ID: 967017739

View in Genome Browser
Species Human (GRCh38)
Location 3:185496963-185496985
Sequence GGAGGGGAACCACAGCGACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 937}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967017733_967017739 -4 Left 967017733 3:185496944-185496966 CCCGCAGCTCTGCCAGGTCGGAG 0: 1
1: 0
2: 0
3: 29
4: 219
Right 967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 937
967017734_967017739 -5 Left 967017734 3:185496945-185496967 CCGCAGCTCTGCCAGGTCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 222
Right 967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 937
967017729_967017739 25 Left 967017729 3:185496915-185496937 CCGGTACTCTCGAAGGACCTCAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 937
967017728_967017739 29 Left 967017728 3:185496911-185496933 CCTTCCGGTACTCTCGAAGGACC 0: 1
1: 0
2: 0
3: 3
4: 13
Right 967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 937
967017730_967017739 8 Left 967017730 3:185496932-185496954 CCTCAGAGAGCTCCCGCAGCTCT 0: 1
1: 0
2: 7
3: 83
4: 384
Right 967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967017739 Original CRISPR GGAGGGGAACCACAGCGACC TGG Exonic
900037844 1:432600-432622 GGAGGGGAACAACACATACCAGG + Intergenic
900037860 1:432676-432698 GGAGGGGAACAACACACACCAGG + Intergenic
900037880 1:432753-432775 GGAGGGGAACAACACACACCAGG + Intergenic
900037901 1:432830-432852 GGAGGGGAACAACACACACCAGG + Intergenic
900037922 1:432907-432929 GGAGGGGAACAACACACACCAGG + Intergenic
900037943 1:432984-433006 GGAGGGGAACAACACACACCAGG + Intergenic
900037964 1:433061-433083 GGAGGGGAACAACACACACCAGG + Intergenic
900037984 1:433138-433160 GGAGGGGAACAACACACACCAGG + Intergenic
900038005 1:433215-433237 GGAGGGGAACAACACACACCAGG + Intergenic
900038025 1:433292-433314 GGAGGGGAACAACACACACCAGG + Intergenic
900038045 1:433369-433391 GGAGGGGAACAACACACACCAGG + Intergenic
900038065 1:433446-433468 GGAGGGGAACAACACACACCAGG + Intergenic
900038085 1:433523-433545 GGAGGGGAACAACACACACCAGG + Intergenic
900038105 1:433600-433622 GGAGGGGAACAACACACACCAGG + Intergenic
900038125 1:433677-433699 GGAGGGGAACAACACACACCAGG + Intergenic
900038145 1:433754-433776 GGAGGGGAACAACACACACCAGG + Intergenic
900038165 1:433831-433853 GGAGGGGAACAACACACACCAGG + Intergenic
900038185 1:433908-433930 GGAGGGGAACAACACACACCAGG + Intergenic
900038205 1:433985-434007 GGAGGGGAACAACACACACCAGG + Intergenic
900038225 1:434062-434084 GGAGGGGAACAACACACACCAGG + Intergenic
900038245 1:434139-434161 GGAGGGGAACAACACACACCAGG + Intergenic
900038265 1:434216-434238 GGAGGGGAACAACACACACCAGG + Intergenic
900038284 1:434293-434315 GGAGGGGAACAACACACACCAGG + Intergenic
900038301 1:434370-434392 GGAGGGGAACAACACACACCAGG + Intergenic
900038321 1:434447-434469 GGAGGGGAACAACACACACCAGG + Intergenic
900038341 1:434524-434546 GGAGGGGAACAACACACACCAGG + Intergenic
900038361 1:434601-434623 GGAGGGGAACAACACACACCAGG + Intergenic
900038381 1:434678-434700 GGAGGGGAACAACACACACCAGG + Intergenic
900038401 1:434755-434777 GGAGGGGAACAACACACACCAGG + Intergenic
900038422 1:434832-434854 GGAGGGGAACAACACACACCAGG + Intergenic
900038443 1:434909-434931 GGAGGGGAACAACACACACCAGG + Intergenic
900059477 1:668352-668374 GGAGGGGAACAACACACACCAGG + Intergenic
900059496 1:668428-668450 GGAGGGGAACAACACACACCAGG + Intergenic
900059515 1:668504-668526 GGAGGGGAACAACACACACCAGG + Intergenic
900059534 1:668580-668602 GGAGGGGAACAACACACACCAGG + Intergenic
900059572 1:668734-668756 GGAGGGGAACAACACACACCAGG + Intergenic
900059593 1:668811-668833 GGAGGGGAACAACACACACCAGG + Intergenic
900059612 1:668887-668909 GGAGGGGAACAACACACACCAGG + Intergenic
900059651 1:669041-669063 GGAGGGGAACAACACACACCAGG + Intergenic
900059673 1:669118-669140 GGAGGGGAACAACACACACCAGG + Intergenic
900059693 1:669195-669217 GGAGGGGAACAACACACACCAGG + Intergenic
900059715 1:669272-669294 GGAGGGGAACAACACACACCAGG + Intergenic
900059736 1:669349-669371 GGAGGGGAACAACACACACCAGG + Intergenic
900059753 1:669426-669448 GGAGGGGAACAACACATACCAGG + Intergenic
900059775 1:669503-669525 GGAGGGGAACAACACACACCAGG + Intergenic
900059796 1:669580-669602 GGAGGGGAACAACACACACCAGG + Intergenic
900059816 1:669657-669679 GGAGGGGAACAACACACACCAGG + Intergenic
900059836 1:669734-669756 GGAGGGGAACAACACACACCAGG + Intergenic
900059858 1:669811-669833 GGAGGGGAACAACACACACCAGG + Intergenic
900059879 1:669888-669910 GGAGGGGAACAACACACACCAGG + Intergenic
901535493 1:9880150-9880172 GGAGGGGAACAACACACACCGGG - Intronic
903811687 1:26038269-26038291 GGAGGGAAACCGCAGCTTCCTGG - Exonic
904147465 1:28404934-28404956 GGAGGGGAACAACAGACACTGGG - Intronic
904233008 1:29092724-29092746 GGAGGGGAACAACAGACACCAGG - Intronic
905300377 1:36982715-36982737 GAAGGGGCAGCCCAGCGACCGGG + Intronic
905343952 1:37298791-37298813 GGAGGGAAACCAGAGCTCCCAGG + Intergenic
905609988 1:39342074-39342096 GGAGGGGAACAACAGATACTGGG - Intronic
906580841 1:46934198-46934220 GGAGGAGATCCACAGCCTCCTGG - Exonic
907821999 1:57979383-57979405 GGAGGGGAACATCACAGACCAGG + Intronic
907957633 1:59245802-59245824 GGAGGGGAACAACACACACCGGG - Intergenic
908723495 1:67150443-67150465 GGAGGGGAACAACACACACCGGG - Intronic
909461212 1:75916655-75916677 GGAGGGGAACAACACACACCAGG + Intergenic
909986187 1:82163385-82163407 GGAGGAGAACCACACAGAACAGG + Intergenic
910076252 1:83282604-83282626 GGAGGGGAACAACACACACCAGG - Intergenic
910307876 1:85787388-85787410 GGAGGGGAACAACACCCACTGGG - Intronic
910438605 1:87229831-87229853 GGAGGGGAACAACACACACCAGG - Intergenic
910560790 1:88588578-88588600 GGAGGGGAACAACATGTACCAGG + Intergenic
910775230 1:90868145-90868167 GGAGGGGAACAACACACACCAGG + Intergenic
910799727 1:91133095-91133117 GGAGGGGAACATCAGACACCGGG + Intergenic
911290341 1:96049932-96049954 AGTGGGAAACCACAGAGACCAGG + Intergenic
911514126 1:98846279-98846301 AGAAGGGAACCACAGACACCAGG - Intergenic
911958780 1:104271867-104271889 GGAGGGGAACAACACACACCAGG - Intergenic
912244968 1:107952278-107952300 GGAGGGGAACCACACACACTGGG + Intronic
912537958 1:110389866-110389888 AGAGGGGAACCACAGACACTGGG + Intronic
912774678 1:112498098-112498120 GGAGGGGAACAACACACACCGGG - Intronic
