ID: 967009084

View in Genome Browser
Species Human (GRCh38)
Location 3:185414704-185414726
Sequence CATTGCCAGTTTAATATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967009084 Original CRISPR CATTGCCAGTTTAATATTTA GGG (reversed) Intronic
906847968 1:49214970-49214992 CACTGCCATTTTAAAATTTGAGG + Intronic
907304507 1:53506273-53506295 CCCTGCCAGTTTTATATTTTTGG - Exonic
907838482 1:58133858-58133880 CATTGCCAATTTAATCTTTGGGG + Intronic
909142229 1:71882587-71882609 CAGTGTCTGTTTAATTTTTAAGG - Intronic
911719684 1:101177453-101177475 CATTTCTGTTTTAATATTTAGGG - Intergenic
911778849 1:101849683-101849705 CACTGACAGTTTATTATTTCAGG - Intronic
917083234 1:171278548-171278570 CATTGGCAGGTAATTATTTAAGG - Intronic
917409559 1:174744224-174744246 CTTTGAAAGTTTAATATTTTAGG - Intronic
918577788 1:186084626-186084648 CATGGCCAGCTTAATTTTTGTGG + Intronic
918768395 1:188519254-188519276 CCTTTCCAGTTTATTATTTCAGG + Intergenic
919209626 1:194463916-194463938 CATTGGCAGTTGTATTTTTAAGG + Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
1066988875 10:42493458-42493480 CATTGCTACTTTAATCATTATGG + Intergenic
1068445548 10:57117888-57117910 CATGGCCAATTTAAGATTTTTGG - Intergenic
1068533677 10:58216579-58216601 CATTGCCTTTTTAATATTGTTGG - Intronic
1071367709 10:84916916-84916938 CAATGCCAGTTACATATTCATGG - Intergenic
1071691070 10:87819930-87819952 CCGTGCCTGTTTAGTATTTAAGG + Intronic
1073003578 10:100303976-100303998 CATTGCCCGTCAACTATTTATGG + Intronic
1073615831 10:104993778-104993800 AAATGCCAGTTTAATAATCAGGG + Intronic
1073793613 10:106964223-106964245 CACTACCAGCCTAATATTTAAGG - Intronic
1075858698 10:125654756-125654778 CATTATCATTTAAATATTTAAGG - Intronic
1080485206 11:32698917-32698939 CAATGCTATTTTAATTTTTAAGG + Intronic
1084883809 11:72190383-72190405 GATAGCCAGTTTAATCTTTGTGG - Exonic
1087975973 11:104546990-104547012 CAGTACCACTTTAACATTTATGG - Intergenic
1088559302 11:111096603-111096625 CATTTCCAGTCTATTATTTGAGG - Intergenic
1088631457 11:111777750-111777772 CCTTGCCAGTGAAATATTTGTGG - Intergenic
1093249089 12:16778297-16778319 CATTGCCTATCTACTATTTAGGG - Intergenic
1094030370 12:26005236-26005258 AATTGCCAGATTAATCTTAAAGG + Intronic
1095235341 12:39788548-39788570 AATTGCCCGTTTAATATTTTTGG + Intronic
1095712406 12:45304759-45304781 CATTGCCAGTTGAATAGTCTTGG + Intronic
1095790151 12:46158108-46158130 CACTAACAGTTTATTATTTATGG + Intergenic
1097556033 12:61138780-61138802 CATTGGCATTGTGATATTTATGG - Intergenic
1100475413 12:94931180-94931202 CACTACCATTTCAATATTTAAGG + Intronic
1107464288 13:40635343-40635365 CATTACAAGCTTAACATTTAGGG + Intronic
1108183609 13:47866520-47866542 CATTGCCAAATTGATTTTTATGG - Intergenic
1109008859 13:56913486-56913508 CAGTGCTAGTATAATATTAATGG - Intergenic
1109782090 13:67125099-67125121 CATTCCCAATTTTATATTCAAGG - Intronic
1110443045 13:75546649-75546671 CATTGACAGTATAATTTTGATGG - Intronic
