ID: 967006070

View in Genome Browser
Species Human (GRCh38)
Location 3:185383618-185383640
Sequence CAGTATGTGCAGAAATTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 2, 1: 3, 2: 22, 3: 125, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967006070_967006075 5 Left 967006070 3:185383618-185383640 CCATGTAATTTCTGCACATACTG 0: 2
1: 3
2: 22
3: 125
4: 461
Right 967006075 3:185383646-185383668 CCTTCACCATCTGCCATAAGTGG 0: 2
1: 5
2: 91
3: 305
4: 730
967006070_967006078 18 Left 967006070 3:185383618-185383640 CCATGTAATTTCTGCACATACTG 0: 2
1: 3
2: 22
3: 125
4: 461
Right 967006078 3:185383659-185383681 CCATAAGTGGAAGCAACCTGAGG 0: 2
1: 14
2: 231
3: 540
4: 1509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967006070 Original CRISPR CAGTATGTGCAGAAATTACA TGG (reversed) Intronic
900688616 1:3965700-3965722 CAGTTTATGCAGAAATTTCTAGG - Intergenic
904588303 1:31592539-31592561 CAGTTTATGCAGAAATTTCTAGG - Intergenic
904714386 1:32456241-32456263 CAGTTTGTGCAGAAATTTCTAGG - Intergenic
904919640 1:33997031-33997053 CAGTATGTGATGAACTGACATGG - Intronic
905660016 1:39714630-39714652 CAGTTTGTGCAGAAATTTCTAGG - Intronic
907695631 1:56725040-56725062 GAGAATGTGCAGACATCACATGG - Intronic
908199503 1:61779868-61779890 CAGTGTGTGCAGAGATCACGTGG + Intronic
908371823 1:63489760-63489782 CATCATGTGCATAAATTAAAGGG - Intronic
908390594 1:63679977-63679999 CAGTGTGTGCAGAGATCACATGG - Intergenic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
909115929 1:71536426-71536448 CAGTGTGTGAAGAGATCACATGG - Intronic
909402014 1:75243990-75244012 TGGCATGTGCAGAAATTACATGG - Intronic
909685138 1:78339437-78339459 CAGTATTTGCTGAAAGTAGAAGG - Intronic
910270406 1:85387918-85387940 CATTGTGTGCAGACATCACATGG + Intronic
910348939 1:86273918-86273940 CAGTAGGTGCAGAAAGCTCAAGG - Intergenic
910552190 1:88487960-88487982 CAGTAAGTGCAAAAATCAAAAGG - Intergenic
911819871 1:102404361-102404383 CAGCATCTGCAGAGATCACATGG + Intergenic
912971404 1:114287076-114287098 CAGTTTATGCAGAAATTTCTAGG + Intergenic
913034328 1:114947852-114947874 CAGTATTTGCAGAAAAAAAAGGG - Intronic
913116146 1:115699150-115699172 CAGTGTGTGCAGAGATCACATGG - Intergenic
913352478 1:117876299-117876321 CAGTATGTGCAGGGATCTCATGG - Intronic
913544191 1:119851181-119851203 CAGTGTGTGCAGAGATCATATGG + Intergenic
913991590 1:143618097-143618119 CAGTGTGTGCAGAGATCATATGG + Intergenic
914382839 1:147134203-147134225 CAGTGTGTGCAGAGATTATATGG + Intergenic
914439085 1:147687297-147687319 CAGTGTGTGCAGACATCACATGG - Intergenic
916884933 1:169058140-169058162 CAGCACGTGCAGAAATCACATGG - Intergenic
916976000 1:170079246-170079268 CAGCATGTGCAGTGATCACATGG - Intronic
917068448 1:171123332-171123354 TGATGTGTGCAGAAATTACATGG + Intergenic
917541876 1:175922350-175922372 CGGCATGTGCAGAGATCACATGG + Intergenic
917658522 1:177153268-177153290 CAGAGTGTGCAGAGATTACCTGG - Intronic
917723741 1:177811009-177811031 CAGTGTGTGCAGAGATCACATGG + Intergenic
917813037 1:178679006-178679028 CATCTTGTGCAGAAATCACATGG + Intergenic
917966364 1:180181474-180181496 CAGTATGTGCAGTAGTCAGAGGG - Intronic
918907458 1:190515225-190515247 CAGTGTGTACAGAGATCACATGG - Intergenic
919252966 1:195083117-195083139 CAGCATGTACAGAGATCACATGG + Intergenic
919964332 1:202506445-202506467 CACTAGGTCCAAAAATTACAGGG - Intronic
921044827 1:211468161-211468183 CTGTGTGTGCAGAAATCACATGG - Intergenic
921261163 1:213386196-213386218 CAGCATGTGCAGAGATCCCATGG - Intergenic
921346867 1:214195362-214195384 CATTCTCTCCAGAAATTACAGGG - Intergenic
921906182 1:220497650-220497672 TAGAATGTGCATAAATTGCAGGG - Intergenic
922178873 1:223218020-223218042 CTGCATGTGCAGAGATTACATGG - Intergenic
922689626 1:227677980-227678002 CATTAGGGGCAGAAATCACAGGG + Intergenic
922862258 1:228829632-228829654 CAGAGTGTGCAGAGATCACATGG + Intergenic
923014211 1:230113359-230113381 CAGTTTGCGCAGCACTTACATGG + Intronic
923223806 1:231920765-231920787 AAGTATGTACTAAAATTACATGG - Intronic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
923468582 1:234269852-234269874 CAGTGTGTGCAGAGATCACGTGG - Intronic
923868643 1:237966692-237966714 CAGTATGTACATATATTATATGG + Intergenic
924938528 1:248792809-248792831 CAGTATGTGCAGTATTCTCAAGG - Intergenic
1063897816 10:10700708-10700730 CAATTTGAGAAGAAATTACAAGG - Intergenic
1064259580 10:13774461-13774483 CCGGAAGTGCAGGAATTACATGG + Intronic
1064359891 10:14655072-14655094 TGGCATGTGCAGAGATTACATGG + Intronic
1064494044 10:15888739-15888761 TGGTATGTGCAGAGATCACACGG - Intergenic
1064893325 10:20205434-20205456 CAAAATGGACAGAAATTACATGG - Intronic
1065244794 10:23746248-23746270 CAGTGTGTGCAAAGATCACATGG - Intronic
1065701824 10:28433102-28433124 CAGCATCTGCAGAATTTAAAAGG + Intergenic
1065722548 10:28640818-28640840 CAGCATGTGCAGAGATCACATGG - Intergenic
1066383425 10:34921126-34921148 CAGTGTGTGCGGAGATCACATGG + Intergenic
1066501646 10:36000716-36000738 CAGTGTGTGCAGAGATCACATGG - Intergenic
1066629494 10:37445045-37445067 CAGTGTGTGCAGAGATCATATGG - Intergenic
1067518172 10:46973198-46973220 CAGCATATGCAGAGATCACATGG + Intronic
1067518402 10:46974694-46974716 CAGCATGTGCAGAGATTACATGG + Intronic
1067643847 10:48077134-48077156 CAGCATGTGCAGAGATTACATGG - Intergenic
1067644077 10:48078630-48078652 CAGCATATGCAGAGATCACATGG - Intergenic
1068178238 10:53489495-53489517 TGGTATGTGCAGAGATCACATGG + Intergenic
1068412814 10:56679483-56679505 CGGTATGTACCGAAATTAGAAGG - Intergenic
1068443510 10:57090569-57090591 CAGTATGTACAGTAACTACTTGG - Intergenic
