ID: 967016872

View in Genome Browser
Species Human (GRCh38)
Location 3:185490167-185490189
Sequence CAATTCTGTACTGCAGCTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967016868_967016872 20 Left 967016868 3:185490124-185490146 CCAAGGTCCTTCTGTCTTTGGAA 0: 1
1: 0
2: 1
3: 31
4: 308
Right 967016872 3:185490167-185490189 CAATTCTGTACTGCAGCTACAGG 0: 1
1: 0
2: 0
3: 8
4: 113
967016869_967016872 13 Left 967016869 3:185490131-185490153 CCTTCTGTCTTTGGAAGCATTAA 0: 1
1: 0
2: 4
3: 18
4: 239
Right 967016872 3:185490167-185490189 CAATTCTGTACTGCAGCTACAGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967016872 Original CRISPR CAATTCTGTACTGCAGCTAC AGG Exonic
900302764 1:1986279-1986301 CAATTCTCTGCTGCAGCCTCCGG - Intronic
901815775 1:11792615-11792637 CATTTCTGAACAGCAGCAACTGG + Intronic
904597400 1:31655474-31655496 CCCTTCTGTCCTGCAGCTCCTGG + Exonic
906401850 1:45510196-45510218 GAATTCTGTACTGCTGCTCATGG + Exonic
909712036 1:78662688-78662710 AATTTCTGTATTGCAGCTAGAGG + Exonic
912907956 1:113727434-113727456 CTATTCTGTGCTCCAGGTACTGG - Intronic
913568062 1:120092724-120092746 CAATTCTGTACTCCCACAACAGG - Intergenic
914288871 1:146253748-146253770 CAATTCTGTACTCCCACAACAGG - Intergenic
914549906 1:148704491-148704513 CAATTCTGTACTCCCACAACAGG - Intergenic
914616835 1:149367535-149367557 CAATTCTGTACTCCCACAACAGG + Intergenic
915819729 1:159009416-159009438 CAATACTTTACTGCATCTCCTGG - Intronic
918380895 1:183954057-183954079 GAATACTGTTCAGCAGCTACAGG + Intronic
918909161 1:190543283-190543305 CACTGCTGTAATCCAGCTACTGG - Intergenic
919582736 1:199398024-199398046 CAATTCTAAAATGCAGCTATAGG - Intergenic
922700649 1:227758075-227758097 AAGCTCTGTCCTGCAGCTACAGG - Intronic
922856878 1:228783155-228783177 CAGTTCTGTCCTGCAGATAAAGG + Intergenic
1066458611 10:35594164-35594186 CCATTCTGTGAGGCAGCTACAGG - Intergenic
1066610308 10:37239023-37239045 AAATTGTGTACTGCACATACTGG - Intronic
1074283900 10:112079931-112079953 AAATCATGTATTGCAGCTACTGG - Intergenic
1075782576 10:125026701-125026723 CATTTCGGTCCTGCAGCTATTGG + Exonic
1077595559 11:3528578-3528600 CATTTCTGGCCTGCAGCTGCAGG - Intergenic
1079478273 11:20854455-20854477 CACTTCTGTAGTGGACCTACAGG + Intronic
1079647167 11:22879832-22879854 CAGATCTGGAATGCAGCTACAGG + Intergenic
1083436704 11:62648003-62648025 CAAGGCTGTCCTGCAGCTGCTGG - Exonic
1083752463 11:64768047-64768069 CCATTCTCTACTGCAGAGACTGG - Intronic
1088683434 11:112264938-112264960 CAATTCTGGACTGCAGTTCCTGG + Intronic
1089754979 11:120679900-120679922 GAATTCTGTACTGCAGACGCTGG + Intronic
1092963814 12:13622369-13622391 CCATTCTGTCCTGCAGCCCCGGG + Intronic
1093087406 12:14882056-14882078 TATTTCTGTAATGCTGCTACAGG + Exonic
1096327208 12:50674713-50674735 CAATGCAGTTCTGCAGCTGCTGG - Intronic
1099056186 12:77843982-77844004 CAATTCTGTACAGTGGCTAGGGG + Intronic
1099353028 12:81596743-81596765 TAATTCTGTACAGCAGCCCCAGG + Intronic
1100871132 12:98911675-98911697 CAAGTCTGTTCTACAGCCACCGG + Intronic
1108546333 13:51499001-51499023 CAAGTCTGAACTGCTGCAACTGG - Intergenic