1113968777 13:114172241-114172263 CCTTGCCAGTTTGATATTGGGGG - Intergenic
1114883077 14:26811073-26811095 TTTTGCAAGTTTAATAATTAAGG + Intergenic
1119914725 14:78387194-78387216 CATTTCTAATTTAATATTGAAGG + Intronic
1120294253 14:82621157-82621179 CAATGTCAGTTTAATTTTTAGGG + Intergenic
1120872550 14:89350934-89350956 TACTGTCAGTATAATATTTAAGG - Intronic
1121772993 14:96567773-96567795 CATTCCCATTTTCATATATAGGG - Intergenic
1125145728 15:36466130-36466152 TATTGCCAGAATAATATTTCTGG + Intergenic
1127429603 15:58889937-58889959 CATTCCCACTATAATATGTAAGG + Intronic
1129809808 15:78500679-78500701 CATTGCCATTTTCATATTTTGGG + Exonic
1134638409 16:15810001-15810023 CTTTTTCAATTTAATATTTACGG + Intronic
1135878475 16:26228315-26228337 TATTGACTGTTTAATCTTTATGG - Intergenic
1137942958 16:52706977-52706999 CATTGCCAGATTTATATTGTAGG - Intergenic
1138003357 16:53305434-53305456 AATTCCCTGTTTAATATTCAAGG + Intronic
1139159491 16:64487397-64487419 CAATGCCAGCTTTATATTAAGGG - Intergenic
1149486217 17:57045074-57045096 AATTTTCAGTTTAATATTTTTGG - Intergenic
1155560540 18:27071349-27071371 CATTTCCAGTTTTATAGTTCAGG - Intronic
1155952749 18:31931157-31931179 CTTTGCCTGTTTATTATTTTAGG - Intronic
1156365696 18:36424727-36424749 AATTGTCCGTTTAATATTTTTGG - Intronic
1157319974 18:46626635-46626657 CAATACCATTTTAATATGTAGGG + Intronic
1158171439 18:54605050-54605072 CAGTGGCAGTTAAATATTGAGGG + Intergenic
1159121897 18:64180734-64180756 GAGTGCCTGTTTAATATTTATGG + Intergenic
1159186027 18:64975490-64975512 CATAGCTAGTTTAATAGTTTGGG - Intergenic
1159588313 18:70303472-70303494 TATTGCCAAATTAATTTTTATGG + Intronic
1159599177 18:70412324-70412346 CTTTGCCAGTCTAATCTTTTTGG - Intergenic
1159824909 18:73195701-73195723 CATTGCTATTTTGATATTTTTGG - Intronic
1163044739 19:14632222-14632244 CATTACCAGATTCATTTTTAGGG + Intronic
1164637966 19:29805385-29805407 CTTGGCCAGGTTGATATTTAAGG + Intergenic
926321567 2:11751935-11751957 CATTTTCATGTTAATATTTATGG + Intronic
926431482 2:12790528-12790550 CATTGCCAGTTAAAAAATTTGGG + Intergenic
928031644 2:27784723-27784745 CTTGGCAAGTTTAATATTGATGG - Intronic
928464900 2:31514534-31514556 CATTTTCAGCTTTATATTTAAGG - Intergenic
929160750 2:38829797-38829819 CATTTCCAGTAAAATGTTTATGG - Intronic
929445695 2:41999257-41999279 CTTTGCCATTTTTACATTTAAGG - Intergenic
929702947 2:44180534-44180556 CTCTGCCAATTTAATATTTCTGG + Intronic
930640606 2:53850960-53850982 CATTTCCACTTTAAGATTAATGG + Intergenic
930691250 2:54367684-54367706 CATTGCCAACTTAAGATTTATGG + Intronic
935197277 2:100824871-100824893 CAATGGCAGTTTGATGTTTAGGG + Intronic
936256146 2:110914877-110914899 CATTGCCGGTATTATATTTAAGG + Intronic
936934100 2:117821629-117821651 CTTTCCCTTTTTAATATTTAGGG + Exonic
939603543 2:144224081-144224103 CCATGCCAGCTTAATTTTTAAGG - Intronic
939815237 2:146887789-146887811 CACTGCCAGACAAATATTTATGG + Intergenic
