ID: 967015354

View in Genome Browser
Species Human (GRCh38)
Location 3:185476646-185476668
Sequence CCCAGCAATCACGGGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967015342_967015354 4 Left 967015342 3:185476619-185476641 CCCCGCCTTCCAGATCAACCATG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149
967015341_967015354 22 Left 967015341 3:185476601-185476623 CCTCAGTCAGGACACTTACCCCG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149
967015346_967015354 -1 Left 967015346 3:185476624-185476646 CCTTCCAGATCAACCATGGAGCC 0: 1
1: 0
2: 0
3: 13
4: 124
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149
967015347_967015354 -5 Left 967015347 3:185476628-185476650 CCAGATCAACCATGGAGCCCCAG 0: 1
1: 0
2: 0
3: 10
4: 110
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149
967015343_967015354 3 Left 967015343 3:185476620-185476642 CCCGCCTTCCAGATCAACCATGG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149
967015345_967015354 2 Left 967015345 3:185476621-185476643 CCGCCTTCCAGATCAACCATGGA 0: 1
1: 0
2: 2
3: 11
4: 154
Right 967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG 0: 1
1: 0
2: 2
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967015354 Original CRISPR CCCAGCAATCACGGGGACTC AGG Intronic
901027387 1:6285782-6285804 CCCAGCAATGAGGGGAGCTCAGG + Intronic
901076733 1:6559863-6559885 CCCTGCAATCCCAGGTACTCTGG + Intronic
902565713 1:17310027-17310049 CCCAGAAAGGATGGGGACTCCGG + Intronic
903067468 1:20708604-20708626 CCCAGACATCACGGAGACCCGGG + Intronic
905168690 1:36098117-36098139 CCCTGGAATCACGGGCCCTCCGG - Exonic
905361587 1:37424529-37424551 CCCAGCAACCAAGTGGACTGTGG - Intergenic
905937891 1:41839342-41839364 CCCAGCAATCATCGGGACAATGG - Intronic
905945042 1:41894771-41894793 CCCAGCACTGAAGGTGACTCTGG + Intronic
906029712 1:42708840-42708862 CCCAGCACTCTGGGGGACTGAGG - Intergenic
907041676 1:51266576-51266598 CCCAGCTACCTCGGGGACTGAGG - Intronic
913563540 1:120047557-120047579 CCCAGTAATCCCGGCTACTCGGG + Intronic
913634583 1:120746020-120746042 CCCAGTAATCCCGGCTACTCGGG - Intergenic
913659550 1:120994265-120994287 CCCAGCAGCCACGGAGACTGAGG + Intergenic
914284135 1:146206921-146206943 CCCAGTAATCCCGGCTACTCGGG + Intronic
914545166 1:148657660-148657682 CCCAGTAATCCCGGCTACTCGGG + Intronic
914621401 1:149413027-149413049 CCCAGTAATCCCGGCTACTCGGG - Intergenic
915915835 1:159940405-159940427 CCCAGGACTCAGGAGGACTCAGG - Intronic
918518894 1:185392841-185392863 CCCTGTAATCCCAGGGACTCAGG - Intergenic
919382820 1:196879494-196879516 CCCAACACACACGGGCACTCAGG - Intronic
920288352 1:204898131-204898153 CCCAGCACTCTGGGTGACTCAGG - Intronic
922262568 1:223956096-223956118 CCCAGCAATTAGGGAGACCCAGG - Intergenic
922947418 1:229529039-229529061 CCCAGCACTCTGGGGGACTGAGG + Intronic
923704609 1:236333823-236333845 CCCAGCAATTTGGGGGACTGAGG - Intergenic
924344406 1:243061097-243061119 CCCAGCAATTAGGGAGACCCAGG - Intergenic
1062909077 10:1200297-1200319 CCCAGCCATCACTGGGGCTCTGG + Intronic
1065005103 10:21372296-21372318 CCCAGCTACCAGGGGGACTGAGG + Intergenic
