75694889-75694911 ATCAGGAACTTGAGCATCCTTGG + Intronic
1142622053 17:1171471-1171493 ACAAGGACTCTGAGCTTCCTTGG + Intronic
1144252488 17:13431772-13431794 ATCAGGGATTTGAACATCCGTGG - Intergenic
1144265495 17:13564440-13564462 ATAAGGAACTTGAGCATCCATGG - Intronic
1145823043 17:27855202-27855224 ATAAGGGACTTGAGCATCCTAGG + Intronic
1146139684 17:30354703-30354725 AAAAGGAAAGTGAACATTCTTGG + Intergenic
1146966088 17:37031361-37031383 ATAAGGAACTTGAGCATCCGTGG + Intronic
1148919828 17:51020776-51020798 ATAAGGGACCTGAGCATCCATGG - Intronic
1149398137 17:56265676-56265698 ATAAGGGATTTGAGCATCCATGG - Intronic
1149503595 17:57174280-57174302 ATAAGGAATGTGACCTTCCATGG + Intergenic
1149888883 17:60368024-60368046 ATAAGAAACATGAGCATCCTTGG + Intronic
1151055897 17:71031152-71031174 ATAAAGAATCTGAACAGACAGGG + Intergenic
1154200976 18:12300577-12300599 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1155997796 18:32349923-32349945 ATGAGAAATGTGAACATTCTTGG + Intronic
1156235020 18:35194793-35194815 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1156710378 18:39936998-39937020 ACAAGAAATCAGAACAACCTTGG - Intergenic
1157278252 18:46327630-46327652 GTAAGGGACTTGAACATCCTTGG - Intronic
1157374966 18:47154091-47154113 ATAAGGACTATAAACATCATCGG + Intronic
1158316383 18:56215251-56215273 ATAATGAATCTAATCATCATAGG - Intergenic
1158970418 18:62661376-62661398 ATCAGGAACTTGAACATCCATGG + Intergenic
1163593489 19:18207215-18207237 ATAAGAAATATGAATATTCTAGG + Intergenic
1165528004 19:36372555-36372577 ATAAAAAATCTGAACAGGCTGGG + Intronic
1166017299 19:39992099-39992121 ATATGGGCTCTGAATATCCTAGG + Intronic
1167991295 19:53363441-53363463 ATAATGAGTCTGAGCATCATTGG + Intergenic
1168255679 19:55163607-55163629 ATAAGGGACTTGAGCATCCTTGG + Intronic
925853407 2:8106158-8106180 AAAATGAACCTGGACATCCTGGG + Intergenic
928502841 2:31915243-31915265 GTAAGATTTCTGAACATCCTGGG + Intronic
928642510 2:33315147-33315169 TTAATGAATGTGAACATCCAGGG + Exonic
930343547 2:50148839-50148861 CTAAGGAATGTGATAATCCTAGG + Intronic
930690041 2:54352684-54352706 ATAAGGAACTTGAACATCTGTGG - Intronic
931229325 2:60360847-60360869 ACAGTGAATCTTAACATCCTTGG - Intergenic
931638361 2:64360525-64360547 ATGAGGAATGTGGATATCCTAGG + Intergenic
931964021 2:67513716-67513738 ATAAGGGATTTGAGCATCCATGG + Intergenic
932005788 2:67925843-67925865 ATAAGGAACTTGAGCATCCTTGG + Intergenic
933037544 2:77419385-77419407 ATAAGGGACTTGAACATCCATGG - Intronic
935914280 2:107932484-107932506 AAAAGGAATCTGAAAATGGTAGG - Intergenic
937751205 2:125477802-125477824 ATCTGCAATCTGAAGATCCTGGG - Intergenic
939955695 2:148526312-148526334 ATAAGGAAATTGAGCATTCTGGG + Intergenic
