ID: 967014976

View in Genome Browser
Species Human (GRCh38)
Location 3:185473523-185473545
Sequence TTCTGGCCTGCACTGAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967014976_967014983 18 Left 967014976 3:185473523-185473545 CCTGCCTTCAGTGCAGGCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 179
Right 967014983 3:185473564-185473586 ATACCCTCTGCTGAGCCAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 120
967014976_967014982 17 Left 967014976 3:185473523-185473545 CCTGCCTTCAGTGCAGGCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 179
Right 967014982 3:185473563-185473585 CATACCCTCTGCTGAGCCAGTGG 0: 1
1: 0
2: 1
3: 15
4: 159
967014976_967014987 22 Left 967014976 3:185473523-185473545 CCTGCCTTCAGTGCAGGCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 179
Right 967014987 3:185473568-185473590 CCTCTGCTGAGCCAGTGGGGAGG 0: 1
1: 0
2: 5
3: 27
4: 373
967014976_967014984 19 Left 967014976 3:185473523-185473545 CCTGCCTTCAGTGCAGGCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 179
Right 967014984 3:185473565-185473587 TACCCTCTGCTGAGCCAGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967014976 Original CRISPR TTCTGGCCTGCACTGAAGGC AGG (reversed) Exonic
902318916 1:15645941-15645963 TTGTGGCCTTCACTGTAGGGTGG + Intronic
903473251 1:23602040-23602062 TTCTGGCAGGCACTGGAGGCTGG - Intronic
904266879 1:29323372-29323394 CTCTGGCCAGTACTGCAGGCAGG - Exonic
904824174 1:33264025-33264047 TGCTGGCCTGCACCCCAGGCTGG + Intronic
908088536 1:60662290-60662312 TTGTGGCTTGCTCTGAAAGCAGG - Intergenic
915007224 1:152649943-152649965 TCCTGGCCTGAACTTAATGCAGG + Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
920396345 1:205648788-205648810 TTCTGGCCTGCATTTGAGGCTGG - Intergenic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
923280649 1:232439888-232439910 TTCTGCCCTGAACTCAAGGCTGG - Intronic
923334225 1:232952927-232952949 TTCTGGCCTGCTCTGTTTGCAGG - Intronic
1066048707 10:31616956-31616978 TTCAGACCAGCACTGAGGGCTGG + Intergenic
1066601211 10:37109134-37109156 TACTGGTGTGCACTGATGGCTGG - Intergenic
1067462458 10:46467780-46467802 TTCTTGCCTGCACAGAGGACGGG - Intergenic
1067534560 10:47099445-47099467 TTCTGACCTTCACTGCAGCCAGG + Intergenic
1067624738 10:47916857-47916879 TTCTTGCCTGCACAGAGGACGGG + Intergenic
1067682345 10:48449040-48449062 CTCTGGCCTGCTCTGAGGCCTGG - Intronic
1067795447 10:49318132-49318154 TTCTTGTCTGCATTCAAGGCAGG + Intronic
1069855874 10:71440735-71440757 CCCTGGGCTGCACTGAAGGCAGG + Intronic
1069991434 10:72319053-72319075 TTCTGGCAGGCACTCAAAGCAGG + Intergenic
1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG + Intergenic
1076506145 10:130973750-130973772 TTCTGGCTGGCACAGAGGGCTGG - Intergenic
1080684148 11:34501710-34501732 TGCTTGGCTGCACTGCAGGCAGG - Intronic
1081837137 11:46165123-46165145 ATCTTGCCTGCAGTGAAGGGCGG - Intergenic
1083814841 11:65126862-65126884 TTCTGACCTGCAATCAAGGCTGG + Exonic
1084161447 11:67352684-67352706 CTCTGACCTGCACTGGAAGCGGG + Exonic
1085889438 11:80560091-80560113 TACTGGTGTGCACTGATGGCTGG - Intergenic