1110609814 13:77475672-77475694 AAATTCAGCACAGCAGCTACTGG + Intergenic
1112928896 13:104711808-104711830 CAATTCTTTCCTGCAGCATCAGG + Intergenic
1118801156 14:69191400-69191422 CCATTTTGTACGGAAGCTACTGG - Intergenic
1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG + Intronic
1127523401 15:59766835-59766857 CAATTCAGTAATCCCGCTACTGG - Intergenic
1134295630 16:12943009-12943031 CAATTCTGGTTTGCAGCTGCTGG - Intronic
1137313425 16:47289451-47289473 GAATTCAGTACTGAAGCTACTGG + Intronic
1137626687 16:49913315-49913337 CATGTCTGTAGTCCAGCTACTGG - Intergenic
1139035390 16:62939944-62939966 CATTTCTGTACATGAGCTACTGG - Intergenic
1139443092 16:66978951-66978973 CAATTCTTTTGGGCAGCTACAGG - Intergenic
1140876599 16:79158391-79158413 CCATTCTGAATTGCAGCTGCAGG + Intronic
1142827063 17:2520122-2520144 CAGTTCTGTATTACAGCAACAGG + Intergenic
1147207325 17:38846814-38846836 CAATTCTGAAGTCTAGCTACAGG - Intergenic
1153132256 18:1868419-1868441 CAATTCTGCAGTGCAACTTCAGG - Intergenic
1154047789 18:10923386-10923408 CAAGTCTGTACTCCACCTCCAGG + Intronic
1162484790 19:10952967-10952989 CAACCCTGAACTGGAGCTACTGG - Intergenic
931775474 2:65536762-65536784 CCCTTGTGTATTGCAGCTACAGG - Intergenic
933480399 2:82849818-82849840 CAAATCTGTACTCCAGTTAGAGG - Intergenic
936434706 2:112494228-112494250 CCATTCTGTGCTGGAGCAACTGG - Exonic
937445858 2:121957326-121957348 CAGTTCTGTTCTGCAGACACTGG + Intergenic
941079957 2:161049177-161049199 CAGTTCTGTAATGCAGATTCAGG - Intergenic
943942429 2:194015811-194015833 CAATTAAGTATTGTAGCTACAGG - Intergenic
946001824 2:216488845-216488867 CCATTCTGTGCTGCAGGTCCTGG - Intergenic
1170286622 20:14716665-14716687 CAATTATATACTGCAGCTTGAGG + Intronic
1173099276 20:40069530-40069552 GAATTCAGCACTGAAGCTACTGG - Intergenic
1174763248 20:53227664-53227686 CAATGCTGTAGGGCAGCTAATGG - Intronic
1175080172 20:56413073-56413095 CATACCTGTACTCCAGCTACCGG + Intronic
1176664786 21:9675618-9675640 CATTTCTGTGCTGCAGCTTCTGG + Intergenic
1176953199 21:15069467-15069489 CAAATCCTTACTGCAGCTTCAGG - Intergenic
1177376748 21:20280225-20280247 CACTTCTGTTCTGGAGCTGCTGG - Intergenic
1177499725 21:21937699-21937721 CCATTCTGTATTGGAGCTAATGG - Intergenic
1178169977 21:30029691-30029713 CACTGCAGTACAGCAGCTACTGG - Intergenic
1181121859 22:20673820-20673842 AAATTCTGAACTGCAGATAATGG + Intergenic
1183160844 22:36111962-36111984 CACTTCTGTGCTGCAGGTGCAGG + Intergenic
952651348 3:35730417-35730439 CATTTCTGTACTCTACCTACTGG - Intronic
965697939 3:171428707-171428729 CAATTCTGTGCTGCAGCATTTGG + Intronic
967016872 3:185490167-185490189 CAATTCTGTACTGCAGCTACAGG + Exonic
968789242 4:2648047-2648069 CTGTTCTCTACTGCAGCCACAGG + Intronic
969366981 4:6701579-6701601 CAATTCTGCAAAGCAGCTGCAGG - Intergenic
971835249 4:31754920-31754942 CATTTCTGAAGTGCAGCTTCTGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
975735390 4:77375752-77375774 CCATTCTGTACTGAAACTAGTGG + Intronic
977845633 4:101763459-101763481 CTTTTCTGAACTCCAGCTACAGG + Intronic
981660529 4:147161068-147161090 TAAGTCTGACCTGCAGCTACAGG + Intergenic