940608742 2:155963387-155963409 TTAAGAACTCTCAACATCCTTGG - Intergenic
941585712 2:167355529-167355551 TTAAGGAATCTGAACTATCTAGG + Intergenic
942104877 2:172624166-172624188 AAAAGGATTCTGGACTTCCTTGG - Intergenic
942993110 2:182226698-182226720 ATTAGGAATCAGAAGAACCTTGG - Intronic
943165017 2:184311310-184311332 ATAGGAAATCTGAACATGATTGG + Intergenic
943563761 2:189493754-189493776 ATAAGTAATCTTAAAATTCTTGG + Intergenic
946149949 2:217757559-217757581 ATAAGGTATTTGAGCATCCATGG + Intergenic
946974875 2:225137336-225137358 TTAATGAATCTGAACTTACTGGG - Intergenic
947082670 2:226416243-226416265 ATAAGGAATTTGAACAGCACTGG - Intergenic
948223104 2:236289063-236289085 ATAAGGAACTTGATCAGCCTGGG + Intergenic
948417753 2:237826892-237826914 ATAAGGGACTTGAGCATCCTTGG + Intronic
948971359 2:241429870-241429892 ATAAGGAGTCTCAAACTCCTGGG - Intronic
1169515385 20:6311324-6311346 ATTGGGAATCTGAACAACCCAGG + Intergenic
1170012398 20:11739206-11739228 AGAATGAATGTCAACATCCTTGG + Intergenic
1171273745 20:23836695-23836717 ATAAGGAAGCTAAAAATCTTGGG + Intergenic
1173639635 20:44591679-44591701 ATAAGGAAGCTGAAGCTCATAGG - Intronic
1173789465 20:45818350-45818372 ATCAGCAATCTCAACATCTTGGG + Intergenic
1174691788 20:52513771-52513793 ATAGAGAATCGGAACATACTGGG - Intergenic
1176176860 20:63731964-63731986 ATAAGGGACTTGAGCATCCTTGG + Intronic
1176375716 21:6086073-6086095 ACAAGGATTCTGAACATGCCGGG + Intergenic
1178250530 21:30999414-30999436 ATAATGAATCTCTACTTCCTAGG + Intergenic
1179096304 21:38318739-38318761 ATAAGGAATTTGAGTATCCTTGG - Intergenic
1179406498 21:41130763-41130785 ATAAGGGATTTGAGCATCCTTGG - Intergenic
1179638197 21:42728230-42728252 ATAAGGAATTTGAGCATCCTTGG + Intronic
1179747758 21:43452171-43452193 ACAAGGATTCTGAACATGCCGGG - Intergenic
1180457335 22:15521580-15521602 ATAAGGGACTTGAACATCCCAGG - Intergenic
1181835241 22:25600672-25600694 ATAAGGGACTTGAGCATCCTAGG + Intronic
1181905236 22:26189692-26189714 ATAAGGAACTTGAGCATCCGTGG + Intronic
1182291386 22:29282672-29282694 ATAAGTCATCTGACCATACTTGG + Intronic
1183263078 22:36808633-36808655 CTAAGGAATCAGAAACTCCTGGG + Intronic
1184072936 22:42157260-42157282 ATAAGGAACCTGAGCATCCTTGG - Intergenic
949542228 3:5041897-5041919 AAAAAGAATCTGAACATCTGGGG - Intergenic
951366753 3:21792548-21792570 AGAAAGAATCTTTACATCCTTGG + Intronic
952386848 3:32848028-32848050 ATAAGGAACTTGAGTATCCTTGG + Intronic
954706657 3:52484595-52484617 CCAAGGAATCAGAACATCCCTGG - Exonic
956775859 3:72564964-72564986 ATCAGGAACCTGAGCATCCATGG - Intergenic
956900510 3:73711029-73711051 ATTAGGAACTTGAACATCCATGG + Intergenic
957069807 3:75558608-75558630 ATAACGAATCTGAACATCACTGG + Intergenic