913029721 1:114888876-114888898 GGAGGGGAACCTCACACACCAGG - Intronic
913156231 1:116101784-116101806 GGAGGGGAACCTCACACACCAGG - Intergenic
914402043 1:147330537-147330559 GGAGGGGAACAACACACACCAGG + Intergenic
915005717 1:152634019-152634041 GGAGGGGAACAACAGACACTGGG + Intergenic
915658614 1:157382235-157382257 GGAGGGGAACGACACACACCAGG - Intergenic
916663598 1:166945898-166945920 AGAGGGGAACCACACGGAGCTGG - Intronic
916708384 1:167377842-167377864 AGAAGGGAACAACAGCCACCAGG - Intronic
917024502 1:170627425-170627447 GGAGGGGAACAACACACACCAGG - Intergenic
917059610 1:171022567-171022589 GGAGGGGAACAACACACACCAGG + Intronic
917062926 1:171059848-171059870 GGAGGGGAACAACACACACCAGG + Intronic
917232986 1:172857916-172857938 GGAGGGGAACCAGTCCCACCTGG + Intergenic
917243526 1:172974944-172974966 GGAGGGGAACAACACACACCAGG - Intergenic
918482852 1:184998332-184998354 GGAGGGGAACAACAGACACTGGG + Intergenic
918729143 1:187968367-187968389 GGAGGGGAACAACACATACCAGG - Intergenic
918846497 1:189621906-189621928 GGAGGGGAACAACACACACCGGG + Intergenic
918858715 1:189793748-189793770 AGAGGGGAACAACAGACACCAGG - Intergenic
920058121 1:203207405-203207427 GGAAGGGAAGCACAGAAACCGGG + Intergenic
920675051 1:208032762-208032784 GGAGGGAAAGCACAGAGGCCTGG - Intronic
920791197 1:209094680-209094702 GGAGGGAAACCACAGTCACTGGG - Intergenic
922372761 1:224927955-224927977 GGAGGGGAACAACACACACCAGG + Intronic
923179529 1:231502825-231502847 GGAGGGGAACAACAGACACACGG - Intergenic
924255335 1:242177384-242177406 GGAGGGGAACAACACACACCGGG + Intronic
924617996 1:245630551-245630573 GGAGGGGAACAACACACACCAGG + Intronic
1063089348 10:2848461-2848483 GGAGGGGAATCACACACACCGGG - Intergenic
1063291291 10:4752462-4752484 GGAGGGGAACAACACACACCGGG + Intergenic
1063295923 10:4806301-4806323 GGAGGGGAACAACACACACCAGG + Intronic
1063343041 10:5286264-5286286 GGAGGGGAACGACAGACATCGGG - Intergenic
1063749811 10:8930602-8930624 GGAGGAGAAGCACAGAGATCAGG + Intergenic
1063962624 10:11319410-11319432 AGAGGGGAAGCACAGCGGCAGGG + Intronic
1064579279 10:16777792-16777814 GGAGGGTAACCACAGAGGCCAGG + Intronic
1064610797 10:17100004-17100026 AGATGGGAAACACAGCAACCAGG - Exonic
1064912829 10:20421618-20421640 AGAGGGGAACAACAGACACCAGG - Intergenic
1065403858 10:25340180-25340202 GGAGAGCAACCAAAGCAACCAGG - Intronic
1065438992 10:25729868-25729890 GGAGGGGAACAACACACACCAGG + Intergenic
1065839044 10:29685093-29685115 GGAGGGGAACAACAGATACTGGG - Intronic
1065916579 10:30358472-30358494 GGAGGGCCACCACAGCCCCCAGG + Intronic
1066499827 10:35981728-35981750 GGAGGGGAACAACACACACCGGG - Intergenic
1066627661 10:37425626-37425648 GGAGGGGAACAACATACACCAGG - Intergenic
1068372237 10:56131916-56131938 GGAGGGGAACAACACACACCAGG + Intergenic
1068833681 10:61527424-61527446 GGAGGGGAACAACACCCACTGGG - Intergenic
1069591986 10:69647853-69647875 GGTAGGGAACCACTGGGACCTGG + Intergenic
1069934164 10:71903769-71903791 GGAGGGGAACAACAGACACCGGG - Intergenic
1070680368 10:78444831-78444853 GCAGGGGGAACACAGCCACCTGG - Intergenic
1071762632 10:88626321-88626343 GGAGGGGAACAACACAAACCTGG - Intergenic
1072856802 10:98955925-98955947 GGAGGGGAACAACACACACCAGG + Intronic
1072938013 10:99732084-99732106 GGAGGGAGACCACAGAGCCCTGG - Exonic
1073143317 10:101262934-101262956 GGAGGAGAGCCCCAGAGACCAGG - Intergenic
1074172210 10:110952736-110952758 GGAGGGGAACAACACACACCAGG - Intronic
1074381154 10:112981849-112981871 GCATGGGAACCAAAGTGACCAGG + Intronic
1074635826 10:115316130-115316152 GGAGGGGAACAACATGCACCAGG - Intronic
1075024777 10:118976541-118976563 GGAGGGGAACAACACACACCTGG + Intergenic
1075909514 10:126112192-126112214 GGAGGGGAACAACACACACCAGG + Intronic
1076027541 10:127128562-127128584 GGAGGAGAACCACACACACCGGG - Intronic
1076074317 10:127521256-127521278 AGAGGGGAACGACAGACACCTGG + Intergenic
1076655004 10:132018094-132018116 GCTGGGGACCCACAGCGATCTGG + Intergenic
1076964573 11:70510-70532 GGAGGGGAACAACACACACCAGG + Intergenic
1076964590 11:70586-70608 GGAGGGGAACAACACACACCAGG + Intergenic
1076964609 11:70663-70685 GGAGGGGAACAACACACACCAGG + Intergenic
1076964648 11:70817-70839 GGAGGGGAACAACACACACCAGG + Intergenic
1077607251 11:3620545-3620567 GGAGGGGACCCACAGGGTCAAGG - Intergenic
1077945026 11:6887750-6887772 GGAGGGGAACATCACCCACCGGG - Intergenic
1078109314 11:8379798-8379820 AGAGGGGAACCACAGACACGGGG - Intergenic
1078422553 11:11224306-11224328 GAAGGGGAGCCACAGCCCCCAGG + Intergenic
1079076877 11:17389587-17389609 GGAGGGGAGCCAGGGCGACAGGG - Intergenic
1079396852 11:20071127-20071149 GGAGGGGAACATCAGACACCAGG - Intronic
1079489503 11:20971994-20972016 GGAGGGGAACAACAGACACTGGG + Intronic
1079690256 11:23408007-23408029 GGAGGGGAACAACACACACCAGG - Intergenic
1079854612 11:25586369-25586391 GGAGGGGAACAACACACACCCGG - Intergenic
1080033822 11:27689897-27689919 GGAGGGGAACCACACACACTGGG - Intronic
1080352358 11:31399933-31399955 GGAGGGGAACAACACACACCAGG - Intronic
1080591682 11:33729486-33729508 GGAGGGGAACATCAGACACCAGG + Intronic
1081269966 11:41071218-41071240 GGAGGGGAACAACACACACCAGG + Intronic
1081342162 11:41942033-41942055 GGAGGGGAACAACAGACACTGGG + Intergenic
1081410445 11:42751582-42751604 GGAGGGGAACAACACACACCAGG - Intergenic
1082886359 11:58087737-58087759 GGAGGGGAACCTCACACACCGGG - Intronic
1083042611 11:59702132-59702154 GGAGGGGAACAACACACACCAGG - Intergenic
1083448860 11:62728887-62728909 GGAAGGGAACCAGCGCTACCGGG + Exonic
1084562211 11:69911398-69911420 GGAGGGGAGCCAGAGGGAGCAGG + Intergenic
1085140528 11:74136769-74136791 GGAGGGGAACATCACAGACCGGG + Intronic
1085832129 11:79912505-79912527 GGAGGGGAACAACACACACCAGG - Intergenic
1085850616 11:80115316-80115338 GGAGGGGAACAACACACACCAGG + Intergenic
1085979134 11:81701122-81701144 GGAGGGGAACAACACACACCAGG - Intergenic
1086161905 11:83731309-83731331 GGAGGGGAACAACACACACCAGG - Intronic
1086292940 11:85331642-85331664 AGAGGGGAATCATAGCCACCGGG - Intronic
1086780194 11:90894268-90894290 GGAGGGGAACAACACACACCCGG - Intergenic
1087207417 11:95411769-95411791 GGAGGGGAACATCACAGACCGGG + Intergenic
1087404328 11:97711492-97711514 GGAGGGGAACAACATACACCTGG + Intergenic