1086985242 11:93240986-93241008 TCCTGTGCTGCACTGAAGGAAGG + Intergenic
1087591853 11:100199368-100199390 CTTTGGCCTGCTCTGAACGCTGG + Intronic
1089643638 11:119864014-119864036 TTCTGGGCTGCACTCCTGGCGGG + Intergenic
1089742449 11:120593982-120594004 TGGTGGCCTGGACTGAAGGGTGG - Intronic
1092727223 12:11498136-11498158 TCATGGTCTGCACTGAAGACAGG + Intronic
1095570088 12:43674982-43675004 TCCTGGCCTCCACAGATGGCAGG - Intergenic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1096967022 12:55636877-55636899 TTCTGGCCTGGAGTGATGGCTGG + Exonic
1097363447 12:58683991-58684013 ATTTGTCATGCACTGAAGGCTGG + Intronic
1097981822 12:65742896-65742918 TTCTGAGCTGCACTGATGGCGGG + Intergenic
1101903107 12:108806267-108806289 CTCTGACCTGCAATGAAGGGAGG + Intronic
1101923204 12:108949854-108949876 TTCTGGCCTGCCACAAAGGCTGG - Intronic
1102182696 12:110924129-110924151 TTGTGCCCTGCCCTCAAGGCTGG + Intergenic
1102487277 12:113266783-113266805 TTCTGGCCCCCACTGAATGATGG - Intronic
1103177569 12:118877889-118877911 TTCTGGAGTGGACTGAAGTCTGG - Intergenic
1104853935 12:131893316-131893338 TTTAGGACTGTACTGAAGGCTGG + Intergenic
1106570263 13:30920787-30920809 TTCTGGGCTGCTGTAAAGGCAGG - Intronic
1106850115 13:33781181-33781203 CTCTTGCCTGAACTGAAAGCTGG + Intergenic
1107917547 13:45168345-45168367 TTCTGGCCTGCCCTCCAGGCAGG - Intronic
1107960586 13:45554747-45554769 CTCTGGCCTGTCCTGCAGGCGGG + Intronic
1109640789 13:65189084-65189106 TTCTGGGTGGTACTGAAGGCTGG + Intergenic
1112374177 13:98823614-98823636 TTCTGCCCTGGGCTGAAGGGAGG + Intronic
1114760070 14:25303966-25303988 TTCTGGACTGCACTTAACACTGG + Intergenic
1117957641 14:61135087-61135109 TCCTGGCCTGGACTGCAGTCTGG - Intergenic
1121009677 14:90512596-90512618 GTGTGGCCTGGACTGCAGGCAGG - Intergenic
1121055427 14:90847639-90847661 TTCTGAACTGCCCTGAAGGACGG - Intergenic
1121396594 14:93629337-93629359 TACTGGCCTGCACTCTATGCAGG - Intronic
1122401266 14:101468940-101468962 GGATGGCCTGCACTGAAGCCGGG + Intergenic
1125911286 15:43442051-43442073 ATCTGGCCTGCACTGCAGCCTGG - Intronic
1127758328 15:62113957-62113979 TTCTGTCCTGCCCTGAGGGCAGG - Intergenic
1129357029 15:74998041-74998063 CTCTGGCCTGATCTGAAGCCAGG + Intronic
1129898926 15:79130536-79130558 CTCTGACCTGCTCTGAGGGCAGG + Intergenic
1131823606 15:96297478-96297500 TTCTGGCCAGGTTTGAAGGCAGG - Intergenic
1132116057 15:99137302-99137324 CTGTGGCCTCCACTGCAGGCAGG - Exonic
1132547726 16:540950-540972 TCCTGGCCCTCACTGGAGGCAGG + Intronic
1135829916 16:25763949-25763971 TTGTGGCCTGCACTGAATTAGGG + Intronic
1139464651 16:67147903-67147925 TTCTGTTCTGCACTGTGGGCTGG + Exonic
1140599335 16:76456639-76456661 ATCTGGCTGGCACTGAGGGCTGG - Intronic
1142431094 16:90027816-90027838 TTCTGGCTTGGACAGAAGGGTGG - Intronic
1144100193 17:11936157-11936179 TCCAGGCCTGCACAGAACGCTGG + Intronic
1144763714 17:17721878-17721900 TTCTGGCATTCCCTGAAGCCTGG - Intronic
1144811061 17:17999216-17999238 AGCTGGCCCGCAATGAAGGCAGG - Intronic
1144853816 17:18257489-18257511 TGCTGGCCTGCCCTGCAGGGTGG - Intronic
1145081428 17:19897613-19897635 TTCTGGACTGCAAGGAGGGCAGG + Intergenic