1068497648 10:57805573-57805595 CAGCATGTCCAGAGATCACATGG + Intergenic
1068774789 10:60857970-60857992 CAATGTGTGCAGAAATCACATGG + Intergenic
1070874740 10:79792593-79792615 CAGTGTGTGCAGAGATCACAGGG - Intergenic
1071641667 10:87314762-87314784 CAGTGTGTGCAGAAATCACAGGG - Intergenic
1072036826 10:91570417-91570439 CAGTGTGTGCAGAGATCACATGG - Intergenic
1072477115 10:95773036-95773058 CAGAGTGTGCAGAGATCACATGG + Intronic
1072750978 10:97978559-97978581 CAGCTTGTGCAGAAATTCCTAGG - Intronic
1073194243 10:101675154-101675176 AAGTGTGTGCATATATTACATGG + Intronic
1073841911 10:107507350-107507372 CAGTGTGTGAAGAGATCACATGG - Intergenic
1073924465 10:108499122-108499144 CAGTGTGTGCAGAGATCACATGG + Intergenic
1074496757 10:113986419-113986441 CTGTAAGTGCAGAAAGCACATGG - Intergenic
1074603672 10:114939389-114939411 CACAAGGTGCAGAAATTACTAGG - Intronic
1076501109 10:130936711-130936733 ACTTATGTGCAGAAATAACAAGG - Intergenic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077773520 11:5246932-5246954 CTGTATGTAAAGACATTACAAGG + Intergenic
1077902769 11:6503021-6503043 GAGTATGTGGAGAAAGGACAGGG - Intronic
1078121052 11:8509151-8509173 CAATATGTTCAGACATTAAATGG + Intronic
1078415927 11:11164828-11164850 CAGCCTGTGCAGAGATCACATGG + Intergenic
1078443255 11:11385087-11385109 CAGGATGTACAGAGATCACATGG + Intronic
1078707853 11:13762310-13762332 CACGATGTACAAAAATTACAAGG - Intergenic
1078780033 11:14429437-14429459 CAAGATATGCAGAAATTCCATGG - Intergenic
1079539023 11:21549873-21549895 CAATTTGTGCAGAAATGACTGGG + Intronic
1080450937 11:32378385-32378407 AAGGATGTGCAGGAATTAAAAGG - Intergenic
1080477680 11:32610627-32610649 AAGTATTTGTAGAAATTATATGG - Intronic
1081024164 11:37988074-37988096 CAGCATGTGCAGAGATCAGATGG - Intergenic
1082827825 11:57593645-57593667 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1083699086 11:64462718-64462740 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1085110912 11:73886983-73887005 CAGTGTATGCAGAGATCACATGG - Intronic
1085719423 11:78899770-78899792 CAGTATGTGCAGAGATCACATGG - Intronic
1085924226 11:80996509-80996531 CAGCATGTACAGAAAATAGAGGG - Intergenic
1086615634 11:88815633-88815655 TTGTATGTGCAGAGATCACAAGG + Intronic
1086820863 11:91434262-91434284 CAGCATGAGCAGAAATAACATGG + Intergenic
1086897432 11:92329389-92329411 CAGCATGTGCAGAGATCACGTGG - Intergenic
1087027401 11:93663023-93663045 CAGTATTTTCAAAAATGACAGGG + Intronic
1087159573 11:94935677-94935699 CTGTGAGTGCAGAAATCACATGG - Intergenic
1087369626 11:97266470-97266492 CAGCATGTGCAGAGATCACATGG + Intergenic
1088294633 11:108278631-108278653 CAGTGTGTGCAGAGATCACATGG + Intronic
1088351399 11:108892304-108892326 AAGCTTGTGCAGAGATTACATGG - Intronic
1088391212 11:109316882-109316904 TAGTATGACCTGAAATTACATGG - Intergenic
1088445942 11:109928625-109928647 CAGCATGTGCAGAGATCACATGG - Intergenic
1088733543 11:112706066-112706088 TGGTATGTGCAGACATCACATGG + Intergenic
1089925751 11:122255697-122255719 GAGTATGTGCAGAGATCACATGG - Intergenic
1089940421 11:122410830-122410852 CAGCCTGTGCAGAAATCACATGG + Intergenic
1090474774 11:127009998-127010020 CTGAGTGTGCAGAGATTACAAGG + Intergenic
1090622143 11:128569730-128569752 GAGTATGTGAAAAAATTAAAGGG + Intronic
1090697964 11:129267842-129267864 CAGCATGTGCAGAGATCACATGG + Intronic
1091014421 11:132037281-132037303 CGGCATGTGCAGAAATCACAGGG - Intronic
1091610870 12:2007516-2007538 GTGTCTGTGCTGAAATTACATGG + Intronic
1093783265 12:23161873-23161895 CAGAATGTACAGAGATAACATGG + Intergenic
1094030522 12:26007034-26007056 CAGCGTGTGCAGAGATCACATGG + Intronic
1094156925 12:27346979-27347001 CAGAGTGTGCAGAGATCACATGG - Intronic
1095320503 12:40820143-40820165 CAGCATGTGCAGAGATGACATGG + Intronic
1095492787 12:42752790-42752812 AAGTATGTGCAAAATTTTCAAGG + Intergenic
1096755947 12:53799672-53799694 CAGTTTGTGCAGAGATCACATGG + Intergenic
1097474505 12:60036760-60036782 CAGTGTGTGCAGAGATCACATGG - Intergenic
1097710724 12:62914244-62914266 CAGCATGTGCAGAGGTCACATGG - Intronic
1098096106 12:66957903-66957925 CAGTATCTGCATAAATTATCTGG + Intergenic
1098882256 12:75928516-75928538 TGGCATGTGCAGAGATTACAGGG - Intergenic
1098961686 12:76745681-76745703 CTGTATGTTCAGAGATCACATGG - Intergenic
1099307139 12:80971516-80971538 CAGTTTATGCAGAAATTTCTAGG + Intronic
1099419858 12:82443718-82443740 CAGCATGTGCAGAAACCACATGG + Intronic
1099916650 12:88903402-88903424 TAGGATGTGTAGGAATTACAAGG + Intergenic
1100778282 12:97996190-97996212 CAGTGTGTGCAGAGATCACATGG - Intergenic
1101221181 12:102642380-102642402 TGGCATGTGCAGAGATTACATGG - Intergenic
1101259958 12:103019030-103019052 CAGTGTGTGCAGAGATCACATGG + Intergenic
1101630736 12:106491581-106491603 GAGTATCTGCAGAAAGTAAAAGG + Intronic
1101637941 12:106561762-106561784 CAGTGTGTGCAGAGATCACAGGG - Intronic
1102162011 12:110777017-110777039 CAGTGAGTGCAGAGATTACAAGG + Intergenic
1102841088 12:116123289-116123311 CTGTATGTTCAGAAATTACAAGG + Intronic
1102905684 12:116673662-116673684 CAGTTTATGCAGAAATTTCAAGG + Intergenic
1102921917 12:116797836-116797858 CAGTTTATGCAGAAATTTCCAGG + Intronic
1104172817 12:126298907-126298929 CAGTGTGTGCAGAGATCACATGG + Intergenic
1104396513 12:128438397-128438419 CGGTGTGTGCAGAGATCACATGG - Intronic
1105303857 13:19155944-19155966 AAGTGTGTGCAGAAAGCACATGG + Intergenic
1105786093 13:23750707-23750729 GAGTATGTACATAAATTACTTGG + Intronic
1106588164 13:31074998-31075020 CAGTGTGTGCAGAGATCACATGG - Intergenic
1106746017 13:32708064-32708086 CAGTTTATGCAGAAATTCCTAGG - Intronic