957518910 3:81293740-81293762 ATAAGGAATGTGAACCTCAGAGG - Intergenic
957764098 3:84599025-84599047 ATAAAGAAACTGAACATTATTGG + Intergenic
958096548 3:88953045-88953067 AGAAGGAATCTCAACATCCTGGG + Intergenic
958423722 3:93957735-93957757 ATAAGTGATTTGAGCATCCTTGG - Intronic
958955573 3:100462742-100462764 ATAAGAGATATGAACATCATCGG + Intergenic
961055270 3:123782515-123782537 AGAAGGAATCTGAACATCCTGGG + Intronic
961578707 3:127860144-127860166 AAAAGGAATCTGAAGATGCATGG + Intergenic
963935061 3:151043809-151043831 ATCAGGAATCAGAACATTATTGG - Intergenic
964356008 3:155852693-155852715 ATAAGGAAGATGAACATTTTAGG - Intronic
965156551 3:165066256-165066278 ATAAGGAACTTGAGCATCCATGG + Intronic
965330898 3:167373286-167373308 ATAAGGAACCTGAGCATCCTAGG + Intronic
965663202 3:171064150-171064172 ATAAGGAATAATAACAACCTAGG - Intronic
967001088 3:185335617-185335639 ATAAGGAATCTGAACATCCTTGG - Intronic
967074332 3:185988667-185988689 ATCAGGGACCTGAAAATCCTAGG + Intergenic
967476793 3:189930810-189930832 ATAAGGAACTTGAGCATCCATGG - Intergenic
967743834 3:193032541-193032563 AGTAAGAATCTGAACATCTTAGG - Intergenic
969000699 4:3978708-3978730 ATAATGAATCTGAACATCACTGG - Intergenic
969092201 4:4703065-4703087 AGAAGGAGTCTGAACCTGCTGGG + Intergenic
969753315 4:9129984-9130006 ATAATGAACCTGAACATCACTGG + Intergenic
969813225 4:9666162-9666184 ATAATGAATCTGAACATCACTGG + Intergenic
970125256 4:12802430-12802452 ATAAGGAAACTTAGCACCCTGGG + Intergenic
970179314 4:13373275-13373297 ATAAAAAATCTGAACAATCTGGG + Intronic
970596095 4:17601625-17601647 ATAAGGGATGTGAGCATCGTGGG - Intronic
970965878 4:21927331-21927353 ATAAGGAATATGGACATCTTTGG + Intronic
971206247 4:24572434-24572456 TTAAAAAATCTGAACATTCTTGG - Intronic
971430985 4:26567197-26567219 ATAAGGAAACTGAAAATCGGAGG + Intergenic
971843805 4:31892716-31892738 ATAAGGGACTTGAACATCCGTGG + Intergenic
972059907 4:34856539-34856561 CTAAGGGATCTGAACTACCTTGG - Intergenic
972639587 4:40913507-40913529 ATATGGAATCTGCACATGATGGG - Intronic
973998603 4:56486007-56486029 ATAAGGGACTTGAGCATCCTTGG + Intronic
974433201 4:61825148-61825170 ATGTGGCATCAGAACATCCTAGG + Intronic
974450716 4:62054185-62054207 ATACTGAGTCTGAAAATCCTGGG - Intronic
974859753 4:67505489-67505511 ATAAGGGACTTGAGCATCCTTGG - Intronic
975547307 4:75573194-75573216 ATAAGGGTTCTGAACATCTTTGG - Intergenic
975867609 4:78740484-78740506 AGAAGGAATCTGTACATATTTGG - Intergenic
976546904 4:86346280-86346302 ATAACGGGTTTGAACATCCTTGG - Intronic
976576704 4:86680688-86680710 TTAAGGAATCTGTACTTCATTGG - Intronic
976768712 4:88627501-88627523 ATAAGGAATTTGAGCATCTATGG + Intronic
977472998 4:97465620-97465642 ATCAGGAACCTGAACATCTAAGG - Intronic