1065253530 10:23841355-23841377 CCCAGCAATGACAGTTACTCAGG - Intronic
1065976247 10:30845377-30845399 CCCAGGAAGCAAGGGGACTCAGG - Exonic
1066601621 10:37114216-37114238 CCCAGCACTCTGGGGGACTAAGG - Intergenic
1068658442 10:59598026-59598048 CCAAGCAATTTCTGGGACTCAGG + Intergenic
1069626732 10:69872678-69872700 CCAAGTAACCATGGGGACTCTGG + Intronic
1070236220 10:74629287-74629309 CCCTGCAATCCCAGTGACTCAGG - Intronic
1071526562 10:86362977-86362999 CCCCGCAACCATGGGGACTCTGG - Intronic
1075970689 10:126649804-126649826 CCCAGCAACCTCTGGGTCTCAGG - Intronic
1076162376 10:128255296-128255318 CCCAGGATTCAGGGGGACCCAGG - Intergenic
1076755054 10:132565223-132565245 CCCAGCACTCAGGGAGACTGAGG - Intronic
1083597401 11:63924806-63924828 GCCTGTAATCACGGTGACTCAGG - Intergenic
1086265321 11:84991257-84991279 CCCAGCAATTTGGGGGACTGAGG + Intronic
1088270298 11:108027394-108027416 CCCAGTAATCCCGGCTACTCAGG - Intronic
1088271326 11:108037414-108037436 CCCAGCAATCACTGAGCCTAGGG - Intronic
1088298605 11:108329527-108329549 CCCAGCTATTTCGGGGGCTCAGG - Intronic
1090052258 11:123389868-123389890 CCCAGTAATCACAGCTACTCAGG - Intergenic
1090397766 11:126430537-126430559 CCCAGCAATGATGTGGTCTCAGG - Intronic
1091582821 12:1799308-1799330 CCCAGCCCTCAGCGGGACTCCGG - Intronic
1091700047 12:2653085-2653107 CCCAGAAGTCACGGGGGCTCTGG + Intronic
1092049263 12:5456392-5456414 CCCAGAAATCAGTGGGACCCTGG + Intronic
1097224488 12:57469338-57469360 CCCAGCAGTCACTGGGACACAGG + Intronic
1102446307 12:113005432-113005454 CCCAGTAATCAGGGAGACTGAGG + Intronic
1103992747 12:124810155-124810177 GCCGGTAATCACTGGGACTCGGG - Exonic
1104157846 12:126150775-126150797 CCCACCTATCACAGGGACTTAGG - Intergenic
1104252202 12:127105655-127105677 CCCAGCACTCTGGGAGACTCAGG - Intergenic
1105613175 13:21986872-21986894 CCTATCCATCACGGGGCCTCTGG - Intergenic
1107906502 13:45065991-45066013 CCCAGCAATTTCGGAGACTGAGG + Intergenic
1116009550 14:39334689-39334711 CCCTGTAATCCCGGGTACTCGGG - Intronic
1119181408 14:72607694-72607716 TTCAGCAATCAGGGGGACTTAGG - Intergenic
1122126292 14:99580345-99580367 CACTGCACTCACGGTGACTCTGG - Intronic
1122284245 14:100641366-100641388 CTCAGCACTCCCAGGGACTCTGG + Intergenic
1122292893 14:100688884-100688906 CCCCGCAAACACAGGGGCTCAGG - Intergenic
1131134080 15:89920026-89920048 CCCAGCTATTTCGGGGACTGAGG + Intergenic
1132191432 15:99865589-99865611 CCCAGCTATTAAGGGGACTGAGG + Intergenic
1132425551 15:101713231-101713253 TCCTGCATTCATGGGGACTCGGG + Intronic
1132931164 16:2459946-2459968 CCCAGGTCTGACGGGGACTCCGG - Intergenic
1136074703 16:27808945-27808967 CCCAGCCATCAGTGGGACGCAGG - Intronic
1137429513 16:48407229-48407251 CCCAGCACTCTGGGGGACTGAGG - Intronic
1137673629 16:50293132-50293154 CCCAGCAGCCCCCGGGACTCAGG - Intronic
1138265221 16:55655807-55655829 CCCAGGGATCTGGGGGACTCGGG - Intronic
1139088417 16:63616659-63616681 CCCACCAATTCCGGGCACTCAGG - Intergenic
1141284639 16:82660179-82660201 CCCAGAAATCACGGGAACCAGGG + Intronic
1141835019 16:86532702-86532724 GTCAGCACTCACGGGGGCTCTGG + Intronic
1142212502 16:88815139-88815161 CCCAGGAATCATGGGAACTTGGG + Intronic