1087618311 11:100514073-100514095 GGAGGGGATCAACACAGACCAGG - Intergenic
1088005339 11:104933027-104933049 GGAGGGGAACAACACACACCAGG + Intergenic
1088356455 11:108949076-108949098 GGAGGGGAACAACACACACCGGG - Intergenic
1088360043 11:108980007-108980029 GGAGGGGAACAACACACACCAGG - Intergenic
1088360944 11:108989475-108989497 GGAGGGGAACAACACTCACCAGG - Intergenic
1088382845 11:109215883-109215905 GGAGGGGAACAACACACACCAGG - Intergenic
1088525439 11:110748318-110748340 AGAGGGGAACAACAGACACCGGG - Intergenic
1088921478 11:114262377-114262399 GGAGGGGAACAACACACACCGGG - Intronic
1089028879 11:115302120-115302142 AGAGGGGAACCACACACACCGGG + Intronic
1090360355 11:126168020-126168042 GGTGTGGAGCCACAGGGACCTGG - Intergenic
1090709437 11:129372746-129372768 CGAGGGGCAGCACCGCGACCAGG + Intergenic
1090716958 11:129439451-129439473 GGAGGGGAACCTCACACACCAGG - Intronic
1091165756 11:133474697-133474719 GGAGGGCAACCAGAGTGAGCTGG - Intronic
1091379455 12:46571-46593 GGAGGGGAACAACACACACCAGG - Intergenic
1091382211 12:69126-69148 TGAGGGCAGCCACAGCTACCTGG + Intronic
1091782230 12:3221066-3221088 GGAGAGAAGCCACAGGGACCGGG + Intronic
1092500891 12:9046001-9046023 GGAGGGGAACGACAGACACTGGG + Intergenic
1092978599 12:13770689-13770711 GGAGGGGAACAACACACACCAGG - Intronic
1093413112 12:18890409-18890431 GGAGGGGAACAACACACACCAGG - Intergenic
1093808991 12:23470212-23470234 GGAGGGGAACAACACACACCGGG + Intergenic
1094579069 12:31717127-31717149 GGAGGGGAACAACACACACCGGG - Intronic
1094778636 12:33763291-33763313 GGAGGGGAACGACACACACCTGG + Intergenic
1094846338 12:34363012-34363034 GTATGGGAACCACGGAGACCCGG + Intergenic
1095120074 12:38406296-38406318 GGAGGGGAACCACACACACTGGG - Intergenic
1095538098 12:43276214-43276236 GGAGGGGAACAACACACACCAGG + Intergenic
1095595832 12:43957122-43957144 GGAGGGGAACAACAGACACTGGG + Intronic
1095857918 12:46881680-46881702 GGAGGGGAACATCACCTACCAGG + Intergenic
1096437344 12:51605019-51605041 AGAGGGGAACAACAGACACCTGG - Intronic
1096885378 12:54713906-54713928 GGAGGGGAACAACACCCACCAGG - Intergenic
1097312532 12:58136194-58136216 GGAGGGGAACAACACACACCAGG - Intergenic
1097388627 12:58981610-58981632 GGAGGGGAACAACACACACCGGG + Intergenic
1097425687 12:59441280-59441302 GGAGGGGAACGACACACACCAGG - Intergenic
1098133842 12:67380691-67380713 GGAGGGGAACCTCACACACCGGG - Intergenic
1098582910 12:72121946-72121968 GGAGGGGAGGCACAGAGAGCTGG - Intronic
1099372828 12:81858770-81858792 GGAGGGGAACAACACACACCAGG + Intergenic
1099616029 12:84937539-84937561 GGAGGGAGAGCACAGCGACTGGG + Intergenic
1099833925 12:87882557-87882579 GGAGGGGAACAACAGACACTGGG + Intergenic
1100110674 12:91238203-91238225 GGAGGGGAACAACACATACCAGG - Intergenic
1100960955 12:99962222-99962244 GGAGGGGAACAACACACACCAGG - Intronic
1101625622 12:106438063-106438085 GGAGGGGAACAACACACACCAGG - Intronic
1102053311 12:109879087-109879109 GGAGGGGAACTATAGCCTCCAGG + Intronic
1102299317 12:111759432-111759454 GAAGGGGAACCAGAGAGAGCAGG + Intronic
1103978219 12:124717704-124717726 AGAGGGGAACAACAGACACCGGG + Intergenic
1104094432 12:125544160-125544182 GGAGGGGAACAACAGACACTGGG + Intronic
1104099900 12:125597725-125597747 GGAGGGGAATGACAGGCACCCGG - Intronic
1104507700 12:129348524-129348546 GGAGGGGAACATCACCCACCAGG + Intronic
1105887722 13:24656483-24656505 AGATGGGAACCACAGAGACTAGG - Intergenic
1107184514 13:37503023-37503045 GGAGGGGAACAACACACACCGGG + Intergenic
1108145184 13:47469490-47469512 GGAGGGGAACAACACACACCAGG + Intergenic
1108529310 13:51314265-51314287 GGAGTGGAACAACAGACACCGGG + Intergenic
1109113712 13:58354588-58354610 GGAGGGGAACAACAAACACCAGG - Intergenic
1109301878 13:60597968-60597990 GGAGGGGAACAACAGACACTGGG - Intergenic
1109369128 13:61398262-61398284 GGAGGGGAACAACACACACCTGG - Intergenic
1109374828 13:61478634-61478656 GGAGGGGAACAACAGACACAAGG - Intergenic
1109973564 13:69802038-69802060 GGAGGGGAACATCAGACACCAGG - Intronic
1110346664 13:74456180-74456202 GGAGGGGAACAACATACACCAGG + Intergenic
1111775058 13:92650923-92650945 GGAGGGGAACAACACACACCAGG - Intronic
1112141485 13:96648673-96648695 GGAGGGGAACAACACAGACTGGG - Intronic
1112141901 13:96653381-96653403 GGAGGGGAACAACACACACCAGG - Intronic
1113528225 13:110999503-110999525 GGAGGGGAACAACACACACCAGG + Intergenic
1113967070 13:114158907-114158929 GGAGGGGAACAACACACACCGGG - Intergenic
1115340446 14:32287945-32287967 GGAGGGGAACAACACACACCCGG - Intergenic
1117781083 14:59232815-59232837 GGAGGGGAACAACATACACCAGG - Intronic
1120725290 14:87932282-87932304 GGAGGGGAACAACACATACCAGG + Intronic
1121736509 14:96221677-96221699 TGTGGGGAACCAGAGCGTCCTGG + Intronic
1121905353 14:97736727-97736749 GGAGGGGAACAACACACACCAGG - Intergenic
1123037824 14:105478586-105478608 GGCGGGGATCCACGGCGGCCGGG - Intronic
1124053100 15:26217380-26217402 GGAGGGGAACAACACACACCAGG + Intergenic
1124113110 15:26811468-26811490 AGAGGGGAACAACAGACACCGGG + Intronic
1126198551 15:45958360-45958382 GGAGGGGAACAACAGACACTCGG + Intergenic
1127050944 15:55083234-55083256 GGAGGGGAACAACACACACCAGG - Intergenic
1127404189 15:58623782-58623804 GGAGGGGAACAACACACACCAGG + Intronic
1127893874 15:63277759-63277781 GGAGGGGAGCCCCGGCGTCCGGG - Intronic
1128300482 15:66563829-66563851 GCAGGGGCACCACAGAGTCCTGG - Intronic
1130191262 15:81738359-81738381 GGAGGGGAACAACACCCACCAGG + Intergenic
1130327965 15:82896580-82896602 TGAGGGGAGGCACAGAGACCTGG + Intronic
1130848842 15:87773846-87773868 GGAGGGGAACAACATACACCAGG + Intergenic
1132198805 15:99933422-99933444 GGAGGAGAACCATATCCACCAGG + Intergenic
1132443473 15:101892708-101892730 GGAGGGGAACAACACACACCAGG - Intergenic
1132443494 15:101892785-101892807 GGAGGGGAACAACACACACCAGG - Intergenic
1132443514 15:101892862-101892884 GGAGGGGAACAACACACACCAGG - Intergenic
1132443536 15:101892939-101892961 GGAGGGGAACAACACACACCAGG - Intergenic
1132443555 15:101893016-101893038 GGAGGGGAACAACACACACCAGG - Intergenic
1132443575 15:101893092-101893114 GGAGGGGAACAACACACACCAGG - Intergenic
1132443596 15:101893169-101893191 GGAGGGGAACAACACACACCAGG - Intergenic
1132443616 15:101893246-101893268 GGAGGGGAACAACACACACCAGG - Intergenic