1106828097 13:33545772-33545794 CAGCATGTGCAGAGATCACATGG - Intergenic
1107034190 13:35883417-35883439 TGGTATGTGCAGAGATCACATGG - Intronic
1108452041 13:50576612-50576634 CAGACTCAGCAGAAATTACACGG - Intronic
1108461275 13:50669877-50669899 TGGCATGTGCAGAAATCACATGG - Intronic
1108599448 13:51979201-51979223 CAATATGGGCAGGAATTACACGG + Intronic
1108879274 13:55089389-55089411 TGGCATGTGCAGACATTACATGG - Intergenic
1109001205 13:56808248-56808270 CTGAGTGTGCAGAGATTACATGG + Intergenic
1109181214 13:59216194-59216216 TGGTATGTCCAGAGATTACATGG + Intergenic
1109371661 13:61428699-61428721 CAGTACATACAGAGATTACATGG - Intergenic
1109423399 13:62142937-62142959 CAGCATGTGCAGAGATCACATGG - Intergenic
1109716173 13:66225394-66225416 CAGCGTGTGCAGAGATCACATGG - Intergenic
1109811501 13:67519116-67519138 CAGCATGTGCAGAAATCACATGG - Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1109882285 13:68495366-68495388 CAGCATGTACAGAAATCACATGG + Intergenic
1109978387 13:69872196-69872218 CAGCATGTGCATAGATCACATGG + Intronic
1110182654 13:72635907-72635929 CAGCATGTGCAGGGATCACAAGG - Intergenic
1110700184 13:78537913-78537935 CAGAATGTGAAGGGATTACAAGG + Intergenic
1110734559 13:78920895-78920917 CCCTAAGTGCAGAAATTACAGGG - Intergenic
1110959120 13:81598315-81598337 CAGCATGTACAGAGATCACAAGG - Intergenic
1111878508 13:93925842-93925864 CAGTATGTGGAGAAGATCCAAGG - Intronic
1111907717 13:94274614-94274636 CTGAATGTGGACAAATTACAAGG + Intronic
1112789923 13:102991937-102991959 CAGTAGGGGCAGAAATGATAAGG + Intergenic
1113123023 13:106944433-106944455 AAGCATGTGCACAAATAACAGGG + Intergenic
1113592152 13:111508544-111508566 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1114917851 14:27289373-27289395 CAGAATTTGCATAAATAACAAGG - Intergenic
1116539947 14:46089638-46089660 CAGCATTTGAAGAGATTACATGG + Intergenic
1116631402 14:47339617-47339639 CAGCATGTGCAGTGATTACATGG - Intronic
1119775688 14:77247085-77247107 CTTTATGTGCACAAAATACATGG + Intronic
1120506232 14:85356056-85356078 CTGTGTGTGCAGAGATCACATGG - Intergenic
1120733705 14:88030323-88030345 CAGTATGTGCAGAGATCACATGG - Intergenic
1120768413 14:88353208-88353230 GAATATGAGCAGAAATGACATGG + Intergenic
1120861563 14:89259529-89259551 AAGGAAGTGCAGAAATTATAAGG - Intronic
1121032239 14:90668188-90668210 CAGAATAGGTAGAAATTACAAGG + Intronic
1121210403 14:92204084-92204106 CTGTGTGTGCAGAGATCACATGG - Intergenic
1121215405 14:92243977-92243999 CAGCATGTGCAGAGATCACATGG + Intergenic
1121215706 14:92246102-92246124 CAGTGTGTGCAGAGACCACATGG + Intergenic
1121618059 14:95327036-95327058 CAGTTTGAGCAGAAATTTCTAGG + Intergenic
1121903298 14:97714820-97714842 AAATATGTGCAAAAAATACAGGG + Intergenic
1122074437 14:99226933-99226955 TAGTATATGCTGAAATCACAGGG - Intronic
1122390693 14:101380640-101380662 CGGTGTGTGCAGAGATCACATGG + Intergenic
1122743191 14:103883423-103883445 CAGGATGTACAGAAACTCCAAGG + Intergenic
1123100245 14:105792907-105792929 TGGTATGTGCAGAGATCACATGG + Intergenic
1123794267 15:23755914-23755936 CAGCGTGTGCAGAGATTACATGG + Intergenic
1124323103 15:28731131-28731153 CAGAAAGTGCAGAAATTGAACGG + Intronic
1124527000 15:30464280-30464302 CAGAAAGTGCAGAAATTGAACGG + Intergenic
1124705710 15:31962206-31962228 CTGTATGTGCAGAGATCACATGG - Intergenic
1124771653 15:32543403-32543425 CAGAAAGTGCAGAAATTGAACGG - Intergenic
1125848726 15:42884377-42884399 CAGTCACTTCAGAAATTACAAGG - Intronic
1127078183 15:55348633-55348655 CAGTTTGTGCAGAGATCACATGG - Intronic
1127314569 15:57782699-57782721 CTGTAAGTGTAGAAATTACAAGG - Intronic
1127553362 15:60063071-60063093 CAGCATGTGCAGAAATGATGGGG - Intergenic
1130552581 15:84900537-84900559 CACAAAGTGCTGAAATTACAGGG - Intronic
1131340843 15:91599221-91599243 CAGTATGTGCAGAGAGTCCAGGG - Intergenic
1131725192 15:95214371-95214393 CAGCATGTGCAGAGATTACATGG - Intergenic
1131866077 15:96711539-96711561 CAGTAAATGCAGAATTAACATGG - Intergenic
1131866815 15:96720079-96720101 CAGCATGTTCAGAAATTTCCTGG - Intergenic
1131984920 15:98033517-98033539 CTGTCTGTGCAGAGATCACATGG + Intergenic
1133065264 16:3201868-3201890 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1133821472 16:9240978-9241000 TGGTGTGTGCAGAGATTACATGG - Intergenic
1135670034 16:24367460-24367482 CGGCATATGCAGAGATTACATGG - Intergenic
1135685824 16:24497647-24497669 TGGTATGTGCGGAGATTACATGG - Intergenic
1135793375 16:25419241-25419263 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1135817944 16:25653014-25653036 CAGCATGTGCAGAGATTGCATGG + Intergenic
1135940464 16:26817590-26817612 CAGCATGTGCAAAAGTCACATGG - Intergenic
1137518887 16:49174765-49174787 CAGTATGTAAACAAATCACAGGG + Intergenic
1137909738 16:52364843-52364865 CAGAATATGGATAAATTACAGGG - Intergenic
1138124223 16:54425678-54425700 CAGTATGTTCAGAAACTCCCTGG - Intergenic
1138612578 16:58138393-58138415 TAGCATGTGCAGAGATCACATGG - Intergenic
1140029831 16:71326788-71326810 CATTCTGGGCAGAAATTACCAGG - Intergenic
1140494902 16:75376880-75376902 CAGTTTATGCAGAAATTTCTAGG - Intronic
1140757343 16:78079649-78079671 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1140870161 16:79099052-79099074 CAGTGTGTGCAGAGATCACATGG + Intronic
1140986029 16:80158784-80158806 AAGTAAGTGCAGCATTTACACGG - Intergenic
1141978151 16:87531963-87531985 CAGTTTTTGCAAAAATTCCATGG + Intergenic
1142162610 16:88566426-88566448 CAGTTTATGCAGAAATTTCTGGG - Intergenic
1144214014 17:13038821-13038843 CAGTGTGTGCAGAAATCACATGG - Intergenic