1142592790 17:1013720-1013742 CCCAGCAATCCCAGGGAGGCAGG - Intronic
1143544293 17:7587430-7587452 CCCAGCCATCAGGGGATCTCCGG - Exonic
1146814914 17:35934961-35934983 GCTAGCAATGACGGGGATTCTGG - Intronic
1147564514 17:41528126-41528148 CCCAGCATTCACGGGGGCTCCGG - Exonic
1148469083 17:47882481-47882503 CCCAGCAACCATGGGGAAACTGG - Intergenic
1151578552 17:74964728-74964750 CCCAGCAGGTAGGGGGACTCTGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156149174 18:34223186-34223208 CTCAGGACTTACGGGGACTCAGG - Exonic
1157811937 18:50703462-50703484 CCCAGCACTCAGGGGCTCTCAGG + Intronic
1158535127 18:58301661-58301683 TCCAACAATCACAGGGACCCTGG - Intronic
1159947760 18:74456971-74456993 CCCAGCCTTCCCGGGGACTTGGG - Intronic
1160693373 19:470591-470613 CCCAGCCCACACTGGGACTCAGG - Intronic
1161521406 19:4725786-4725808 CCCAGCACTCTGGGAGACTCAGG - Intergenic
1162150813 19:8644349-8644371 CCCAGCAATTTCGGAGACTGAGG - Intergenic
1163203043 19:15782039-15782061 TCCAACAATCCCCGGGACTCTGG - Intergenic
1163463135 19:17451045-17451067 CCCAGCATTTAGGGGGACTGAGG - Intronic
1163744937 19:19040761-19040783 CCCAGCAATCAGGGAGACCGAGG - Intronic
1164915950 19:32052493-32052515 CCCAGCAATGGCAGGGACTTGGG + Intergenic
1166047263 19:40236771-40236793 CCCAGCAATTTGGGGGACTTAGG + Intronic
1166653879 19:44595966-44595988 CCCAGCAATCAGGGAGGCTGAGG + Intergenic
1167513934 19:49911861-49911883 CCCAGCAGTCCTGGGGGCTCAGG - Intronic
924995670 2:358473-358495 CCCAGCATCCACGGTGACCCTGG + Intergenic
926599224 2:14823979-14824001 CCCAGACATCACGGTGATTCAGG - Intergenic
927129190 2:20043053-20043075 CCCAGCTACCCCGGGGACTGAGG - Intronic
930765847 2:55084389-55084411 CCCAGCAATTTCAGAGACTCAGG - Intronic
931331122 2:61285236-61285258 CCCAGCAATTAGGGAGGCTCAGG + Intronic
934976934 2:98809308-98809330 CCCAGCCACCACTGGGACTCTGG + Intronic
938266959 2:129934501-129934523 CCCAGGAGGCGCGGGGACTCGGG - Intergenic
939996360 2:148924332-148924354 ATCAGGAATCACGGGGACTATGG - Intronic
944723868 2:202449992-202450014 CCCAGCAATCTGGGGGGCTGAGG + Intronic
948112472 2:235467580-235467602 CCCAGCACTCTGGGAGACTCAGG + Intergenic
948640129 2:239370473-239370495 CCCAGTCAGCACGGGCACTCTGG + Intronic
948866067 2:240775502-240775524 CCCATCAGTCACGGGGACCTGGG - Intronic
1172190679 20:33060200-33060222 CCCACCACTGACAGGGACTCCGG + Intronic
1173031384 20:39364385-39364407 AACTGCAATGACGGGGACTCTGG + Intergenic
1175770428 20:61620012-61620034 CCCAGCATTCAGGGGGAGCCAGG + Intronic
1176161509 20:63651073-63651095 CCCAGCAATCTGGGAGACTGAGG - Intronic
1184354579 22:43970397-43970419 CTCAGCCATCAGAGGGACTCAGG - Intronic
1184809709 22:46822945-46822967 CCCAGGAATGATGGGGTCTCTGG - Intronic
950173042 3:10852537-10852559 CCCAGCAATCACTGGGACTTTGG - Intronic
953341525 3:42138634-42138656 CCCAGCACTCCCGGGGGCTGAGG + Intronic
954370860 3:50169006-50169028 CCCAGCAGTGATGGGGACTGGGG - Intronic
957413403 3:79869466-79869488 CCCAGCACTCAGGGAGGCTCAGG + Intergenic
961719896 3:128886456-128886478 CCCAGCACTTACGGAGACTGAGG + Intronic
962412054 3:135149855-135149877 CCCAGCAGTCAGCGGCACTCGGG - Intronic