985017855 4:185656250-185656272 TAAATCTGTACAGCAGTTACTGG - Intronic
985410257 4:189676271-189676293 CATTTCTGCGCTGCAGCTTCTGG + Intergenic
986131448 5:4935947-4935969 AAATTTTGTCCTTCAGCTACTGG + Intergenic
988544835 5:32145855-32145877 CAGTTCTGTACCACAGCTTCTGG + Intronic
990238608 5:53794500-53794522 CAATTCAGTTCTGCATTTACTGG + Intergenic
990914612 5:60891009-60891031 AAATTCTGAACTGCAGCCACAGG + Exonic
991578122 5:68126248-68126270 CAATTCTGAAGTGGAGCTAGAGG - Intergenic
993187525 5:84638064-84638086 CAATACTTTACTGAAGCTTCAGG - Intergenic
996873174 5:128214671-128214693 ACATTCTGTACTGCAGAGACTGG - Intergenic
997038186 5:130218408-130218430 CAGTTCTGTTCAGCAGCTACGGG - Intergenic
998078664 5:139256873-139256895 CATGTCTGTACCCCAGCTACTGG + Intronic
999783306 5:154868798-154868820 CACTTGAGTGCTGCAGCTACTGG + Intronic
1004174838 6:13330565-13330587 CAATTCGTTTCAGCAGCTACTGG + Intergenic
1004992728 6:21156714-21156736 CAACTCTGAGCTGCAGCCACTGG + Intronic
1006953794 6:37848468-37848490 CCATTCAGTGCTGCAGCTCCAGG - Intronic
1007768862 6:44177612-44177634 CACGTCTGTAATCCAGCTACTGG - Intronic
1007954309 6:45902355-45902377 CAATTCTAAACTGCAGTGACTGG - Exonic
1008618662 6:53250298-53250320 CAATTTGTTACTGCAGCCACAGG + Intergenic
1012976956 6:105790963-105790985 CAATTCTATTATTCAGCTACTGG - Intergenic
1014588333 6:123229546-123229568 CAATACTGTTCTGCAGCCATGGG + Intronic
1015798744 6:137039494-137039516 GATTTCTGTACTGCAGCTAATGG - Intronic
1015961289 6:138651686-138651708 CATTTCTGTCCTGTAGCTTCTGG - Intronic
1016705450 6:147101734-147101756 CATGTCTGTGCTGCAGCTATAGG + Intergenic
1016718013 6:147256378-147256400 CCCTTCTATACTGCAGATACTGG - Intronic
1017642666 6:156509606-156509628 CAAATGTGTACTGCAGCCCCGGG + Intergenic
1019452129 7:1104497-1104519 CATGTCAGTACTGCAGCTCCGGG + Intronic
1022573308 7:31474254-31474276 CAATTCTGCAGCTCAGCTACAGG - Intergenic
1030235272 7:107253058-107253080 CAACACTGTACTGCAGATCCTGG + Intronic
1033107266 7:138538763-138538785 TAATGCTGTACTGCTGCCACTGG - Exonic
1039933088 8:42012702-42012724 CAATTTTTTACAGCAGCCACAGG + Intronic
1042785441 8:72540701-72540723 CAACTCTTTACTGCAAGTACGGG + Intronic
1050590449 9:7154770-7154792 CTATTTAGTACTGCAGCTACGGG + Intergenic
1053341679 9:37341457-37341479 CACTGCTGTACTTCAGCTCCTGG - Intronic
1055868386 9:80843931-80843953 AAATTCTGTACAGCAGCAACTGG + Intergenic
1055973454 9:81933501-81933523 CAGCTCTGCACTGCATCTACTGG - Intergenic
1055975208 9:81948593-81948615 CAGCTCTGCACTGCATCTACTGG - Intergenic
1058412200 9:104746481-104746503 CAATTCTGTACCCCAGTTTCTGG + Intergenic
1058424076 9:104861617-104861639 CAATTACGTTGTGCAGCTACTGG - Intronic
1203661311 Un_KI270753v1:46129-46151 CATTTCTGCGCTGCAGCTTCTGG - Intergenic
1203672501 Un_KI270755v1:29209-29231 CATTTCTGCGCTGCAGCTTCTGG - Intergenic
1188717442 X:33477140-33477162 GAGTTGTGTACTGCAGCTATGGG - Intergenic
1198529413 X:137536012-137536034 CAATTCTCTGCTTCAGCTTCCGG + Intergenic
1199133707 X:144226783-144226805 CAATTCTTTACTGGAGATAAAGG - Intergenic
1201520507 Y:14868526-14868548 CAAGTTTGTACTGCAGATTCTGG + Intergenic