1146759452 17:35463975-35463997 CAGTGTGTGCAGAGATCACAAGG + Intergenic
1147901098 17:43785390-43785412 CGGTTTGTGCAGAAATTCTAGGG + Exonic
1148259108 17:46163909-46163931 CAGTATAGGCAGAAAGCACAGGG - Intronic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1149270745 17:54974886-54974908 CAGTTTATGCAGAAATTTCTAGG + Intronic
1149619592 17:58033465-58033487 CAGCATGTGTAGAGATTGCATGG + Intergenic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1150717266 17:67582724-67582746 AAGTATGTGCATAAAATAAATGG - Intronic
1150841488 17:68611020-68611042 CAGTGTGTACAGAGATTACATGG - Intergenic
1150890843 17:69147639-69147661 CAGCATGTGCAAAGATCACATGG + Intronic
1151077932 17:71295862-71295884 AAGCATGTGCAGAGATCACATGG + Intergenic
1154295748 18:13145792-13145814 CAGCATGTGCAGAGATCACATGG + Intergenic
1154295903 18:13147444-13147466 CAGCATGTGCAGAGATCACACGG - Intergenic
1155765703 18:29629734-29629756 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1155999497 18:32369372-32369394 CTGTCTGTGCTGAAATTAGAAGG - Intronic
1156233427 18:35177863-35177885 CAGTATGTGCAGATAGTGCTGGG - Intergenic
1156345330 18:36252164-36252186 CAGTTTGTTCAGATATTACCTGG + Intronic
1156356256 18:36343646-36343668 CAGCATGTGCAGAGATCACACGG - Intronic
1156535901 18:37864259-37864281 GAGCATGTGCAGAGATCACATGG + Intergenic
1156976734 18:43231093-43231115 TAGTATGTGCAAATATTACACGG - Intergenic
1158143263 18:54280291-54280313 CAGTGTGTGCAGAGATCACATGG + Intronic
1158290126 18:55931550-55931572 CAGAGTGTGCAGAGATCACAGGG - Intergenic
1158929811 18:62312947-62312969 CAGTGTGTGCATAGATCACAAGG + Intergenic
1159131888 18:64288979-64289001 CAGCATGTGCAGAGGTCACATGG + Intergenic
1159399438 18:67911578-67911600 CAGTATGTGCAGAAATTACATGG - Intergenic
1159898908 18:74023576-74023598 TTGTATGTGCAGACATCACATGG - Intergenic
1161862028 19:6805066-6805088 CAGTTTATGCAGAAATTTCCAGG + Intronic
1165181279 19:33973079-33973101 CAGTGTGTGCAGAGACCACACGG - Intergenic
1165426227 19:35746843-35746865 CAGTATGTGCAGAAGTTGTCAGG - Exonic
1165661089 19:37580728-37580750 CAGTGTGTGCAGAGATCACATGG - Intronic
1166021081 19:40030259-40030281 CAGTGTATGCAGACATCACATGG + Exonic
1166024549 19:40069275-40069297 CAGTGTATGCAGACATCACATGG + Intronic
925485736 2:4328299-4328321 TGGTCTGTGCAGAGATTACATGG + Intergenic
925708185 2:6710577-6710599 CAGTGTGTGCAGAGACCACATGG - Intergenic
926257187 2:11215934-11215956 CAGTATGTGTAAATATTTCAAGG - Intronic
927084437 2:19660441-19660463 CAGGATGTGCTGAGATCACATGG - Intergenic
927311687 2:21638763-21638785 CAATGTGTACAGAAATTCCAAGG - Intergenic
927671107 2:25069667-25069689 CAGTATGTGCAGAAATCTCTAGG + Intronic
928311106 2:30210640-30210662 CAGCATGTGCAGAGATGACAAGG + Intergenic
929873944 2:45780954-45780976 CAGTGTTTGCAGAAATTGCCAGG + Intronic
930499020 2:52187457-52187479 CAGGTTGTGTAGAAAATACAAGG + Intergenic
930975482 2:57454243-57454265 AAGTATGTCCAGATGTTACATGG + Intergenic
931034525 2:58223793-58223815 CACTATATGCAGTAATTACTAGG + Intronic
931133827 2:59373974-59373996 CAGTATAGGCAGAGACTACATGG + Intergenic
931517879 2:63060234-63060256 CAGTATAAGCAGAGAATACAAGG - Intergenic
932022776 2:68104640-68104662 CAGCATGTGCAGAGATCACATGG + Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933176547 2:79180150-79180172 CAGCATGTGCAGAGATTACATGG + Intergenic
933463972 2:82626546-82626568 TGGTGTGTGCAGAAATCACATGG + Intergenic
935182451 2:100702973-100702995 CACTGTGTGCAGAGATCACACGG - Intergenic
935264781 2:101384925-101384947 CAGTGTGTGCAGTGATCACATGG - Intronic
935406171 2:102711922-102711944 CAGTATGTGCAGAGGTTGTATGG + Intergenic
935453269 2:103235564-103235586 CAGTATTTGCAGGAAATAAAGGG + Intergenic
935480330 2:103580169-103580191 CAGTTTATGCAGAAATTTCTAGG - Intergenic
936245390 2:110821708-110821730 GAGTATCTGCAGAAATTATTTGG + Intronic
936548142 2:113410786-113410808 TGGTATGTGCAGAGATCACATGG - Intergenic
936694208 2:114927876-114927898 CAGTATGTGCAGAGATCACAAGG + Intronic
936697380 2:114966458-114966480 AGGTGTGTGCAGAGATTACATGG - Intronic
936741585 2:115518002-115518024 CTGCATGTGCAGAGATAACATGG + Intronic
936898118 2:117452192-117452214 CAGTGTGTGCAGAAATCACATGG - Intergenic
937117625 2:119419932-119419954 CAGTGTGTGCTGAGATCACATGG + Intergenic
937951745 2:127393425-127393447 AAGTATCTGCATAAATTACTAGG + Intergenic
938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG + Intronic
938463985 2:131515134-131515156 AAGTGTGTGCAGAAAGCACATGG - Intergenic
939339811 2:140880286-140880308 CAGGGTGTGCAGAATCTACAAGG - Intronic
939448187 2:142336428-142336450 CAGTTTGTGCAGAATTTTCTCGG + Intergenic
940127012 2:150337803-150337825 CATTATTTGCAAAAATAACAAGG - Intergenic
940150119 2:150590905-150590927 CAACAGGTGTAGAAATTACAAGG + Intergenic
940576805 2:155518251-155518273 CTGTCTGTGCAGAAGTTAAATGG - Intergenic
940619625 2:156094723-156094745 CAGAATGTGCAGAAATGTAAGGG + Intergenic
941364107 2:164589509-164589531 CAGCATGTGCACAGATCACATGG + Intronic
941624064 2:167810767-167810789 CAGTATGTGCAGAGTTTTCCTGG - Intergenic
941714559 2:168749970-168749992 CAGTTTATGCAGAAATTTCTAGG + Intronic
942330923 2:174823095-174823117 CATTATGTGCAGAAATTTCTGGG - Intronic
942396958 2:175560328-175560350 CAGTCTGAGCAGTAATTAAACGG + Intergenic
943169384 2:184377475-184377497 CAGTGTGTGCAGGGATCACATGG + Intergenic
943183736 2:184577869-184577891 CAGTATGTGCAGAAATCACATGG + Intergenic
943258480 2:185628441-185628463 CAGTGTGTACAGAGATAACATGG - Intergenic
943416901 2:187619032-187619054 CAGTGTGTGCAGAGATCATATGG + Intergenic