979018645 4:115467025-115467047 ATGAGGACTCTGAAGAACCTGGG - Intergenic
979691982 4:123569144-123569166 ATAAGGAAACTCAAGCTCCTTGG - Intergenic
979901262 4:126221453-126221475 ATCAGGCAGCTGAACATGCTGGG - Intergenic
980124255 4:128758497-128758519 ATAAGAAAGCTGCACATCCAGGG - Intergenic
981203470 4:142011397-142011419 AGATTGAATCTGAAAATCCTGGG - Intergenic
981880275 4:149602250-149602272 ATAAGGAATTTGAACATTACTGG + Intergenic
982336889 4:154250090-154250112 ATAAGAAATGTGAGCATCCATGG + Intronic
982861409 4:160454817-160454839 ATTAGGATATTGAACATCCTTGG + Intergenic
983090805 4:163499580-163499602 ATAAGGGACCTGAGCATCCATGG - Intronic
987618961 5:20313997-20314019 ATAATGAATCTTAACTTACTTGG + Intronic
988439008 5:31210634-31210656 ATAAGGGACTTGAGCATCCTTGG - Intronic
989277773 5:39609827-39609849 TTAAGGAATATGGACATGCTCGG + Intergenic
989280578 5:39638151-39638173 ATAAGGGATTTGAGCATCCTTGG - Intergenic
990795064 5:59530412-59530434 ATAAGGAACTTGAGCATCCATGG - Intronic
992711388 5:79460860-79460882 AGAAGGAATCTGAGTCTCCTGGG + Intronic
992880934 5:81109336-81109358 ATATGGAACTTGAACATCTTAGG - Intronic
992985936 5:82229792-82229814 ATAAGGGACTTGAACATCCATGG + Intronic
995445749 5:112241696-112241718 ATAAGGAATTTGAGCATTCTCGG + Intronic
997159217 5:131589543-131589565 ATAAGGAAGCTGAGCAGCCAGGG + Intronic
997403906 5:133627996-133628018 ACATGGAAACTGAACAACCTGGG + Intergenic
997555974 5:134799083-134799105 ATAAGGGACTTGAGCATCCTAGG + Intronic
997744181 5:136284420-136284442 CTAAAGAATATGAACATTCTGGG - Intronic
998449988 5:142226845-142226867 ATAAGAAAGGTGAACATCCCTGG + Intergenic
999752271 5:154637316-154637338 ATAATAAATCTGAACATCACTGG - Intergenic
999995787 5:157091009-157091031 CTAAGGAATCTCAACATCTAAGG + Intronic
1000287833 5:159843021-159843043 ATCAGGAATTTGAGCATCCTTGG + Intergenic
1001801943 5:174552216-174552238 ATAAGGAATCTCAAAATAGTAGG + Intergenic
1002958014 6:1887787-1887809 ATAAGGGAGTTGAGCATCCTTGG - Intronic
1003386664 6:5673859-5673881 ATAATGTATCTGTACATCTTAGG + Intronic
1003678259 6:8227093-8227115 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1003737534 6:8893642-8893664 ATAAAGAAGCTGAACATCAGAGG - Intergenic
1005265202 6:24105071-24105093 ATCAGGAATCTGAATTTCCGGGG + Intergenic
1005647885 6:27859257-27859279 ACAAGGGATTTGAACATCCAGGG + Intronic
1005983725 6:30857018-30857040 ATAAGTAACCTGAGCATCCCTGG + Intergenic
1006567249 6:34970494-34970516 ATAAGGGACTTGAGCATCCTTGG - Intronic
1006775551 6:36589726-36589748 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1007172646 6:39875006-39875028 AAAAGCAATCTGCACTTCCTGGG + Intronic
1010748289 6:79589000-79589022 ATAAGGAACTTGAATATCCTTGG - Intergenic