1132443636 15:101893323-101893345 GGAGGGGAACAACACACACCAGG - Intergenic
1132443655 15:101893400-101893422 GGAGGGGAACAACACACACCAGG - Intergenic
1132443677 15:101893477-101893499 GGAGGGGAACAACACACACCAGG - Intergenic
1132443698 15:101893554-101893576 GGAGGGGAACAACACACACCAGG - Intergenic
1132443719 15:101893631-101893653 GGAGGGGAACAACACACACCAGG - Intergenic
1132443740 15:101893708-101893730 GGAGGGGAACAACACACACCAGG - Intergenic
1132443762 15:101893785-101893807 GGAGGGGAACAACACACACCAGG - Intergenic
1132443780 15:101893862-101893884 GGAGGGGAACAACACACACCAGG - Intergenic
1132443800 15:101893939-101893961 GGAGGGGAACAACACACACCAGG - Intergenic
1132443841 15:101894093-101894115 GGAGGGGAACAACACACACCAGG - Intergenic
1132443860 15:101894170-101894192 GGAGGGGAACAACACACACCAGG - Intergenic
1132443902 15:101894323-101894345 GGAGGGGAACAACACACACCAGG - Intergenic
1132443921 15:101894400-101894422 GGAGGGGAACAACACACACCAGG - Intergenic
1132443942 15:101894477-101894499 GGAGGGGAACAACACACACCAGG - Intergenic
1132443961 15:101894554-101894576 GGAGGGGAACAACACACACCAGG - Intergenic
1132443980 15:101894631-101894653 GGAGGGGAACAACACATACCAGG - Intergenic
1132550102 16:550746-550768 GCAGGGGACCCTCACCGACCGGG - Intronic
1133573940 16:7069371-7069393 GAAGGGGAACCACACACACCGGG - Intronic
1133669388 16:8003240-8003262 GGAGGGGAACAACACACACCAGG + Intergenic
1134194396 16:12147903-12147925 GGAGGGGAACAACAGGAAGCTGG + Intronic
1134300637 16:12987563-12987585 GGAGGGGAACAACACACACCAGG + Intronic
1135748380 16:25036650-25036672 GAAGGCGAACAACAGCAACCAGG - Intergenic
1135801923 16:25505428-25505450 GGAGGGGAACAACACTCACCAGG - Intergenic
1136451745 16:30357681-30357703 GGAGGGGACCCAGAGGGAACTGG + Exonic
1136913906 16:34163599-34163621 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1138179716 16:54933150-54933172 GGAGGGCAGCCTCAGCGACTCGG + Exonic
1138786206 16:59849852-59849874 GGAGGGGAACAACACACACCGGG - Intergenic
1139169121 16:64609718-64609740 GGAGGGGAACAACACACACCAGG - Intergenic
1139341739 16:66271905-66271927 GGAGGGGAACCAGAGCCAGAAGG + Intergenic
1140526846 16:75630246-75630268 GGAGGAGAACCAAAGTGCCCTGG + Intronic
1140656484 16:77145510-77145532 GGAGGGGAACAACAGACACTGGG - Intergenic
1140772943 16:78222864-78222886 GGAGGCGCTCCACAGCGAGCGGG - Intronic
1142844323 17:2660424-2660446 GGAGGGGAACAACACACACCCGG - Intronic
1143019249 17:3908142-3908164 AGAGGGGAAACAGAGCCACCTGG + Intronic
1143304403 17:5934319-5934341 GGAGGGGAACAACACACACCAGG - Intronic
1143869445 17:9947648-9947670 GGAGGAGAACCACTTGGACCCGG + Intronic
1143981346 17:10872918-10872940 GGAGGGGAACAACACACACCAGG - Intergenic
1144043438 17:11433254-11433276 GGAGGGGAACATCACCCACCGGG - Intronic
1144416993 17:15057804-15057826 GGAGGGGAACAACACATACCGGG + Intergenic
1144626309 17:16846000-16846022 GGAGGGGGTCCCCAGCCACCTGG - Intergenic
1144715912 17:17435832-17435854 GGAGGGGGACCACAGCCAGATGG - Intergenic
1144859242 17:18289872-18289894 GGAGGGGAAGCAGAGCTCCCTGG - Intronic
1144880124 17:18426720-18426742 GGAGGGGGTCCCCAGCCACCTGG + Intergenic
1145152109 17:20517664-20517686 GGAGGGGGTCCCCAGCCACCTGG - Intergenic
1145403688 17:22568560-22568582 GGAGGGCACCCACGGGGACCAGG - Intergenic
1145723239 17:27091270-27091292 GGAGGGCACCCACGGGGACCAGG + Intergenic
1146163469 17:30571877-30571899 GGAGGGGGTCCCCAGCCACCTGG - Intergenic
1146622565 17:34410801-34410823 AGAGGGGAACAACAGACACCAGG + Intergenic
1146952372 17:36915887-36915909 GGAGGGGAACAACACACACCAGG + Intergenic
1147580456 17:41624698-41624720 GGAGGGGGCCCCCAGCCACCTGG - Intronic
1147675578 17:42202726-42202748 GAAGGAGAGCCACAGCCACCTGG + Intronic
1147689987 17:42309107-42309129 GAAGGAGAGCCACAGCCACCTGG - Intronic
1148698998 17:49576917-49576939 GGAGGGGATCCCCGGCGCCCTGG - Intronic
1148739077 17:49881687-49881709 GGACAGGAACCACAGAGACATGG + Intergenic
1149020307 17:51955796-51955818 GGAGGGGAACCTCACACACCGGG + Intronic
1149395229 17:56234524-56234546 AGAGGGGAACAACAGACACCGGG - Intronic
1150698486 17:67426577-67426599 GGAGGGGAACAACACACACCGGG + Intronic
1151069819 17:71196059-71196081 AGAGGGGACCAACAGCCACCAGG - Intergenic
1152327568 17:79650533-79650555 GGACGTGAACCAGAGAGACCTGG + Intergenic
1152468132 17:80476942-80476964 GGCGGGAAACCACCGCGTCCGGG + Intronic
1153463354 18:5362034-5362056 GGAGGGGAACAACACATACCAGG + Intergenic
1153731823 18:8021541-8021563 GGAGGGGAACAACACACACCAGG - Intronic
1154393258 18:13962434-13962456 GGAGGGGAACATCAGACACCAGG - Intergenic
1155257168 18:24009018-24009040 AGAGGGGAACCACAGACGCCAGG + Intronic
1155444625 18:25898378-25898400 GGAGGGGAACAACACACACCAGG - Intergenic
1155651171 18:28143966-28143988 GGAGGGGAACAACACACACCAGG + Intronic
1156053683 18:32971195-32971217 GGAGGGGAACAACACAAACCAGG - Intronic
1156230161 18:35146057-35146079 GGAGGGGAACAACACACACCAGG - Intergenic
1157065829 18:44349558-44349580 GGAGGGGAACATCACCCACCGGG - Intergenic
1158175652 18:54652990-54653012 GGAGGGGAACCTCATGCACCCGG - Intergenic
1159320759 18:66845019-66845041 GGATGGGAACAACAGACACCTGG + Intergenic
1159392076 18:67806440-67806462 GGAGGGGAACAACACACACCAGG + Intergenic
1160077561 18:75693010-75693032 GGAGTGGAACCCCTGGGACCTGG + Intergenic
1160248854 18:77183723-77183745 GGAGGGGAACAACACACACCGGG - Intergenic
1160329246 18:77977266-77977288 GGAGGAGAATCGCTGCGACCTGG - Intergenic
1160466204 18:79078833-79078855 GGAGGGGAACAACACACACCGGG - Intronic
1160641376 19:140142-140164 GGAGGGGAACAACACACACCAGG + Intergenic
1160641393 19:140218-140240 GGAGGGGAACAACACACACCAGG + Intergenic
1160641414 19:140295-140317 GGAGGGGAACAACACACACCAGG + Intergenic
1160641433 19:140372-140394 GGAGGGGAACAACACACACCAGG + Intergenic
1160641454 19:140449-140471 GGAGGGGAACAACACACACCAGG + Intergenic
1161389414 19:4013462-4013484 GGCGGGGAGCCACAGTGGCCAGG + Intronic
1161523420 19:4738590-4738612 GGAGGGGGACCACATGAACCAGG + Intergenic
1162561182 19:11418942-11418964 GGAGGGGACCCGCAGCGAGGAGG - Intronic
1163781074 19:19248696-19248718 GGAGGGGGACCACAGAGCACTGG - Exonic
1164922494 19:32099537-32099559 GGAGGGGAACAACACACACCAGG - Intergenic
1165121501 19:33561723-33561745 GGAGGGGAACAACACACACCAGG - Intergenic