943927287 2:193801306-193801328 CAAGATGTGCAGAAATGCCATGG + Intergenic
943939246 2:193970141-193970163 CATTCTGTGCAGAGATCACAGGG + Intergenic
945584996 2:211650159-211650181 CAATATATGCCTAAATTACATGG + Intronic
945778387 2:214135770-214135792 CAGTGTGTGCAGAGATCACATGG - Intronic
946581823 2:221137060-221137082 CAGTATGTGTACATAATACAAGG - Intergenic
947993781 2:234509907-234509929 CAGTTTGTGCAGCAATTAGGAGG - Intergenic
948078424 2:235185408-235185430 AAGAATGTGCTGAAATCACACGG + Intergenic
1168816162 20:738771-738793 CAGCACATGCAGGAATTACATGG + Intergenic
1168926333 20:1583185-1583207 CAGCATCTGCGGAAATTTCATGG + Intronic
1169980404 20:11378362-11378384 CAGTTTATGCAGAAATTCCTAGG + Intergenic
1170424492 20:16225265-16225287 GAGTATGTACAGAAATAACTTGG + Intergenic
1170712644 20:18806281-18806303 CAGTGTGTACAGAGATCACATGG - Intergenic
1171325234 20:24285406-24285428 CAACATGTGCAGAAGTCACAAGG - Intergenic
1171538641 20:25924142-25924164 CAGTATGTGGAGAAAATCTAAGG - Intergenic
1172058206 20:32168855-32168877 TGGCATGTGCAGAGATTACATGG - Intergenic
1173214483 20:41067807-41067829 CATTATGTGCAGAAACAAAATGG + Intronic
1173237590 20:41261720-41261742 CAGCATGTACAGAAATTAAAAGG - Intronic
1175675431 20:60942692-60942714 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177188268 21:17821360-17821382 CAGTATGTGCAGAGATCATGTGG + Intergenic
1177234349 21:18367547-18367569 CAGTTTGTCGAGAAATAACATGG + Intronic
1177621644 21:23602510-23602532 GAGTATGATCAGAAATGACACGG + Intergenic
1177676724 21:24309928-24309950 CAGCATGTGCAGAGATCACATGG + Intergenic
1177969852 21:27776506-27776528 CAGCACGTGCAGAGATCACACGG + Intergenic
1178349261 21:31860610-31860632 CAGCGTGTGCAGAGATCACATGG + Intergenic
1178361212 21:31949819-31949841 CAGTGTGTGCAGAGATCACATGG + Intronic
1178498345 21:33105524-33105546 CAGGAAGTGCAGATAATACAAGG - Intergenic
1180789974 22:18570451-18570473 CAGTATATTTAGAAGTTACAAGG - Intergenic
1181231765 22:21424864-21424886 CAGTATATTTAGAAGTTACAAGG + Intronic
1181246886 22:21510004-21510026 CAGTATATTTAGAAGTTACAAGG - Intergenic
1182111094 22:27724302-27724324 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1184632477 22:45794020-45794042 CAGTTTATGCAGAAATTTCTAGG + Intronic
1184964066 22:47954238-47954260 CAGTTTATGCAGAAATTTCTAGG + Intergenic
949255093 3:2036350-2036372 CAGTATATGCAGACATTTCTAGG - Intergenic
949276423 3:2288323-2288345 CAGTGTGTACAGAGATCACAGGG + Intronic
949737232 3:7187691-7187713 CAGTTTATGCAGAAATTTCTAGG + Intronic
953686288 3:45080902-45080924 CTGCATGTGCAGAAATCACATGG - Intergenic
954479036 3:50780485-50780507 CTGTACGTGCAGAGATCACATGG + Intronic
954528419 3:51295277-51295299 CAGTGTGTGCAGAGATATCATGG + Intronic
955104328 3:55882234-55882256 CTGTATGTGCAGAGATCACATGG - Intronic
955532273 3:59886546-59886568 CTGTGTGTGCAGAGATCACATGG + Intronic
956197589 3:66668782-66668804 CAGGTTATGCAGAAATTTCATGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956379664 3:68652482-68652504 CAGCATGTGCAGAGATCACAGGG - Intergenic
956483493 3:69696683-69696705 CAGTTTATGCAGAAATTTCTAGG - Intergenic
956556401 3:70528107-70528129 CAGCATGTGCAGAGATTACATGG + Intergenic
956677771 3:71752263-71752285 CACTATGTGCAGAAATCACTGGG - Intronic
956891223 3:73616124-73616146 CTGCATGTGCAGAGATTACATGG - Intronic
956967219 3:74475780-74475802 CAGTATGTGCAGTACTTTCAAGG + Intronic
957444409 3:80296408-80296430 CAGCTTGTGCAGAGATCACATGG + Intergenic
958737494 3:98026191-98026213 CAAAATGAGCAGAAAATACAGGG + Intronic
959216578 3:103457311-103457333 CAGCATGTGCAGAGATCACATGG - Intergenic
959228949 3:103621849-103621871 CAGTATGTGCAGAGATCACATGG + Intergenic
959368017 3:105488142-105488164 CAGTGTGTGCAGAGATCACATGG - Intronic
959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG + Intergenic
959839461 3:110957832-110957854 GAGTTTGTGCAGAAATTTTAAGG + Intergenic
959965684 3:112351863-112351885 CAGTGTGTGCAGAGATCAGATGG + Intronic
960241673 3:115349663-115349685 CAATGTGTGCAGAGATCACACGG - Intergenic
960255205 3:115504507-115504529 CAGGATGTGCAGAAACTCAAAGG - Intergenic
960774679 3:121236479-121236501 CAGAGTGTGCAGAAATCACATGG + Intronic
960887804 3:122414645-122414667 GAGATTGTGCAGAAATTACAAGG - Exonic
961402531 3:126657236-126657258 CACAATGTGAAGAAATTCCATGG - Intergenic
961870818 3:129986796-129986818 CTGTGTGTGCAGCAATCACATGG - Intergenic
961871215 3:129989707-129989729 CTGTGTGTGCAGAGATCACATGG - Intergenic
962183391 3:133232380-133232402 CAATATGTGCAGAGATCACATGG - Intronic
962324154 3:134419419-134419441 CAGGAAGTGCCAAAATTACAGGG + Intergenic
962587825 3:136860626-136860648 TGGTGTGTGCAGAGATTACATGG + Intergenic
963238492 3:142979404-142979426 CAATATGTGCAGATATCACATGG - Intronic
963406132 3:144866440-144866462 CAGCATGTGCAGAGATCACATGG - Intergenic
963406324 3:144868259-144868281 CATTATGTGCAGAGATTACATGG - Intergenic
963478097 3:145832243-145832265 CTGTGTGTGCAGAGATGACATGG + Intergenic
963834499 3:150043032-150043054 CAGCATGTGCAGAGATCACATGG - Intronic
964328729 3:155576362-155576384 CAGTATAGCCAGAAATTACCTGG - Intronic
964480988 3:157138205-157138227 CAGTGTGTACAGAGATCACATGG + Intergenic
964608540 3:158585327-158585349 CAGTATGTGCAGAGATCACATGG - Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966513467 3:180790676-180790698 CAAAATATGAAGAAATTACATGG - Intronic
966750562 3:183317676-183317698 CAGAACGTGCTGAAATTGCAGGG - Intronic
967006070 3:185383618-185383640 CAGTATGTGCAGAAATTACATGG - Intronic
967253044 3:187562782-187562804 CAGCATGTGCAAAGATCACATGG + Intergenic