1013346639 6:109266637-109266659 ATAAGGAACTTGTGCATCCTTGG - Intergenic
1014034939 6:116755758-116755780 ATTAGCATTCTGAAAATCCTAGG + Intronic
1014116432 6:117673271-117673293 TTTAGGAGGCTGAACATCCTGGG + Intergenic
1014601801 6:123422166-123422188 ATAAGAGACCTGAACATCCTTGG + Intronic
1015101837 6:129490724-129490746 GCAAGGAAGCTGAACCTCCTGGG + Intronic
1017475281 6:154784726-154784748 ATAAGGGACGTGAGCATCCTCGG + Intronic
1017602516 6:156099355-156099377 ATAAGGAAACTGAAGCTCCAAGG - Intergenic
1017773016 6:157657651-157657673 GTAAGAAATCTCAACATCCTGGG + Intronic
1018694363 6:166380226-166380248 ATAAGGGATGTGAAAATACTTGG - Intronic
1020312578 7:6880019-6880041 ATTAGGAATTTCCACATCCTTGG + Intergenic
1021100316 7:16581092-16581114 ATAAAGTATCTGAACATATTTGG - Intronic
1022298318 7:29078492-29078514 ATAAAGAGTCTGAACACACTGGG + Intronic
1022953945 7:35364348-35364370 GGAAGGACTCTGAACATCCCAGG + Intergenic
1023114707 7:36851349-36851371 ATAAGGGACTTGAGCATCCTGGG + Intergenic
1025932351 7:66006014-66006036 ATAATGACTCTGAACATCAATGG - Intergenic
1026701438 7:72649880-72649902 ATAAAAATTCTGAACATCCCTGG - Intronic
1028507078 7:91582588-91582610 ATAAGGAACTTGAGCATCCATGG + Intergenic
1028672440 7:93418753-93418775 ATAAGGAACTTTAGCATCCTTGG + Intergenic
1030279480 7:107757387-107757409 AATAGGAATCTGAAGATCTTGGG - Intronic
1030581052 7:111356470-111356492 ATCAGGGATTTGAGCATCCTCGG + Intronic
1031497012 7:122462252-122462274 CTAAGGACTCTGAACTACCTAGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033680327 7:143587460-143587482 ATAAGGATCTTGCACATCCTTGG + Intergenic
1033704567 7:143874352-143874374 ATAAGGATCTTGCACATCCTTGG - Intronic
1034498297 7:151434624-151434646 ATCAGGAACTTGAGCATCCTCGG - Intronic
1036853011 8:12217823-12217845 ATAATGAATCTGAACAGCACTGG - Intergenic
1036874384 8:12460345-12460367 ATAATGAATCTGAACAGCACTGG - Intergenic
1037164569 8:15811093-15811115 ACAAGGAGTGTGAACATGCTTGG + Intergenic
1038599242 8:28922316-28922338 ATAAGGGATTTGAGCATCCATGG + Intronic
1038837636 8:31145330-31145352 ATTAGCATTCTGAAAATCCTAGG + Intronic
1039017875 8:33172710-33172732 GTAAGGAGTTTGCACATCCTTGG - Intergenic
1039407310 8:37324595-37324617 ATAAGGATCTTGAACATCCATGG + Intergenic
1040316730 8:46265392-46265414 ATAATGAATCTGAACATCACTGG - Intergenic
1040431967 8:47351839-47351861 ATCAGGAACTTGAGCATCCTTGG + Intronic
1041595554 8:59646621-59646643 ATAAGGAACTTGAGCATCCATGG - Intergenic
1041641242 8:60204600-60204622 ATAGGTATTCTGAGCATCCTTGG + Intronic
1041880879 8:62748801-62748823 ACAGGGAATCTGATCATTCTAGG + Intronic
1042118657 8:65460173-65460195 AAAGAGAATCTGAACATTCTTGG + Intergenic