1168359898 19:55730726-55730748 GGAGGGGAACCACACACACTGGG + Intronic
1168389148 19:55992044-55992066 AGAGGGGAACCACAGATACTGGG - Intergenic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
925511962 2:4638029-4638051 GGAGGGGAACAACACACACCAGG + Intergenic
925915495 2:8601581-8601603 GGAGGGGAACAACACACACCAGG + Intergenic
926318607 2:11731249-11731271 GGAGGGGAACAACACACACCGGG - Intronic
926613570 2:14972267-14972289 GGAGGGGAACAACACATACCAGG + Intergenic
926651136 2:15346970-15346992 GGAGGGGAACAACACATACCAGG + Intronic
927256319 2:21043751-21043773 GGAGGGCAGCCACAGGGTCCAGG - Intronic
928133736 2:28672463-28672485 GGAGGGGAACAACACACACCAGG + Intergenic
928265213 2:29805515-29805537 GGAGGGGAACCACACACACTGGG - Intronic
928353365 2:30584046-30584068 GGAGGGGAACAACACACACCAGG - Intronic
928670109 2:33594380-33594402 GGAGGGGAACAACACACACCAGG + Intronic
930282861 2:49391747-49391769 AGAGGGGAACAACAGACACCGGG + Intergenic
930352449 2:50274364-50274386 GGAGGGGAACATCATCCACCAGG + Intronic
930478584 2:51917242-51917264 GGAGGGGAACAACACATACCAGG + Intergenic
930965659 2:57321305-57321327 GGAGGGGAACAACACACACCAGG + Intergenic
931624903 2:64248577-64248599 GGAGGGGAACAACAGACACTGGG + Intergenic
931903636 2:66819695-66819717 AGAGGGGAACCACAGACACAGGG - Intergenic
931917902 2:66979195-66979217 GGAGGGGAACAACACACACCAGG + Intergenic
932014069 2:68006784-68006806 GGAGGGGAACAACACACACCAGG + Intergenic
932903257 2:75724171-75724193 GGAGGGGAACCACACACACTGGG + Intergenic
932913299 2:75828299-75828321 GGAGGGGAACAACAGATACTGGG + Intergenic
933132512 2:78690223-78690245 GGAGGGGAACAACACACACCAGG + Intergenic
933143774 2:78825739-78825761 AGAGGGGAACCACAGACACAGGG + Intergenic
933237181 2:79877988-79878010 GGAGGGGAACAACACACACCAGG - Intronic
933797392 2:85930552-85930574 GGAGGGGCTCCACAGCCCCCAGG - Intergenic
934114790 2:88777435-88777457 GGAGGGGAACAACACACACCGGG - Intergenic
935852630 2:107239370-107239392 GGAGGGGAACAACACACACCAGG + Intergenic
935927047 2:108080756-108080778 GGAGGGGAACAACAGACACTGGG - Intergenic
935945367 2:108281270-108281292 GGAGGGGAACATCACCCACCAGG - Intergenic
936728626 2:115354722-115354744 GGAGGGGAACAACACACACCAGG - Intronic
936824951 2:116570816-116570838 GGAGGGGAACAACACACACCTGG - Intergenic
936928559 2:117763026-117763048 GGAGGGGAACAACACACACCAGG + Intergenic
937534852 2:122873684-122873706 GGAGGGGAACAACACACACCGGG + Intergenic
937664467 2:124468845-124468867 AGAGGGGTTCCACAGTGACCTGG - Intronic
937762890 2:125627361-125627383 GGAGGGGAACATCAGACACCAGG + Intergenic
938034880 2:128027652-128027674 GGCGGGGAAGCAGAGCGGCCGGG - Intronic
938976663 2:136485180-136485202 GGAGGGGAACAACACACACCAGG + Intergenic
939487121 2:142828417-142828439 GGAGGGGAACAACACACACCGGG - Intergenic
939548858 2:143588506-143588528 GGAAGGGAACGACACCCACCAGG - Intronic
939849189 2:147283664-147283686 GGAGGGGAACAACACACACCAGG + Intergenic
939956152 2:148529206-148529228 GGAGGGGAACAACACATACCGGG + Intergenic
940689574 2:156898713-156898735 GGAGGGGAACAACACATACCGGG + Intergenic
941116342 2:161476862-161476884 GGAGGGGAACAACACAGACTGGG + Intronic
941478593 2:165977791-165977813 GGAGGGGAACCTCACACACCGGG + Intergenic
941501948 2:166290088-166290110 GGAGGGGAACAACACACACCGGG - Intronic
943177234 2:184492355-184492377 AGAAGGGAACCACAGACACCAGG + Intergenic
943232468 2:185272415-185272437 GGAGAGGAACAACACAGACCAGG + Intergenic
943482485 2:188437890-188437912 AGAGGGGAACAACAGACACCAGG + Intronic
943539692 2:189197251-189197273 GGAGGGGAACAACACACACCGGG + Intergenic
943899129 2:193409379-193409401 GGAGGGGAACAACACACACCAGG + Intergenic
944315440 2:198280596-198280618 GGAGGGGAACAACAGTGAAGTGG - Intronic
944335695 2:198531338-198531360 GGAGGGGAACAACACACACCGGG + Intronic
945366825 2:208964900-208964922 AGAGGGGAACAACAGACACCTGG + Intergenic
945660899 2:212683985-212684007 GGAAGGGACCAACAGGGACCAGG + Intergenic
945865368 2:215168570-215168592 GGAGGGGAACGTCAGGCACCGGG + Intergenic
946122056 2:217524594-217524616 GGAGGGGAACAACACACACCAGG + Intronic
946181386 2:217951098-217951120 GGAAGGGAATCACAGAAACCTGG + Intronic
946781781 2:223198895-223198917 GGAGGGGAACATCAGACACCTGG + Intergenic
947092922 2:226533016-226533038 GGAGGGGAACAACACACACCAGG - Intergenic
947906251 2:233765575-233765597 GGAGGGGAACAACACACACCAGG + Intronic
948398727 2:237667200-237667222 GGAGGGGAACAACACTTACCAGG - Intronic
948421710 2:237864128-237864150 GGAGGGGAGGCAGAGTGACCTGG + Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1168932965 20:1638792-1638814 GGAGGGGAACAACACACACCAGG - Intronic
1169046355 20:2537184-2537206 TGAGGGGTCCCACAGTGACCGGG + Intronic
1169604580 20:7302402-7302424 GGAGGGTAACCAAGGGGACCAGG - Intergenic
1169685768 20:8269256-8269278 GGAGGGGAACATCACAGACCGGG - Intronic
1170288318 20:14737125-14737147 GGAGGGGAACAACACACACCAGG - Intronic
1170803432 20:19609588-19609610 GGAGGGGAACAACACACACCGGG - Intronic
1171810167 20:29741002-29741024 GGAGGCGAACCACGGCGATCGGG + Intergenic
1171984666 20:31651330-31651352 GGAGGGGAACAACATACACCAGG - Intergenic
1172447394 20:35000386-35000408 GGAGGGTGACCTCAACGACCTGG + Exonic
1173549035 20:43919695-43919717 GGAGGGGAACAACACACACCGGG - Intronic
1173810682 20:45953344-45953366 GCATGGGAACCAAAGGGACCAGG + Intronic
1174209938 20:48869812-48869834 GGAGGGGAACAACACATACCAGG + Intergenic
1174580313 20:51566808-51566830 GGATTGGAACCCCAGCCACCTGG + Intergenic
1174978032 20:55356734-55356756 GGAGGGGAACATCAGATACCAGG + Intergenic
1175659990 20:60804223-60804245 AGAGGGGAACCACAGGCACCGGG - Intergenic
1176282989 20:64325707-64325729 TGAGGGCAGCCACAGCTACCTGG - Intergenic
1176548904 21:8213260-8213282 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1176556799 21:8257473-8257495 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1176567835 21:8396295-8396317 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1176575738 21:8440514-8440536 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1176916767 21:14635150-14635172 GGAGGGGAACAACACACACCAGG + Intronic
1177884986 21:26736121-26736143 AGAAGGGAACCACAGACACCAGG - Intergenic
1179311482 21:40199744-40199766 GGAGGGGAACAACACGCACCGGG + Intronic