1146716143 17:35088901-35088923 GTGTGGGCTGCCCTGAAGGCGGG + Intronic
1147282986 17:39377966-39377988 TTCTAGCCTGCACTCTAGCCTGG + Intronic
1147460353 17:40564338-40564360 TTCCCGCCTGCCCTGAACGCTGG - Intronic
1148431140 17:47644627-47644649 TTCTGGCTTGCACTGCAGAATGG - Intergenic
1149558725 17:57593153-57593175 TGCTGCTCTGGACTGAAGGCAGG - Intronic
1150617463 17:66783428-66783450 CTCTGGGCCCCACTGAAGGCTGG - Intronic
1151669677 17:75565158-75565180 TTCTGCCCTGCCCAGAAGGCGGG - Intronic
1152994842 18:396904-396926 TGTTGGACTGCACTGAGGGCAGG + Intronic
1154020960 18:10663629-10663651 TTCTGGCCCACACTGAGGTCGGG - Intergenic
1154266850 18:12885865-12885887 TACAGGGCTGCACTGAAGCCCGG + Intronic
1156391267 18:36652674-36652696 TTCTGGTTGGCACTGCAGGCGGG + Exonic
1157169918 18:45393725-45393747 CTCTGGCCTGCTTTGCAGGCTGG + Intronic
1158439468 18:57461774-57461796 TTCTGGCCTGCACTGCATGTGGG + Intronic
1159188110 18:65005503-65005525 CTTTGGTCTGCACTGAAGGCAGG + Intergenic
1160701484 19:509564-509586 TGCTGGCCGCCACTGGAGGCTGG - Intronic
1161494671 19:4580730-4580752 TTCTGGGCTGGACAGGAGGCCGG + Intergenic
1163271785 19:16258847-16258869 CTCTGGCCTGCAGTGATGCCCGG - Intergenic
1163473320 19:17510755-17510777 TTCTTGCCTGGACAGAGGGCTGG - Intergenic
1163696090 19:18764267-18764289 ATCTGGCCTGCAGTCAAGGCGGG - Intronic
1163729238 19:18940192-18940214 CTCTGGCCTGGACTGGGGGCGGG + Intronic
925732426 2:6928854-6928876 TTCTGACCATCACCGAAGGCAGG - Intronic
926408910 2:12581610-12581632 TTCTGGGCCCCACTCAAGGCTGG - Intergenic
931068167 2:58611500-58611522 CTCTGACCTGCCATGAAGGCAGG - Intergenic
933854292 2:86398259-86398281 TTCTGGCCACCAGTGAATGCAGG - Intergenic
935784666 2:106537970-106537992 TTCTGACCTGCGCTGAGAGCTGG + Intergenic
937445309 2:121952551-121952573 TACTGGGCTGCTCTGAAGACTGG + Intergenic
937662970 2:124452036-124452058 TCCTGGCCGGCACTCAAGGAAGG + Intronic
938064075 2:128271744-128271766 TCCTGGCCTGCAGTGACGGGTGG + Intronic
941884259 2:170512365-170512387 TTCTGGCTTGGACTGACAGCTGG - Intronic
943799711 2:192042955-192042977 TTCTGGCCTGCAGAGAAGAGTGG - Intronic
944822556 2:203445397-203445419 TTCTGGCGTGACCTTAAGGCAGG - Exonic
946490508 2:220144842-220144864 TTCTGGCCTGGCCTCAAGGCTGG + Intergenic
947592675 2:231394486-231394508 TTCCTGCCTGGTCTGAAGGCTGG - Intergenic
948423739 2:237875581-237875603 GTCGGGCCTGCATGGAAGGCTGG - Intronic
1169049945 20:2567202-2567224 TTCAGGCCTCCACTCAAGCCTGG - Intronic
1169557931 20:6768949-6768971 TTCTGGCCTGGACGTAAGGAAGG - Intronic
1171031047 20:21676648-21676670 TTCTGTCATGCTCTGAAGCCTGG - Intergenic
1171139791 20:22730620-22730642 CTCTGGCCTGCCCTGAACTCAGG - Intergenic
1171256411 20:23691857-23691879 CTCTGGCATGCACTGCAGGGAGG + Intergenic
1171272934 20:23830451-23830473 TGCTGGCATGCACTGCAGGGAGG + Intergenic
1172970490 20:38869890-38869912 TTTTGCTCTGCAGTGAAGGCAGG - Intronic
1173054590 20:39598797-39598819 TTCTGGCCTGCACTCCTGGCTGG - Intergenic
1174109311 20:48187178-48187200 TCCTGGGCTGCACTGCAGCCCGG + Intergenic
1174299389 20:49570485-49570507 TATTGGTCTGCACTGAAGCCAGG - Intergenic