1042299274 8:67258914-67258936 ATAAGGAACTTGAGCATCCATGG - Intronic
1042906210 8:73774701-73774723 ATAAGGAATGTCAACAGTCTTGG - Intronic
1042998799 8:74732305-74732327 AGAAAGAATTTGAACATCCATGG + Intronic
1043103267 8:76074411-76074433 GTAATGAAACTGAAGATCCTAGG + Intergenic
1043460018 8:80450153-80450175 ATAAGGGACTTGAACATCCATGG - Intergenic
1044305113 8:90630702-90630724 AAAAAAAATCTGTACATCCTAGG + Intronic
1046526042 8:115383222-115383244 ATAAGGAATTTGAGCATCTGTGG - Intergenic
1046989143 8:120429760-120429782 ATCAGGGATATGAACATCCCTGG - Intronic
1047867547 8:129043489-129043511 ATCAGGAACTTGAGCATCCTTGG - Intergenic
1048300397 8:133247150-133247172 TTAAGCATTTTGAACATCCTGGG - Intronic
1049150716 8:141033882-141033904 GTAAGCAACTTGAACATCCTTGG + Intergenic
1049876169 8:145022598-145022620 ATAATGAATCTGAACATCACTGG - Intergenic
1050371746 9:4929088-4929110 CTAAGGAATTTGAGCATCCTTGG - Intergenic
1052574683 9:30277373-30277395 AAAAGGAACTTGAACATCCATGG - Intergenic
1053448966 9:38177324-38177346 ATAAGGAACTTGAACATCCGTGG - Intergenic
1056120292 9:83480846-83480868 ATAAGGGACTTGAGCATCCTCGG + Intronic
1056384372 9:86083170-86083192 ATAAGAGACTTGAACATCCTTGG - Intronic
1057555109 9:96081864-96081886 ATCAGCAACCTGCACATCCTTGG - Intergenic
1058404201 9:104653323-104653345 ATAAGGAACTTGAACATCCATGG - Intergenic
1059163587 9:112058232-112058254 ATATGGATTCTGAACCACCTGGG - Intronic
1061155199 9:128856093-128856115 ATAATGAATCTGAACATCACTGG + Intronic
1062132551 9:134907379-134907401 ATAAAGAAACTGCACATGCTTGG - Intronic
1062689903 9:137836214-137836236 AAAAGGAAGCTGTACTTCCTTGG - Intronic
1185747145 X:2582903-2582925 TTAAGGAAACTAAAAATCCTAGG - Intergenic
1186925782 X:14331904-14331926 ATAAGGAACTTGAGCTTCCTTGG + Intergenic
1186930108 X:14379940-14379962 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1187633383 X:21200167-21200189 ATATTTAATCTGAACAACCTGGG - Intergenic
1187656172 X:21476665-21476687 AAAAGGAGACTGAACATCTTGGG + Intronic
1188482611 X:30650781-30650803 ATAAGGCATTTGAGCATTCTCGG - Intergenic
1189454567 X:41174288-41174310 ATAAGGTATTTGAGCATCCCTGG + Intronic
1190832858 X:54074896-54074918 ATAAGAAAACTGAAGCTCCTAGG + Intronic
1191661133 X:63652504-63652526 ATAAGGGATTTGAGCATCCATGG + Intronic
1192308613 X:69989367-69989389 ATCAGGAAGCTGAACATACTTGG + Intronic
1195683034 X:107563020-107563042 ACGAGGAGTCTCAACATCCTAGG - Intronic
1197366581 X:125571370-125571392 ATAAGGAGTCTAAATATCCAAGG + Intergenic
1198636017 X:138701248-138701270 ATAAGGAAACGGAATATACTGGG - Intronic
1200752532 Y:6959752-6959774 ATAATGAATCTAAACATCACTGG - Intronic
1201918778 Y:19211712-19211734 ATAAGGGCCTTGAACATCCTTGG - Intergenic