1181485127 22:23225721-23225743 GCAGGAGAAGCACAGGGACCTGG - Intronic
1181813871 22:25421755-25421777 AAAGGGGAACCACAGAGCCCGGG - Intergenic
1182420321 22:30245717-30245739 GGAGGGGAACCCCTGGGACAAGG - Intronic
1183302588 22:37065597-37065619 GGAGGGGACCCTCAGAGCCCTGG - Exonic
1183740644 22:39666791-39666813 GGAGGGGAGCCACAGGGCCTTGG + Intronic
1184171937 22:42765089-42765111 GGAGGTGAACCCCAGGGACGCGG + Intergenic
1184574839 22:45355204-45355226 GGAGTGGATGCACAGGGACCTGG - Intronic
1184583309 22:45431152-45431174 GGAGGGGAAACACCCCGCCCTGG + Intronic
1185226746 22:49657768-49657790 GGAGGGGAATCGCAGGGCCCCGG - Intergenic
1203253789 22_KI270733v1_random:129568-129590 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1203261845 22_KI270733v1_random:174647-174669 GGCGGCGAACCGCGGCGACCGGG - Intergenic
950658776 3:14453727-14453749 GCAGGGGAAGGACAGTGACCAGG + Intronic
953285366 3:41601643-41601665 GGAGGAAAACCACAGAGACGAGG - Intronic
953759635 3:45676475-45676497 GGAGGGGAACAACACACACCAGG - Intronic
954147953 3:48643535-48643557 GGAGGGGCACCAGAGTCACCTGG + Exonic
955303407 3:57806229-57806251 GGAGGGGAACAACACACACCAGG - Intronic
955886250 3:63601519-63601541 GGAAGGGAACAACAGAAACCAGG - Intronic
956318066 3:67961798-67961820 GGAGGGGAACAACAAACACCAGG + Intergenic
956412890 3:68996727-68996749 GCAGGGGAACCACAGCTTGCTGG - Intronic
956918521 3:73900604-73900626 GGAGGGGAACAACACACACCAGG - Intergenic
957159923 3:76597716-76597738 GGAGGGGAACAACAGACACTGGG - Intronic
957345480 3:78955385-78955407 AGAGGGGAACCACAGACACTGGG - Intronic
957433601 3:80146490-80146512 GGAGGGGAACAACACACACCAGG - Intergenic
957626487 3:82659168-82659190 GGAGGGGAACAACACACACCGGG - Intergenic
957699406 3:83689086-83689108 GGAGGGGAACAACACACACCAGG - Intergenic
958521903 3:95201466-95201488 GGAGGGGAACAACACACACCAGG - Intergenic
958677350 3:97282805-97282827 GGAGGGGAACAACACACACCGGG + Intronic
958870940 3:99558304-99558326 AGAGGGGAACCACAGATACTGGG + Intergenic
959006950 3:101030342-101030364 GGAGGGGAACAACACACACCAGG - Intergenic
959268757 3:104177352-104177374 AGAGGGGAACAACAGAGACTGGG - Intergenic
959392814 3:105797411-105797433 AGAGGGGAACAACAGACACCAGG + Intronic
959413914 3:106061148-106061170 GGAGGGCAAACACAGCAACTGGG + Intergenic
959416451 3:106081018-106081040 AGAGGGGAACAACAGACACCGGG - Intergenic
959618925 3:108379284-108379306 GGAGGGGAACAACACACACCAGG + Intergenic
960347398 3:116550939-116550961 AGAAGGGAACAACAGAGACCAGG - Intronic
960572973 3:119203618-119203640 GGAGGGGAACAACACACACCAGG + Intronic
960914379 3:122681241-122681263 GCCGGGGAACCGCAGCGCCCCGG - Intronic
961554627 3:127689559-127689581 GGAGGGGACCCAGAGAGGCCTGG - Exonic
961578317 3:127856729-127856751 AGAGGGGAACAACAGACACCGGG - Intergenic
962122155 3:132573101-132573123 GGAGGGGAACAACACACACCGGG - Intronic
962151354 3:132896879-132896901 GGAGGGGAACAACAGACACTGGG + Intergenic
962472629 3:135725877-135725899 GGCAGGGAACAACAGAGACCAGG - Intergenic
963228849 3:142889346-142889368 GGAGTGGCACCCCAGCGGCCCGG + Intergenic
963344826 3:144082723-144082745 GGAGGGGAACCACACACACTAGG + Intergenic
963639239 3:147838161-147838183 GGAGGGGAACAACACACACCAGG - Intergenic
963778527 3:149464155-149464177 GGCGTGGACTCACAGCGACCTGG + Intergenic
963988512 3:151626192-151626214 GGAGGGGAACAACACAGACTGGG - Intergenic
964858157 3:161170078-161170100 GGAGGGGAACAACACATACCAGG - Intronic
964859631 3:161186885-161186907 GGAGGGGAACAACACACACCAGG + Intronic
966253941 3:177897024-177897046 GGAGAGGACTCACAGCAACCAGG + Intergenic
966329827 3:178798693-178798715 GGAGGGGAACTACACACACCAGG + Intronic
966554656 3:181245345-181245367 GGAGGGGAACAACACACACCGGG + Intergenic
967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG + Exonic
967857108 3:194126477-194126499 GGAGGGGAACCACACACACTGGG - Intergenic
968218191 3:196912390-196912412 GGAGGGGAACAACATACACCGGG + Intronic
968879249 4:3290770-3290792 GGAGGAGAACCACAGGGGCCAGG + Intergenic
969014831 4:4097116-4097138 GGAGGGGAACAACATATACCAGG + Intergenic
969077038 4:4588146-4588168 GGAGGGGAACAACACACACCAGG + Intergenic
969798304 4:9542845-9542867 GGAGGGGAACAACATATACCAGG - Intergenic
969848009 4:9934829-9934851 GGAGGGGAACAACACACACCAGG - Intronic
970006875 4:11419447-11419469 GGAGGGGAACAACACACACCGGG + Intronic
970062629 4:12051793-12051815 GGAGGGGAACAACACACACCAGG + Intergenic
970107488 4:12601427-12601449 GGAGGGGAACAACAGACACTGGG + Intergenic
970411584 4:15813620-15813642 GGAGGGGAACAACACACACCGGG - Intronic
970674731 4:18435937-18435959 GGAGGGCAAGCACAGCCACAGGG + Intergenic
971042459 4:22769051-22769073 GGAGGGGAACATCAGACACCAGG - Intergenic
971517172 4:27501345-27501367 GGAGGGGAACAACATACACCAGG + Intergenic
971577935 4:28300928-28300950 GGAGGGGAACAACACACACCAGG + Intergenic
971628459 4:28956129-28956151 GGAGGGGAACGACAGACACTGGG + Intergenic
972105944 4:35487455-35487477 GGAGGGGAACAACAGACACTGGG + Intergenic
972265960 4:37460008-37460030 GGAGGGGAACAACACACACCGGG - Intronic
973082144 4:46006660-46006682 GGAGGGGAACAACACACACCGGG - Intergenic
973740362 4:53913835-53913857 AGAGGGGAACAACAGATACCGGG + Intronic
973781554 4:54292847-54292869 AGAGGGGAACAACAGACACCAGG + Intronic
973995042 4:56450140-56450162 GGAGGGGAACAACACACACCGGG + Intronic
974197490 4:58594247-58594269 GGAGGGGAACAACACACACCGGG + Intergenic
974309476 4:60186678-60186700 GGAGGGGAACAACACATACCAGG + Intergenic
974444017 4:61955708-61955730 GGAGGGGAACAACACACACCAGG - Intronic
974604915 4:64139651-64139673 GGAGGGGAACAACACATACCAGG - Intergenic
974956722 4:68650321-68650343 GGAGGGGAACAACACACACCGGG - Intronic
975063512 4:70035011-70035033 GGAGGGGAACAACACACACCAGG + Intronic
975212419 4:71716635-71716657 GGAGGGGAACAACACACACCGGG - Intergenic
975219739 4:71800253-71800275 GGAGGGGAACAACACACACCGGG - Intronic
975362688 4:73489790-73489812 GGAGGGGAACAACACAGGCCAGG + Intronic
976693653 4:87895270-87895292 GGAGGGGAACAACACATACCAGG + Intergenic
976938358 4:90667514-90667536 GGAGGGGAACATCACCCACCGGG - Intronic
977083805 4:92568745-92568767 GGAGGGGAACAACAGACACTGGG - Intronic
977273658 4:94949145-94949167 GGAGGGGAACCTCACACACCAGG - Intronic