967314421 3:188137809-188137831 TAGTATGTGTAGGAATTACCAGG + Intergenic
967998976 3:195188425-195188447 CAGTTTATGCAGAAATTTCTAGG - Intronic
968482310 4:839654-839676 CAGCATGTGCAGAGATCACATGG + Intergenic
970142197 4:12994963-12994985 CAGCATGTGCAGAGATTACATGG + Intergenic
970217788 4:13777998-13778020 CAGGATGTGGAGAAATTCCATGG - Intergenic
970442756 4:16096360-16096382 TAGTAAGTGCACAAATAACACGG + Intergenic
970809230 4:20072058-20072080 TGGTATATGCAGAGATTACATGG + Intergenic
971362522 4:25951027-25951049 AACTATGAGCAGAAATGACAGGG + Intergenic
971727658 4:30334462-30334484 CATTATGTGCAGTATTTATAAGG - Intergenic
972395887 4:38659640-38659662 CAGTGTGTGCAGAGATCACAGGG + Intergenic
972413013 4:38811589-38811611 CAGTTTATGCAGAAATTTCTAGG - Intronic
972479768 4:39486261-39486283 CAGAAGCTGCAGAAATTAGAAGG + Intergenic
972746166 4:41934902-41934924 CAGGAAGTGCGGAAATTTCATGG + Intergenic
973195035 4:47429912-47429934 AACTATGTACAGAATTTACAAGG - Intergenic
974156842 4:58084251-58084273 CAGCATGTCCAGAGATCACAGGG - Intergenic
974475225 4:62370490-62370512 CTGTAAATGCAGAAATTACGGGG + Intergenic
974815576 4:66999749-66999771 CGGTGTGTGCAGAGATTACGTGG + Intergenic
974848264 4:67377787-67377809 AGGTATGTGCAGAGATCACATGG + Intergenic
975268728 4:72403441-72403463 CAATATCTGCAGATATTAGATGG + Intronic
975455504 4:74585456-74585478 CAGCATGTGCAGAGATCACATGG - Intergenic
975619727 4:76284147-76284169 TAGCATGTGCAGACATCACATGG - Intronic
975937743 4:79601691-79601713 CAATATGTGCAGAGATCACATGG - Intergenic
976248334 4:83025692-83025714 TAGCATGTGCAGAGATCACATGG + Intergenic
976821209 4:89209078-89209100 CAGTGTGTGCAGAGATCACATGG + Intergenic
977147740 4:93466530-93466552 CAGTTTATGCAGAAATTTCTAGG + Intronic
978418961 4:108509395-108509417 CAGAAAGTTTAGAAATTACAGGG - Intergenic
978602596 4:110444259-110444281 CAGCATGTGGAAAAATTACTAGG - Intronic
978750624 4:112242567-112242589 CACTGTGTGCAGAAATCACACGG + Intronic
979124178 4:116946637-116946659 CAGCATGTGCAGAGATCTCATGG - Intergenic
979885037 4:126016559-126016581 CAAGATATGCAGAAATGACAGGG - Intergenic
980212946 4:129813764-129813786 TGGTGTGTGCAGAGATTACATGG + Intergenic
981240354 4:142468671-142468693 CAGTGTGTGCAGAAATTACAGGG - Intronic
981268893 4:142820397-142820419 CAGCATGTGCAGAGATCACATGG - Intronic
981797929 4:148619159-148619181 TGGTATGTGCAGAGATCACATGG - Intergenic
982363236 4:154546579-154546601 TAGTATGTAAAGAAAGTACAGGG - Intronic
982662152 4:158220062-158220084 CATTATGTGAAGAACTGACAGGG - Intronic
982734492 4:158991375-158991397 CAGTATTTGCAAAAAGTGCAAGG + Intronic
982830395 4:160052901-160052923 CAGTGTGTGCAGAGATCATATGG + Intergenic
982889460 4:160829288-160829310 CAGCATGTGCAGAGATCAAAGGG + Intergenic
983259032 4:165434994-165435016 CAGCATGTGCAGAGATCATATGG - Intronic
983586648 4:169362829-169362851 CTGCATGTGCAGAAATCACATGG + Intergenic
983763792 4:171450644-171450666 CATTATGTGCAGAAATCACAAGG - Intergenic
984161922 4:176263173-176263195 CAGCATGTGCAGAGATCACATGG - Intronic
984247094 4:177287642-177287664 CTGAATGAGAAGAAATTACAGGG + Intergenic
984374964 4:178918025-178918047 CAGCATGTGCAGAGATCATATGG - Intergenic
984379573 4:178973827-178973849 CAGTATGTGCAACAATTGTATGG + Intergenic
984982731 4:185298698-185298720 CAGAATGTGCAAAGAATACAAGG - Intronic
985586722 5:743426-743448 CTGTTTTAGCAGAAATTACAAGG - Intronic
985810574 5:2081084-2081106 CATTATGTACAGAAAATCCATGG + Intergenic
986410346 5:7473327-7473349 CAGCATGTGCAGACATCACATGG + Intronic
986438792 5:7760110-7760132 AAGGATGTGAAGAAATCACAGGG + Intronic
986768599 5:10950693-10950715 CAGTGTGTGCAGAGATCATATGG + Intergenic
987666283 5:20945274-20945296 TGGAATGTGCAGAGATTACACGG - Intergenic
988423307 5:31032929-31032951 CAGCATTTGCAGAGGTTACATGG - Intergenic
988629590 5:32914671-32914693 CAGTATGACCAGAACTCACATGG - Intergenic
988756393 5:34256791-34256813 TGGAATGTGCAGAGATTACACGG + Intergenic
988893550 5:35647282-35647304 CATAATGTGCAGACATTACATGG + Intronic
989391102 5:40901860-40901882 CAGTATGTACACACATTAAATGG - Intergenic
989708149 5:44362875-44362897 CAGTAAGTGCTGGAATAACAGGG - Intronic
989985891 5:50697438-50697460 CAGTATGTTAATAAATTAAAAGG + Intronic
990658641 5:57987051-57987073 CAGCTTGTGCAGAAATTTCTAGG - Intergenic
990682552 5:58261606-58261628 CAGAATGGGCAGAAATTAAAAGG + Intergenic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
991119250 5:62992920-62992942 CAGTGTGTGTAGAGATTACATGG + Intergenic
991249114 5:64540195-64540217 CAGAAAGTTTAGAAATTACAGGG + Intronic
992208366 5:74452968-74452990 CAGCATGTGCAGAGATCCCATGG + Intergenic
995349968 5:111163901-111163923 CAGTGTGTGCAGAGATAACATGG + Intergenic
995904052 5:117101973-117101995 AAGTATGTTCAAATATTACATGG - Intergenic
995915852 5:117243655-117243677 AAGTTTCTGCAGAAATTTCAGGG - Intergenic
996662546 5:126021278-126021300 CAGCATGTGCAGAAATCAAACGG - Intergenic
996728491 5:126694196-126694218 TAGTAAGGGAAGAAATTACAGGG + Intergenic
997139089 5:131360065-131360087 CAATATGTGCATATATTAGAGGG - Intronic
997150762 5:131492362-131492384 TAGTATGGCCAGAAATAACATGG - Intronic
997243483 5:132325971-132325993 CAGTTTATGCAGAAATTTCTAGG - Intronic
999469916 5:151844938-151844960 CATCATGTGCAGAGATCACATGG + Intronic
1000643027 5:163727248-163727270 AGGTCTGTGCAGAAATCACATGG - Intergenic
1001306933 5:170581909-170581931 CTGGATGTGCAGAGATCACATGG + Intronic
1002848319 6:968420-968442 CAGTGTATGCAGAACTTCCAAGG - Intergenic
1002991337 6:2241686-2241708 TAGTGTATGCAGAGATTACATGG - Intronic