940960174 2:159776662-159776684 CTTTGCCAGTTTTCTATTTGGGG - Intronic
943473649 2:188327848-188327870 CATGGCCAACCTAATATTTATGG + Intronic
943693224 2:190891412-190891434 CATTGATAGCTTAAGATTTAGGG + Intronic
944453794 2:199872892-199872914 CAAGGCTAGTTTAATATTTTTGG - Intergenic
944461770 2:199956803-199956825 CATCTCCAGTTTAATCTTTACGG - Intronic
947510281 2:230746541-230746563 TATTGCCAGGTTTATATTCATGG + Intronic
948676034 2:239597281-239597303 CAATGGCAGTTTAATAGTCATGG - Intergenic
1169598886 20:7233754-7233776 CATTGCTAGTTTGATAGTTCAGG + Intergenic
1172901995 20:38342091-38342113 AGTTGGGAGTTTAATATTTATGG - Intergenic
1173597103 20:44265707-44265729 CATTACTAGTTTAATACATATGG + Intronic
1174547468 20:51336381-51336403 CATTCACAGTTTTATCTTTAGGG - Intergenic
1179128732 21:38615208-38615230 TATTGCCAGTTTAATTCTAAAGG - Intronic
1182501623 22:30752187-30752209 GTTTTCCAGTTTTATATTTATGG + Intronic
1184278006 22:43421267-43421289 TAATGCCCATTTAATATTTATGG - Intronic
949171783 3:1008457-1008479 CAGGGACAGTTTTATATTTAAGG - Intergenic
949339219 3:3010352-3010374 CACTGCCAGTTTAGGATTCAGGG + Intronic
949703491 3:6786906-6786928 AATTGCCAGGTTATCATTTATGG + Intronic
952631560 3:35475582-35475604 CATTGTCCTTTTAATATTCAGGG + Intergenic
953134094 3:40167809-40167831 CATTACCGGTTTAATATAAAGGG + Intronic
953409834 3:42684514-42684536 CACTACAAGTTTAATATTTCAGG - Intergenic
958572774 3:95910378-95910400 CATGGTCAGATTAGTATTTATGG + Intergenic
960675070 3:120185727-120185749 CACTGCAAGATTAATGTTTAAGG - Intronic
963512835 3:146270322-146270344 CATTAGCAGTTTCCTATTTAAGG - Intergenic
965296070 3:166948499-166948521 GTTTGCCAGTCTAATATTTATGG - Intergenic
966311303 3:178596927-178596949 CATTGTCTGCTTCATATTTAAGG + Intronic
967009084 3:185414704-185414726 CATTGCCAGTTTAATATTTAGGG - Intronic
969934194 4:10665183-10665205 CATTGCCAGCTTCAAATCTAAGG + Intronic
970318422 4:14851965-14851987 CATTGCAAGTTCACTATTTTTGG - Intergenic
970342092 4:15118149-15118171 CATTAGCAGATTAATACTTATGG - Intergenic
970980381 4:22089325-22089347 CATTGCTAGAATTATATTTAAGG + Intergenic
971765493 4:30825457-30825479 CAATGCCACATTAAAATTTAAGG + Intronic
972487511 4:39556241-39556263 AATTGACAGCTTAATCTTTATGG - Intronic
973299140 4:48560205-48560227 CTTTGCCACTTTAAAATTTGAGG - Intronic
973898257 4:55438637-55438659 CATTGCCAGTTTGTTTTTCAAGG + Intronic
977201094 4:94117594-94117616 CATTGTCAGTTTATTGTTGAAGG - Intergenic
977366704 4:96078461-96078483 ATTTGCCTATTTAATATTTAGGG - Intergenic
977397539 4:96489495-96489517 CACTGCCTGTTTTATATTCACGG - Intergenic
977787935 4:101061209-101061231 CAATGCCAGAGTAATAGTTAAGG - Intronic
978668386 4:111214733-111214755 CCTTGCAAGTTTATTGTTTAGGG + Intergenic
982340720 4:154295369-154295391 CATTGCTATTTTGTTATTTAGGG - Intronic
982894751 4:160905152-160905174 CATTGCTAGTGAAATATTTTAGG + Intergenic
983772410 4:171568823-171568845 CAATGACAGGTTCATATTTAAGG - Intergenic