977462520 4:97342836-97342858 GGAGGGGAACAACACACACCAGG + Intronic
978118994 4:105055734-105055756 GGTGGGGAACCACAGACACTGGG + Intergenic
978482577 4:109210989-109211011 AGAAGGGAACCACAGACACCGGG + Intronic
979148580 4:117278436-117278458 GGAGGGGAACAACATGCACCTGG - Intergenic
980185171 4:129452024-129452046 GGAGGGGAACAACACACACCAGG + Intergenic
981041771 4:140229792-140229814 GGAGGGGAACAACACACACCAGG - Intergenic
981187544 4:141821649-141821671 GGAGGGGAACAACACACACCAGG + Intergenic
981528390 4:145730340-145730362 GGAGGGAAACTCCAGCCACCGGG - Intronic
982047915 4:151467798-151467820 GGAGGGGAACGACACACACCAGG + Intronic
982371308 4:154636860-154636882 GGAGGGGAACAACACACACCAGG + Intronic
982682783 4:158452058-158452080 GGAGGGGAACAACACACACCAGG + Intronic
982744495 4:159092749-159092771 GGAGGGGAACAACACATACCAGG + Intergenic
982912839 4:161166287-161166309 GGAGGGGAACGACAGACACTGGG + Intergenic
983478488 4:168244073-168244095 GGAGGGGAACAACACATACCAGG + Intronic
984061850 4:174999080-174999102 GGAGGGGAACAACAGACACTGGG - Intergenic
984546693 4:181113187-181113209 GGAGGGGAACCTCATACACCGGG + Intergenic
984985048 4:185320445-185320467 GGAGGGGAACAACACACACCAGG + Intronic
985235195 4:187865137-187865159 AGAGGGGAACCACACACACCAGG - Intergenic
985839211 5:2293496-2293518 AGAGAGGAACAACAGAGACCCGG + Intergenic
985877880 5:2613820-2613842 GGAGGGGAACAACACACACCAGG - Intergenic
986076600 5:4344253-4344275 GGAGGGGAACAACATACACCAGG - Intergenic
986268315 5:6209803-6209825 AGAGGGGAACAACAGACACCGGG + Intergenic
986330067 5:6711472-6711494 GGAGGGGAACAACACACACCGGG - Intergenic
986535495 5:8782736-8782758 GGAGGGGAACATCACCTACCGGG - Intergenic
986561471 5:9064613-9064635 GGAGGGGAACACCACAGACCGGG + Intronic
986878306 5:12138140-12138162 GGAGGGGAACAACAGACACAGGG + Intergenic
986932459 5:12843139-12843161 GGAGGGGAACAACACGCACCAGG - Intergenic
987190813 5:15476333-15476355 GGAGGGGAACAACACACACCGGG + Intergenic
987430911 5:17831834-17831856 GGAGGGGAACAACACACACCAGG - Intergenic
987540315 5:19246530-19246552 GGAGGGGAACAACACACACCAGG + Intergenic
987725592 5:21695182-21695204 GGAGGGGAACAACACACACCAGG - Intergenic
987817416 5:22920578-22920600 GGAGGGGAACAACACACACCAGG + Intergenic
988254571 5:28805043-28805065 GGAGGGGAACCACACACACAGGG + Intergenic
988667179 5:33341857-33341879 GGAGGGGAACAACACACACCGGG - Intergenic
989246500 5:39261145-39261167 GGAGGGGAACAACACACACCAGG + Intronic
989697681 5:44222790-44222812 GGAGGGGAACAACACATACCAGG + Intergenic
990839663 5:60062884-60062906 GGAGGGGAACAACACACACCAGG + Intronic
991002143 5:61793104-61793126 GGAGGGGAACAACACACACCAGG - Intergenic
991445922 5:66699729-66699751 GGAGGGGAACAACACACACCAGG + Intronic
991539921 5:67716255-67716277 GGAGGGGAACAACACACACCAGG + Intergenic
992248998 5:74858551-74858573 TGAGGGGAACAACAGACACCAGG + Intronic
992390157 5:76323856-76323878 GGAGGGGAACAACACACACCAGG + Intronic
992917500 5:81473430-81473452 GGAGGGGAACAACACACACCAGG - Intronic
993242634 5:85410519-85410541 GGAAGGGAACAACAGACACCGGG - Intergenic
993399109 5:87426930-87426952 GGAGGGGAACGACACACACCGGG - Intergenic
993411862 5:87584031-87584053 GGAGGGGAACAACACACACCAGG + Intergenic
993865376 5:93188493-93188515 GGAGGGGAACAACACACACCAGG + Intergenic
993930313 5:93931007-93931029 GGAGGGGAACAACACACACCTGG - Intronic
994351204 5:98748593-98748615 GGAGGGGAACAACACACACCAGG + Intergenic
994545446 5:101161345-101161367 GGAGAGGAACAACAGATACCAGG - Intergenic
994835620 5:104848663-104848685 GGAGGGGAACCTCACACACCGGG - Intergenic
995028512 5:107452181-107452203 GGAGGGGAACAACACACACCAGG + Intronic
995144754 5:108774074-108774096 GGAGGGGAACAACACATACCAGG - Intronic
995471740 5:112509452-112509474 GGAGGGGAACATCAGACACCAGG + Intergenic
995593489 5:113724142-113724164 GGAGGGGAACAACACACACCAGG - Intergenic
996013843 5:118509270-118509292 GGAGGGACACCACAGAGATCTGG + Intergenic
996380273 5:122856140-122856162 AGAGGGGAACAACAGACACCAGG - Intronic
997211557 5:132079914-132079936 GGAGGGGGCCCACAGAGGCCAGG + Intergenic
997804176 5:136898284-136898306 GGAGGGGAACAACACACACCAGG - Intergenic
998173339 5:139885311-139885333 GGAGGAGCACCACAGGGCCCGGG + Intronic
998277675 5:140773584-140773606 GGAGGGGAACAACACATACCTGG - Intergenic
998426610 5:142034219-142034241 GGAGGGGAACAACACACACCGGG + Intergenic
998704584 5:144743971-144743993 GGAGGGGAACAACACACACCGGG - Intergenic
999581219 5:153040459-153040481 GGAGGGGAACAACACATACCAGG + Intergenic
999687668 5:154117212-154117234 GGAGGGGACCCACACCCAGCAGG + Intronic
1001096416 5:168779016-168779038 CCAGGTGAACCACAGCCACCAGG + Intronic
1001864999 5:175096222-175096244 GGAGGGGAACAACACACACCAGG + Intergenic
1002735404 5:181384034-181384056 GGAGGGGAACAACACACACCAGG - Intergenic
1002735426 5:181384111-181384133 GGAGGGGAACAACACACACCCGG - Intergenic
1002735447 5:181384188-181384210 GGAGGGGAACAACACACACCAGG - Intergenic
1002735468 5:181384265-181384287 GGAGGGGAACAACACACACCAGG - Intergenic
1002735488 5:181384342-181384364 GGAGGGGAACAACACACACCAGG - Intergenic
1002735508 5:181384419-181384441 GGAGGGGAACAACACACACCAGG - Intergenic
1002735526 5:181384496-181384518 GGAGGGGAACAACACACACCAGG - Intergenic
1002735546 5:181384573-181384595 GGAGGGGAACAACACACACCAGG - Intergenic
1002735566 5:181384650-181384672 GGAGGGGAACAACACACACCAGG - Intergenic
1002735586 5:181384727-181384749 GGAGGGGAACAACACACACCAGG - Intergenic
1002735606 5:181384804-181384826 GGAGGGGAACAACACACACCAGG - Intergenic
1002735626 5:181384881-181384903 GGAGGGGAACAACACACACCAGG - Intergenic
1002735647 5:181384958-181384980 GGAGGGGAACAACACACACCAGG - Intergenic
1002735667 5:181385035-181385057 GGAGGGGAACAACACACACCAGG - Intergenic
1002735684 5:181385112-181385134 GGAGGGGAACAACACACACCAGG - Intergenic
1002735704 5:181385189-181385211 GGAGGGGAACAACACACACCAGG - Intergenic
1002735723 5:181385266-181385288 GGAGGGGAACAACACACACCAGG - Intergenic
1002735742 5:181385343-181385365 GGAGGGGAACAACACACACCAGG - Intergenic
1002735762 5:181385420-181385442 GGAGGGGAACAACACACACCAGG - Intergenic
1002735783 5:181385497-181385519 GGAGGGGAACAACACACACCAGG - Intergenic
1002735804 5:181385574-181385596 GGAGGGGAACAACACACACCAGG - Intergenic