1003534657 6:6966164-6966186 CAGTATGTTCAGAAACTTCAGGG - Intergenic
1003754547 6:9102057-9102079 CTGTGTGTGCAGAGATCACATGG + Intergenic
1004060151 6:12187459-12187481 TGGTATGTGCAGAGATAACATGG - Intergenic
1004061264 6:12200278-12200300 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1004246813 6:13985872-13985894 CTGTGTGTGCAGAGATCACATGG - Intergenic
1004756885 6:18619747-18619769 CAATGTGTGCAGAGATCACATGG - Intergenic
1004840403 6:19577477-19577499 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1004910062 6:20274253-20274275 AAGTATGTGCAAAGATCACAGGG - Intergenic
1005869146 6:29960584-29960606 TGGTATGTGCAGAGATCACACGG - Intergenic
1006244497 6:32718671-32718693 CAGCATGTGCAGATACCACACGG + Intergenic
1006561262 6:34914721-34914743 CAGTTTCTGCAGAACTTAGAAGG + Intronic
1007215121 6:40231057-40231079 CAGCATGTGCAGAGATCACACGG + Intergenic
1009037820 6:58139210-58139232 GGGCATGTGCAGAAATCACATGG - Intergenic
1009213606 6:60892847-60892869 GGGCATGTGCAGAAATCACATGG - Intergenic
1009281868 6:61762570-61762592 CAGCATGTGCAGAGATGACTTGG - Intronic
1009521311 6:64685574-64685596 CAGCAGGTGCAGAGATCACATGG - Intronic
1010289896 6:74123246-74123268 CACTTTGTCCAGAAATTACTGGG + Intergenic
1011041640 6:83035930-83035952 CACTAAGTGCTGAGATTACAGGG + Intronic
1011840718 6:91495066-91495088 CAGTATTTGAAGAAATAAAAGGG - Intergenic
1012305167 6:97647033-97647055 CCGTGTGTGCAGAGATCACATGG + Intergenic
1012500469 6:99882488-99882510 CAGTGTTTGCAGAGATCACATGG - Intergenic
1012602339 6:101113878-101113900 CAGAAGGTGCAGAAAGTAAAGGG + Intergenic
1012753340 6:103191284-103191306 TGGTATGTGCAGAGATTTCATGG + Intergenic
1012856987 6:104513714-104513736 CAGTATGTGCAGCGATCACATGG - Intergenic
1014177878 6:118349950-118349972 CATGGTGTTCAGAAATTACAAGG + Intergenic
1014687121 6:124515429-124515451 CAGTGTGTGCAGAGATCACATGG + Intronic
1015409772 6:132880255-132880277 GATTATGCTCAGAAATTACATGG - Intergenic
1015611797 6:135030114-135030136 CTGTATTTGTAGAACTTACATGG + Intronic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016533592 6:145086319-145086341 CAGTATGTACAGAGATCACGTGG + Intergenic
1016614349 6:146029084-146029106 CAGGATGTGCCGAAATGAAACGG + Intronic
1016706835 6:147118636-147118658 CAGAATGTGGAGAAATTACTTGG + Intergenic
1016795880 6:148116861-148116883 TAGCATGTGCAGAGATTGCATGG + Intergenic
1016861695 6:148726548-148726570 CAGCATGTGCAGAAATTACATGG + Intergenic
1017082008 6:150678599-150678621 GAGTATGTGGATTAATTACAAGG - Intronic
1018158523 6:161013795-161013817 CAGTTTATGCAGAAATTTCTAGG + Intronic
1018417654 6:163615042-163615064 CAGTATGTGCAGAGATCACACGG - Intergenic
1018735451 6:166684314-166684336 CAGTTTATGCAGAAATTTCTAGG - Intronic
1020397556 7:7734014-7734036 CAGTGTGTGCTTTAATTACAAGG + Intronic
1022027901 7:26465975-26465997 CAGTAAGTGCAAAGATCACAAGG + Intergenic
1022151826 7:27616127-27616149 CAGCACGTGCAGAGATCACAGGG + Intronic
1022895848 7:34749657-34749679 GAGTAAGGGCAGAAAGTACAAGG + Intronic
1023107374 7:36775516-36775538 CAGCATGTACAGAGATCACATGG - Intergenic
1023629212 7:42146931-42146953 CTGTATCTGCAGAAATAAGATGG + Intronic
1023762000 7:43473184-43473206 GAGCATGTGCAGAGATTTCATGG - Intronic
1023854540 7:44174291-44174313 CTGCATGTGCAGATATCACATGG - Intronic
1024316566 7:48024718-48024740 CAGCATGTGCAGAGATCACATGG + Intronic
1024916617 7:54507427-54507449 CAGTGTGTGCAGAGATCACATGG - Intergenic
1025622509 7:63186731-63186753 CAGTATGTGGAAAAATTACTAGG - Intergenic
1026135375 7:67656207-67656229 CAGTGTGTCCAGAGATCACATGG + Intergenic
1027414730 7:77963071-77963093 CAGCATGCACAGAAATCACATGG + Intergenic
1027493879 7:78863394-78863416 CAGTGTGTGCAGAGATCACATGG + Intronic
1028516041 7:91679282-91679304 CTGTGTGTGCAGAGATCACATGG - Intergenic
1028972201 7:96871633-96871655 CAGTTTGTACAGAGATCACATGG + Intergenic
1029197767 7:98818350-98818372 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1029281301 7:99437658-99437680 CAGTTTGTGCAGCAACTACAAGG - Intronic
1029350185 7:100007923-100007945 CAGTTAGTGCAGAAATTACTAGG + Intergenic
1031530051 7:122865176-122865198 TAGTGTATGCAGAGATTACATGG - Intronic
1032436467 7:131905025-131905047 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1033123030 7:138683225-138683247 CAGCATGTATAGGAATTACATGG + Intronic
1034721176 7:153294238-153294260 CAGCATGTACAGAGATCACATGG + Intergenic
1036387904 8:8297733-8297755 CAGCGGGTGCAGAAATCACATGG - Intergenic
1036509097 8:9383895-9383917 CTGCATGTGCAGAGATCACACGG - Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036633854 8:10534080-10534102 CAGAAAGTGAAGAAAATACAAGG - Intronic
1036640117 8:10578018-10578040 CAGTATTTACAGAAACTACTGGG + Intergenic
1037844656 8:22272507-22272529 CGGCCTGTGCAGAGATTACATGG - Intergenic
1038115426 8:24548606-24548628 CAGTATCTGCAGAAAGAATAAGG - Intergenic
1038329370 8:26596005-26596027 CATTAGCTGCAGAAATCACAGGG + Intronic
1038389168 8:27179254-27179276 CAGCATGTACAGAGATTAAAGGG - Intergenic
1038572916 8:28678526-28678548 CAGCGTGTGCAGAGATCACATGG - Intronic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1038922149 8:32096644-32096666 CCGTATGTGCAGAGATTACATGG + Intronic
1039205579 8:35149846-35149868 CAGTATGTTCTGTAATTCCAAGG + Intergenic
1039661477 8:39471640-39471662 TGGTATGTGCAGAGATCACACGG - Intergenic
1039859020 8:41440449-41440471 CGGCATGTGCAGAGATCACATGG + Intergenic
1041757287 8:61328417-61328439 CAGGATGGGCAGGATTTACATGG + Intronic
1041795816 8:61746859-61746881 AGGTCTGTGCAGAGATTACATGG + Intergenic