985074016 4:186195027-186195049 CAATGCAAATTTGATATTTATGG + Intronic
986969478 5:13315372-13315394 CATTTGCAGTTTAATTTTTCAGG - Intergenic
987484167 5:18502824-18502846 TATTGTAAGTTTAATATTAAAGG - Intergenic
987848605 5:23319856-23319878 CATTATCATTTTAATATTCATGG + Intergenic
989260235 5:39411412-39411434 AATTGCCATTTCAATACTTAAGG + Intronic
989413554 5:41147912-41147934 CTCTGCCAATTTAATACTTAAGG - Intronic
989792122 5:45418062-45418084 AATTGCCACTTTATTATTTTAGG - Intronic
989993314 5:50795567-50795589 CATTGCCAGTTGCAAATGTATGG - Intronic
990206687 5:53437368-53437390 CTTTGCCAATATAATATATAAGG + Intergenic
990676471 5:58191897-58191919 TGTTGTCATTTTAATATTTAAGG - Intergenic
990862791 5:60346535-60346557 AATTGCCAGTCTAATATTCATGG + Intronic
992116822 5:73546286-73546308 TATTTCCAGTGTAATAATTATGG + Intergenic
995927544 5:117393223-117393245 CTTTTCCAGTTTAATATCTTTGG - Intergenic
1000178376 5:158781944-158781966 CCTTGACAGAATAATATTTAGGG + Intronic
1000435098 5:161198326-161198348 TAATGCCAGTTTCAGATTTATGG + Intergenic
1004046523 6:12029994-12030016 CGTTGCTTTTTTAATATTTATGG + Intronic
1005087096 6:22018327-22018349 AATTGGCAGTTTGATATTTTAGG + Intergenic
1005262905 6:24080902-24080924 CAATGCCAGTTTAATCATTCTGG - Intergenic
1005798601 6:29394479-29394501 CACTGCAATTTCAATATTTAGGG - Intronic
1006343983 6:33465089-33465111 CATTAACAGATGAATATTTAGGG - Intergenic
1006970090 6:38034449-38034471 CATTTCCAGTTCAAGATATAAGG + Intronic
1009423495 6:63488982-63489004 GATTGCCAGTTTAAAATTGGAGG - Intergenic
1012188936 6:96257143-96257165 AATTGACAGTTGAATGTTTAAGG + Intergenic
1012529096 6:100212986-100213008 TATTGCTTGTTTGATATTTATGG + Intergenic
1013142659 6:107354242-107354264 CCTTGTCAGATTAATATTTGTGG - Intronic
1015200045 6:130569121-130569143 TTTTGCCAGTTTATTATTCATGG - Intergenic
1016433883 6:144015410-144015432 AATTGCCAGTTTATTCTTTTAGG - Intronic
1020366356 7:7384792-7384814 CAGTGTCAGTTTAATGTTTAGGG - Intronic
1021105424 7:16633393-16633415 CATTGCACTTTTAATCTTTATGG - Intronic
1022894156 7:34732501-34732523 CACTGCCAGCTTAAGATTCAGGG + Intronic
1026195843 7:68172894-68172916 CATTGCCAGGTTAACATTGGTGG + Intergenic
1027772178 7:82420483-82420505 CAGTGCAAGTTTCATATTTAAGG - Intronic
1027894758 7:84026315-84026337 AATTGCCAGTTAAATAGATATGG - Intronic
1028363861 7:90004043-90004065 GTGTGCCAGTTTCATATTTATGG + Intergenic
1028407702 7:90494213-90494235 TGTTGCTATTTTAATATTTAGGG - Intronic
1028816305 7:95149888-95149910 AATGGCCAACTTAATATTTAAGG + Intronic
1029846977 7:103421973-103421995 CATTTCCAATTCTATATTTATGG + Intronic
1031159294 7:118146648-118146670 CTGTGCCAGTTTAATAATAATGG - Intergenic
1031460140 7:122038626-122038648 CTTTGCAAGTTTATTTTTTATGG + Intronic
1032597995 7:133261566-133261588 CATTGTCAGTTTTATCTTGATGG + Intronic
1033736891 7:144231338-144231360 GATTGCCAGCTGAATGTTTATGG + Intergenic
1033746166 7:144319608-144319630 GATTGCCAGCTGAATGTTTATGG - Intergenic