967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG + Intronic
968562898 4:1294452-1294474 CCCAGCCATTACGGTGAATCAGG - Intronic
968671595 4:1855344-1855366 CCCGGGGAACACGGGGACTCCGG - Intronic
971085331 4:23268197-23268219 CCCAGCAATCTCCAGGTCTCTGG - Intergenic
971448401 4:26777561-26777583 CCCAGCAATCCCAGCTACTCTGG - Intergenic
991603331 5:68375316-68375338 CACAGCATTCACAGGGACTTGGG + Intergenic
1000301496 5:159960627-159960649 CCCAGCAATCAAGGCCAGTCTGG + Intronic
1007719835 6:43878398-43878420 CCCAGGCAGGACGGGGACTCCGG + Intergenic
1015113773 6:129622748-129622770 CCCAGCAATCTGGGAGACTGAGG + Intronic
1016761697 6:147744939-147744961 CCCAGCAATCACCGGGTGTGAGG + Intergenic
1016991152 6:149929386-149929408 TCCAGCAACCAGGGGGACCCAGG + Intergenic
1017000658 6:149995287-149995309 TCCAGCAACCACGGGGACCCAGG - Intergenic
1017842027 6:158230188-158230210 CCCAGCAATCCCAGCTACTCGGG + Intergenic
1019189517 6:170243441-170243463 CCCAGAGGTCACGGGGAATCAGG + Intergenic
1020697007 7:11424847-11424869 CTCAGCAATCTCAGGGAATCTGG + Intronic
1021097159 7:16547525-16547547 CCCTGCACTCTCGGGGACCCAGG + Intronic
1024203464 7:47130509-47130531 CCCAGCTATAATGGGGACTGAGG - Intergenic
1029497194 7:100902344-100902366 CCCAGGAAGCACAGGGACTTGGG - Intergenic
1032256826 7:130304114-130304136 CCCAGCAATCTGGGAGACTGAGG - Intronic
1033413318 7:141140014-141140036 CCCAGCACTCTGGGGGACTGAGG - Intronic
1033514813 7:142095195-142095217 CCCAGCACTTTCGGGGACTGAGG - Intronic
1034720162 7:153285008-153285030 CTGACCAATCACTGGGACTCTGG + Intergenic
1037637217 8:20710871-20710893 TCCAGCCTTCAGGGGGACTCTGG + Intergenic
1038285039 8:26198921-26198943 CCCAGCACTTTCGGGGACTGAGG - Intergenic
1038785810 8:30615025-30615047 CCCAGCACTCTGGGGGACTAAGG + Intronic
1038955534 8:32464142-32464164 CCCAGCACTCTGGGGGACTGAGG - Intronic
1039060466 8:33568009-33568031 CCCAGCAATCTGGGAGGCTCAGG - Intergenic
1039439026 8:37581773-37581795 CCCAGGAACCACGGGCACACTGG + Intergenic
1039444695 8:37621748-37621770 CCCTGCATTCACGTGGTCTCAGG + Intergenic
1041053024 8:53956028-53956050 CTCAGCACTCACTGGGGCTCGGG + Intronic
1042979816 8:74513734-74513756 CCCAGCTATCACTGTGATTCAGG + Intergenic
1049765278 8:144352542-144352564 CCCAGCACTCAGGAGGCCTCAGG + Intronic
1049826944 8:144674980-144675002 CCCTGCTCTCTCGGGGACTCAGG - Intergenic
1049938861 9:525502-525524 CCCAGCAATCCCAGCTACTCAGG - Intronic
1050305106 9:4298839-4298861 TCCCGCAATCATGGGGACACCGG + Intronic
1057777489 9:98022631-98022653 GCCAGCAATCCCAGTGACTCAGG - Intergenic
1061220500 9:129247735-129247757 TGCAGCAATCACAGGCACTCAGG + Intergenic
1185430859 X:11000-11022 CCCACCCATCCCTGGGACTCGGG + Intergenic
1185440125 X:223397-223419 CCCACCCATCCCTGGGACTCGGG + Intergenic
1186452874 X:9687881-9687903 CCCAGCAACCAGGGGGCCACGGG - Intronic
1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG + Intronic
1190806644 X:53844214-53844236 CTCAGAAATCACGGGGTCTGTGG - Intergenic
1195023530 X:100852919-100852941 CCCAGCATTAACTGGGATTCAGG + Intronic
1195446775 X:104961172-104961194 CAAAGCAATCCCGGGGCCTCTGG + Intronic