1175121490 20:56719400-56719422 TTCTGGGCACCACTGAAGGTTGG + Intergenic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1179516629 21:41913005-41913027 TTGTGGCCAGCACTGACGGAGGG - Intronic
1180664826 22:17502329-17502351 TTCAGGGCCGCACTGAAGACAGG - Intronic
1181160636 22:20957719-20957741 TTCTGGCGTCCACGGATGGCGGG + Intergenic
1182573922 22:31259990-31260012 TGCCGGCCACCACTGAAGGCAGG + Exonic
952917944 3:38263619-38263641 TTGTGGCCTTGAATGAAGGCAGG + Intergenic
953685604 3:45076169-45076191 TGCTGGCCTGGGCAGAAGGCTGG + Intergenic
955516079 3:59727738-59727760 TGCTTCTCTGCACTGAAGGCAGG + Intergenic
956292143 3:67672306-67672328 TTCTAGCCTGCCCTGCATGCTGG - Intergenic
960434454 3:117608373-117608395 TTCTGGCATGCAAAGAAGGTAGG + Intergenic
962111021 3:132448377-132448399 ATCTGGCCTGTACTGAAGCTTGG + Intronic
962198991 3:133385968-133385990 GTCAGGCCTGCACTGCAGTCTGG - Intronic
962346496 3:134623083-134623105 TGCAGGCCTGCACTGCAGCCTGG + Intronic
965536255 3:169826721-169826743 TTTTGGACTGCACAGAATGCAGG + Intronic
965917216 3:173864722-173864744 TTCTAGTCAGCTCTGAAGGCAGG + Intronic
966774587 3:183532761-183532783 TTGTGGAGGGCACTGAAGGCAGG + Intronic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
967438794 3:189482077-189482099 TTTTGGCATGCTCTGAAAGCTGG - Intergenic
967823281 3:193858216-193858238 TTCTGGACTGCACTCAAAACTGG - Intergenic
968006403 3:195246125-195246147 TTCTTGCCTGTAATGAAGGGAGG + Intronic
970053581 4:11945772-11945794 TTCTGGCTTGCACTGATTGCTGG + Intergenic
976711392 4:88075285-88075307 TTCTACCCTGCAGTGAAGGCAGG - Intronic
977978150 4:103291384-103291406 TTCTGGAATGTACTGAATGCAGG + Intergenic
978596146 4:110379459-110379481 CTCTGGGCTGCGCTGAAAGCAGG - Intronic
979852323 4:125588353-125588375 TCCTGGGCTGCAATGGAGGCCGG - Intergenic
984575014 4:181438049-181438071 TTCTGGCCTGCCCATAGGGCTGG + Intergenic
985673418 5:1218060-1218082 TCCTGCCCTGCACTGAAGAGCGG + Intronic
985738465 5:1599811-1599833 TTCTAGACTACACTGAAGGCTGG - Intergenic
986487879 5:8258597-8258619 TTATGTCCTGCACTGGGGGCTGG + Intergenic
988114862 5:26873213-26873235 TTCTTGCCTGCACCAAAGGAGGG + Intergenic
988807587 5:34754673-34754695 TTCTGGCCTGCACTGAAAAGAGG + Intronic
990188538 5:53232635-53232657 TTCTGGGTTGAACTGAGGGCTGG - Intergenic
990320752 5:54627817-54627839 CACTAGCCTCCACTGAAGGCAGG - Intergenic
991958037 5:72015136-72015158 TTCCTGCCTGCACTGCTGGCTGG - Intergenic
993366860 5:87044516-87044538 TTCTAGACTGCAGTGAAGGGAGG - Intergenic
997240221 5:132301340-132301362 TGGTGGCCTGCAAAGAAGGCTGG - Intronic
998550954 5:143077649-143077671 TTCTGGCTTGCACAGATGACAGG + Intronic
998620625 5:143790477-143790499 TTTTGGCTTGATCTGAAGGCTGG + Intergenic
999193271 5:149764349-149764371 TCCAGCCCTGCACTGGAGGCTGG + Intronic
999304045 5:150508404-150508426 TTCTGATCTGGAATGAAGGCAGG - Intronic
999880260 5:155855171-155855193 TTCTGACCTGCTCTGAATGTGGG - Intergenic
1000618717 5:163459542-163459564 TTCTTCCGTGCACTGAAGACAGG - Intronic
1001937184 5:175713839-175713861 TTCTGTCCTGCACTGGAAGTAGG - Intergenic