1033936007 7:146586309-146586331 CTTTGTAACTTTAATATTTAAGG + Intronic
1035977596 8:4330292-4330314 TATTGTCAATTTAATATTTTGGG + Intronic
1037234804 8:16705351-16705373 CATTGCCAGTTAGAAACTTAGGG - Intergenic
1041332223 8:56739434-56739456 CATGACCAATTTAATATTTGAGG + Intergenic
1041334516 8:56765537-56765559 AATAGCCAGTATAATATTGAAGG - Intergenic
1041604464 8:59763704-59763726 CTTTACCTGTTTAATATTTAGGG + Intergenic
1043548209 8:81338877-81338899 CATTTCCAATTTAAAATGTAAGG - Intergenic
1043683569 8:83062036-83062058 TATTTTCAGGTTAATATTTATGG - Intergenic
1044147631 8:88737288-88737310 CATTGCAACTTTAAAATTTTTGG + Intergenic
1045986551 8:108255993-108256015 CACTTCCAGTTTAATTTTAAAGG - Intronic
1046202405 8:110944550-110944572 CATGACCAATTTAGTATTTAAGG - Intergenic
1047618546 8:126583299-126583321 AATTGTCAGTTTAGTGTTTATGG + Intergenic
1051217950 9:14818959-14818981 TACTGCCAATTTAATATTCACGG + Intronic
1051403632 9:16710373-16710395 CAATGCCACTGTAATATTTCTGG - Intronic
1051850879 9:21506267-21506289 CATTGCAAGTTTGATTATTATGG - Intergenic
1051924511 9:22307455-22307477 CATTTCCAGATTAATCTTTCTGG + Intergenic
1052231388 9:26158267-26158289 CTTTGCCAGTATAAAAATTATGG - Intergenic
1052639082 9:31141522-31141544 AAATGCCAGTTTAATTTTCATGG + Intergenic
1054926645 9:70596386-70596408 CATTGCTAACTCAATATTTATGG - Intronic
1055495018 9:76845511-76845533 CATTGCCAGGAAAATATTTAAGG + Intronic
1055593547 9:77843159-77843181 CAGTGCCACATTAATGTTTAAGG - Intronic
1056013633 9:82358574-82358596 CCTAGCCAGCTTTATATTTAAGG + Intergenic
1056412896 9:86349474-86349496 GATTGCCAGTTTAATGTATTTGG - Intronic
1058289787 9:103224821-103224843 CATTGCCAGTTTAAAAATGTAGG - Intergenic
1058310372 9:103493380-103493402 CATTGCCAATTTAAAAATTTAGG - Intergenic
1058509820 9:105705324-105705346 CATTGCCAGTTTCCTAGTAATGG - Intronic
1058854127 9:109043432-109043454 GTTTACCAGTCTAATATTTATGG + Intronic
1185871461 X:3668223-3668245 CATTGCATGTTTAGTATTTGGGG - Intronic
1186242307 X:7582590-7582612 CATTGCCCTTTAAATATTGAGGG - Intergenic
1186355939 X:8790073-8790095 TTTTTCCAGTTTAATATTCACGG - Intergenic
1189803466 X:44712884-44712906 CATTGCCAAGTTCATTTTTAAGG + Intergenic
1190456298 X:50630774-50630796 CATTTACATTTTAAAATTTATGG - Intronic
1193227638 X:79003297-79003319 CAGTTCCATTTTTATATTTATGG - Intergenic
1194738154 X:97539218-97539240 CACTGCCATTTTTATAGTTAAGG - Intronic
1198119401 X:133577493-133577515 CCTTGCCCTTTTAATATTCAGGG + Intronic
1198633942 X:138674438-138674460 TATTGCCAGTTGATTAATTACGG + Intronic
1200792650 Y:7313467-7313489 CATTGCATTTTTAGTATTTAAGG + Intergenic
1202274556 Y:23102160-23102182 CATTTCCATTGTAAAATTTATGG - Intergenic
1202291471 Y:23318526-23318548 CATTTCCATTGTAAAATTTATGG + Intergenic
1202427549 Y:24735896-24735918 CATTTCCATTGTAAAATTTATGG - Intergenic
1202443242 Y:24934198-24934220 CATTTCCATTGTAAAATTTATGG + Intergenic