1042490219 8:69389281-69389303 CAGCATGTGCAGAGATCACATGG + Intergenic
1042649167 8:71021064-71021086 CATTGTGTGCAGAGATCACATGG + Intergenic
1042771085 8:72383322-72383344 CAGTGTGTACAGAGATCACATGG + Intergenic
1042880297 8:73480513-73480535 CACAATGTGCAGAAAACACATGG + Intronic
1043915897 8:85921724-85921746 CACTGTGTGCAGAGATCACATGG - Intergenic
1046175963 8:110575349-110575371 CAGGGTGTGCAGCAATCACATGG + Intergenic
1046236500 8:111429948-111429970 CAGTATGTGTAGATATGACATGG + Intergenic
1047280695 8:123442974-123442996 CAGTTTATGCAGAAATTTCTAGG - Intronic
1048002706 8:130392765-130392787 CAGCATGTGCAGAGATCAGATGG + Intronic
1048175083 8:132144701-132144723 CTGAATGTGAAGAAACTACACGG - Intronic
1048892288 8:138958921-138958943 CAGGAATTGCAGAAATTACTTGG - Intergenic
1048922363 8:139242878-139242900 CAGCATGTTCAGAAATCACATGG + Intergenic
1049131911 8:140853003-140853025 CAGTGTGTGCATAAATTATCTGG - Intronic
1049498582 8:142948584-142948606 CACCATGTGCAGAAATCCCACGG + Intergenic
1049978728 9:884417-884439 CTGAATGTGCAGAAAGTAAACGG + Intronic
1050054410 9:1636965-1636987 CAGTGTGTGCACAAATCACTTGG - Intergenic
1050563976 9:6863478-6863500 CAGCATGTACAGAGATCACATGG + Intronic
1050648377 9:7747123-7747145 CAGTATGTTCAGAAGTAAGAGGG - Intergenic
1050698176 9:8302819-8302841 CAGTAAGTGCAGAGATGCCATGG - Intergenic
1050849246 9:10263732-10263754 CAGAATTTGCATAAATAACAAGG + Intronic
1050993068 9:12176066-12176088 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1051046894 9:12886635-12886657 CAGCATGTGCAGAGATCACATGG + Intergenic
1051347505 9:16165566-16165588 TGGCATGTGCAGAGATTACATGG + Intergenic
1052049472 9:23828538-23828560 TATTATGTAAAGAAATTACATGG + Intergenic
1052282944 9:26753849-26753871 CAGTGTGCGCGGAAATCACATGG + Intergenic
1055152477 9:73019389-73019411 CAGCATGTGCAGAGCTCACATGG + Intronic
1055536070 9:77245935-77245957 CCACATGTGCAGAGATTACATGG + Intronic
1055649860 9:78396644-78396666 CAGTATGTGAAACAGTTACAAGG - Intergenic
1055798056 9:79997645-79997667 CAGCATGTGCAGAGATCACATGG - Intergenic
1056453041 9:86735058-86735080 CAGCATGTAGAGAAATCACAAGG + Intergenic
1057005243 9:91551582-91551604 TAGTGTGTGCAGAGATTACATGG - Intergenic
1057092011 9:92266752-92266774 CAGAGTATGCAGAAATCACATGG - Intronic
1057219573 9:93248731-93248753 CTGTATGTGCAGAAGATACTAGG - Intronic
1058245289 9:102615619-102615641 CAATATCTGCAGAAATCATATGG - Intergenic
1058535706 9:105957936-105957958 CAGTGTGTGCAGAGATCACCTGG + Intergenic
1059639174 9:116199848-116199870 CAGCATATGCAGAAATCACATGG + Intronic
1059897165 9:118879156-118879178 CAGCATGTGCAGAGATCACATGG + Intergenic
1060049084 9:120364261-120364283 CTGTATGGGGTGAAATTACATGG + Intergenic
1060199041 9:121641156-121641178 GAGCAGGTGCAGAAATTATAGGG + Intronic
1060492718 9:124096769-124096791 AAGCATGTGCTGAGATTACAAGG + Intergenic
1061305727 9:129732004-129732026 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1185803462 X:3034573-3034595 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1185883960 X:3765228-3765250 CAGATTTTGCAGAAATTGCAAGG - Intergenic
1186123386 X:6386467-6386489 AAGTAACTGAAGAAATTACAGGG + Intergenic
1186160645 X:6773800-6773822 CAGTTTGTGCAGAAATTTCTAGG - Intergenic
1186368477 X:8921338-8921360 GAGGATGTGCATAAATTATATGG + Intergenic
1186845996 X:13531894-13531916 CAGCATGTGCATAGATCACATGG + Intergenic
1187034128 X:15519768-15519790 TAGTGTGTGCAGAAATTGTATGG + Intronic
1187045129 X:15640273-15640295 CAGTTTATGCAGAAATTTCTAGG - Intronic
1187101395 X:16196530-16196552 CAGCATGTGCAGAGACCACATGG - Intergenic
1187948872 X:24452678-24452700 CAGGGTATGCAGAAATCACATGG + Intergenic
1188304442 X:28545448-28545470 AAGAATGTGCAGAAATTTCGTGG + Intergenic
1188803383 X:34558804-34558826 CAGCATGTGCCAAAATCACATGG - Intergenic
1189127205 X:38461283-38461305 CATGATGTGCAGAGATCACATGG + Intronic
1190892449 X:54582245-54582267 CAGCATGTACAGAAATCACATGG - Intergenic
1191042435 X:56098150-56098172 CAGCATGTGCAGAGACCACATGG - Intergenic
1191957324 X:66658271-66658293 CAGTATTTGCTAAAATAACAGGG + Intergenic
1192274017 X:69611597-69611619 TAGCATGTGCAGAGATCACATGG - Intergenic
1193326520 X:80184168-80184190 CTGCATGTACAGAAATCACATGG - Intergenic
1193949864 X:87784528-87784550 CAGCATGTCCAGAAATTACATGG + Intergenic
1194465340 X:94228349-94228371 CAGTATGTGCAGAGATCACATGG + Intergenic
1194759294 X:97775429-97775451 CAGTTTGTACAGAAACAACAAGG - Intergenic
1194767370 X:97857210-97857232 CAGCATGTGCAGAGATCAAATGG + Intergenic
1196007102 X:110848804-110848826 CAGTATATGCTGAAATTTCCAGG - Intergenic
1196080995 X:111630838-111630860 CAGCCTGTGCAGAGATCACATGG - Intergenic
1196332074 X:114483884-114483906 CAGTAAGTGCAGAAATAATCAGG + Intergenic
1196780856 X:119382946-119382968 CAGTGTATGCAGAGATCACATGG - Intergenic
1197293687 X:124690769-124690791 CAGTGTGTGCAGAGATCACAAGG - Intronic
1197558628 X:127990420-127990442 CAGTGTGTACAGAGATCACATGG - Intergenic
1197912203 X:131495117-131495139 CAGTGTGTGTAGAGATCACATGG - Intergenic
1198070466 X:133143316-133143338 CAGTGTGTACAGAGATCACATGG - Intergenic
1198688166 X:139250082-139250104 CAGTGTGTGCAGAGATTGCATGG + Intergenic
1199052778 X:143257066-143257088 AAGTATGTGTGGAAATAACAGGG + Intergenic
1200781402 Y:7219708-7219730 CAGATTTTGCAGAAATTGCAAGG + Intergenic
1201553928 Y:15248841-15248863 CAGTTTGTGCAGACATTTCACGG - Intergenic
1201605107 Y:15775501-15775523 AAGTAACTGCAGAAATTACAGGG + Intergenic
1201745700 Y:17370877-17370899 TGGTTTGTGCAGAAATCACATGG + Intergenic