1002087004 5:176782165-176782187 GTCTGGCCTGCACAGAGGGGAGG + Intergenic
1002518955 5:179779840-179779862 CACAGGCCTGCACTGCAGGCTGG - Intronic
1002536779 5:179880156-179880178 TCCTGGGCTGCACAGAGGGCTGG + Intronic
1003205387 6:4005147-4005169 CTCTGCCATCCACTGAAGGCAGG + Intergenic
1003822191 6:9911029-9911051 CTCTCCCCTGCTCTGAAGGCAGG - Intronic
1006730906 6:36235614-36235636 TTCTGGCCTCTACTGAAGCTGGG + Intergenic
1013930961 6:115532383-115532405 TTCTAGCTTTCTCTGAAGGCAGG - Intergenic
1014563874 6:122924707-122924729 TGCTAGCCAGCAATGAAGGCTGG + Intergenic
1014696074 6:124622868-124622890 TGCTGGCCTGCTCTGGAGCCTGG + Intronic
1015134972 6:129858504-129858526 TTCTGTCCTGCAGTGAGGGGTGG - Intronic
1017495238 6:154977894-154977916 TTCTGGGCTGGACTGAAGGGTGG + Intronic
1020379020 7:7521688-7521710 TACTGACCTGAACTGAGGGCAGG - Intronic
1026137269 7:67674399-67674421 TCCTTGCCTGCAGGGAAGGCTGG + Intergenic
1027877653 7:83791291-83791313 TTCTGGCCTGCACTGCGGGGAGG - Intergenic
1028649197 7:93131661-93131683 TTCTGGCCAGAACAGGAGGCAGG + Exonic
1028968435 7:96828545-96828567 TTATGGGTTGCACTTAAGGCAGG - Intergenic
1029256437 7:99272850-99272872 TGCAGCCCTGGACTGAAGGCAGG + Intergenic
1030399445 7:109029841-109029863 TTCAGGACTCCACAGAAGGCAGG + Intergenic
1033756213 7:144399750-144399772 TTCTGACCTGCATTGACTGCTGG + Exonic
1033822381 7:145149883-145149905 TTCTGGCCTGAGCATAAGGCAGG - Intergenic
1034228334 7:149499673-149499695 CTCTGTCCTCCACTGAAGACAGG + Intergenic
1035558994 8:591126-591148 TTCCGTCGTGCACTGCAGGCTGG + Intergenic
1036477136 8:9103630-9103652 CTCTGACCTTCACTGCAGGCTGG + Intronic
1036534159 8:9629135-9629157 TTCTGGCCTGCAATGAGGTAAGG + Intronic
1041099152 8:54379214-54379236 ATCTGGACTGCACTGAAACCTGG + Intergenic
1042499617 8:69493643-69493665 TTCAAGCCTGCACTGAAAGATGG - Intronic
1045344643 8:101283099-101283121 TTCTGGCCTGAGTTGCAGGCAGG + Intergenic
1048208790 8:132437357-132437379 TTCTGGCATCCACTCATGGCTGG + Intronic
1049389281 8:142359795-142359817 TCATGCCCTGCACTGACGGCTGG - Intronic
1050610106 9:7343342-7343364 TTCTTGCCTGCGTGGAAGGCCGG - Intergenic
1059223416 9:112647813-112647835 TTCTGAACTGCAATGAAGGGAGG + Intronic
1059436999 9:114282996-114283018 TGCTGGGCTGCTCTGAAGGAAGG + Intronic
1060085444 9:120695878-120695900 TTCTGGCCTCCCCTGCAGCCAGG + Intronic
1060304043 9:122394427-122394449 TTCTGGCCTCTGCTGAATGCAGG + Exonic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062676856 9:137751752-137751774 TTCTAGTCTGCACAGATGGCAGG - Intronic
1187190844 X:17033505-17033527 TTCTGGCCTGTGCTGATGGGTGG - Intronic
1188448701 X:30285837-30285859 TTTTGGCCAACACTGGAGGCGGG + Intergenic
1191594082 X:62923173-62923195 TGCTGGCCAGCACAGCAGGCTGG + Intergenic
1194249144 X:91552080-91552102 TGCTGGCTTGCACCGAAGGTTGG - Intergenic
1200047650 X:153411298-153411320 GTCTGGGCTGCTCTGAAGGCTGG - Intergenic
1200337370 X:155364407-155364429 TTCTGCTGTGCACTGAGGGCAGG + Intergenic
1200349100 X:155476820-155476842 TTCTGCTGTGCACTGAGGGCAGG - Intergenic
1200874030 Y:8134051-8134073 TTCTGGACTGCACTCCAGCCTGG + Intergenic