1002735823 5:181385651-181385673 GGAGGGGAACAACACACACCAGG - Intergenic
1002735845 5:181385728-181385750 GGAGGGGAACAACACACACCAGG - Intergenic
1002735862 5:181385805-181385827 GGAGGGGAACAACACACACCAGG - Intergenic
1002735880 5:181385882-181385904 GGAGGGGAACAACACACACCAGG - Intergenic
1002735899 5:181385959-181385981 GGAGGGGAACAACACACACCAGG - Intergenic
1002735920 5:181386036-181386058 GGAGGGGAACAACACACACCAGG - Intergenic
1002735941 5:181386113-181386135 GGAGGGGAACAACACACACCAGG - Intergenic
1002735961 5:181386190-181386212 GGAGGGGAACAACACACACCAGG - Intergenic
1002735977 5:181386266-181386288 GGAGGGGAACAACACATACCAGG - Intergenic
1002748721 6:88558-88580 GGAGGGGAACAACACACACCAGG + Intergenic
1002748741 6:88635-88657 GGAGGGGAACAACACACACCAGG + Intergenic
1002748779 6:88786-88808 GGAGGGGAACAACACACACCAGG + Intergenic
1002748799 6:88863-88885 GGAGGGGAACAACACACACCAGG + Intergenic
1002748819 6:88940-88962 GGAGGGGAACAACACACACCAGG + Intergenic
1002748838 6:89016-89038 GGAGGGGAACAACACACACCAGG + Intergenic
1002748858 6:89093-89115 GGAGGGGAACAACACACACCAGG + Intergenic
1002748877 6:89170-89192 GGAGGGGAACAACACACACCAGG + Intergenic
1002748899 6:89247-89269 GGAGGGGAACAACACACACCAGG + Intergenic
1002748917 6:89323-89345 GGAGGGGAACAACACACACCAGG + Intergenic
1002748939 6:89400-89422 GGAGGGGAACAACACACACCAGG + Intergenic
1002748959 6:89477-89499 GGAGGGGAACAACACACACCAGG + Intergenic
1002748981 6:89554-89576 GGAGGGGAACAACACACACCAGG + Intergenic
1002748999 6:89631-89653 GGAGGGGAACAACACACACCAGG + Intergenic
1002749018 6:89708-89730 GGAGGGGAACAACACACACCAGG + Intergenic
1002749039 6:89785-89807 GGAGGGGAACAACACACACCAGG + Intergenic
1002749095 6:90014-90036 GGAGGGGAACAACACACACCAGG + Intergenic
1002749116 6:90091-90113 GGAGGGGAACAACACACACCAGG + Intergenic
1003395635 6:5750001-5750023 GGAGGGGCTCCACAGATACCTGG - Intronic
1003709109 6:8569097-8569119 AGAAGGGAACAACAGAGACCTGG - Intergenic
1003803027 6:9692993-9693015 GGAGGGGAACAACAGACACCAGG - Intronic
1003981548 6:11394997-11395019 GGAGGGGAACAACACACACCAGG + Intergenic
1003999870 6:11587641-11587663 GGAGGGGAACGACATACACCAGG - Intergenic
1004112466 6:12732498-12732520 GGAGGGGAACAACACACACCAGG - Intronic
1004190622 6:13460634-13460656 GGAGGGGAACAACACACACCGGG + Intronic
1004794168 6:19062652-19062674 GGAGGGGAACAACACATACCAGG - Intergenic
1004829475 6:19462124-19462146 GGAGGGGAACAACACACACCGGG + Intergenic
1005768323 6:29037400-29037422 AGAGGGGAACAACAGACACCTGG - Intergenic
1005783664 6:29219679-29219701 GGAGGGGAACCACACACACTGGG - Intergenic
1005917841 6:30369631-30369653 AGAGGGGAACAACAGAGACTGGG + Intergenic
1005999211 6:30952451-30952473 GGAGGAGAATCACAGCCACCAGG - Exonic
1006053368 6:31361129-31361151 GGAGGGGAACAACACACACCAGG + Intergenic
1007134223 6:39506327-39506349 GGAGGGGAACAACACACACCGGG + Intronic
1008418113 6:51266795-51266817 GGTGGGGGACCACAGGGAACAGG + Intergenic
1008591626 6:52999252-52999274 GGAGGGGAACAACACACACCAGG + Intergenic
1008596960 6:53052074-53052096 GGAGGGGAACAACACACACCAGG - Intronic
1009285258 6:61807635-61807657 GGAGGGGAACAACAGACACTAGG + Intronic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1009592013 6:65684914-65684936 AGAGGGGAACAACAGACACCGGG - Intronic
1009916215 6:70000041-70000063 GGAGGGGAACAACACACACCAGG - Intronic
1010096643 6:72054099-72054121 GGAGGGGAACAACACATACCAGG - Intronic
1010375440 6:75163481-75163503 GGAGGGGAACCTCACACACCGGG + Intronic
1010412443 6:75575872-75575894 GGAGGGGAACAACACACACCAGG + Intergenic
1010473208 6:76254682-76254704 GGAGGGGAACAACACACACCAGG - Intergenic
1010663844 6:78602664-78602686 GGAGGGGAACAACACGCACCAGG - Intergenic
1011070268 6:83373781-83373803 GGAGGGGAACAACACACACCAGG - Intronic
1011251940 6:85380988-85381010 GGAGGGGAACAACACACACCAGG + Intergenic
1011766840 6:90629529-90629551 GGAGGGGAACATCACCCACCAGG + Intergenic
1011830743 6:91368380-91368402 GGAGGGGAACAACACACACCAGG - Intergenic
1012434296 6:99198579-99198601 GGAGGGGAACAACACACACCAGG - Intergenic
1012573254 6:100758391-100758413 GGAGGGGAACAACACACACCAGG - Intronic
1013126149 6:107186631-107186653 GGAGGGGAACAACACACACCAGG - Intronic
1013535928 6:111062904-111062926 GGAGGGGAACGTCAGACACCGGG - Intergenic
1013577008 6:111493781-111493803 GGAGGGGAACAACACACACCGGG - Intergenic
1014347530 6:120292896-120292918 GGAGGGGAACCTCACACACCAGG - Intergenic
1015075183 6:129148322-129148344 GGAGGGGAACAACACACACCAGG + Intronic
1015292473 6:131553265-131553287 GGAGGGGAACAACACACACCGGG - Intergenic
1015798264 6:137034583-137034605 GGAGGGGAACAACACACACCGGG - Intronic
1016801209 6:148170889-148170911 GGAGGGGAACAACACACACCGGG - Intergenic
1018900605 6:168050044-168050066 AGAGCGGAACCACAGGGGCCCGG + Intergenic
1019239670 6:170656351-170656373 GGAGGGGAACAACACACACCAGG - Intergenic
1019239688 6:170656428-170656450 GGAGGGGAACAACACACACCAGG - Intergenic
1019239709 6:170656505-170656527 GGAGGGGAACAACACACACCAGG - Intergenic
1019239726 6:170656582-170656604 GGAGGGGAACAACACACACCAGG - Intergenic
1019239746 6:170656659-170656681 GGAGGGGAACAACACACACCAGG - Intergenic
1019239766 6:170656736-170656758 GGAGGGGAACAACACACACCAGG - Intergenic
1019239787 6:170656813-170656835 GGAGGGGAACAACACACACCAGG - Intergenic
1019239808 6:170656890-170656912 GGAGGGGAACAACACACACCAGG - Intergenic
1019239828 6:170656967-170656989 GGAGGGGAACAACACACACCAGG - Intergenic
1019239849 6:170657044-170657066 GGAGGGGAACAACACACACCAGG - Intergenic
1019239869 6:170657121-170657143 GGAGGGGAACAACACACACCAGG - Intergenic
1019239889 6:170657197-170657219 GGAGGGGAACAACACACACCAGG - Intergenic
1019239929 6:170657350-170657372 GGAGGGGAACAACACACACCAGG - Intergenic
1019239948 6:170657427-170657449 GGAGGGGAACAACACACACCAGG - Intergenic
1019239967 6:170657504-170657526 GGAGGGGAACAACACACACCAGG - Intergenic
1019239987 6:170657581-170657603 GGAGGGGAACAACACACACCAGG - Intergenic
1019240008 6:170657658-170657680 GGAGGGGAACAACACACACCAGG - Intergenic
1019240028 6:170657735-170657757 GGAGGGGAACAACACACACCAGG - Intergenic
1019240047 6:170657812-170657834 GGAGGGGAACAACACACACCAGG - Intergenic
1019240065 6:170657872-170657894 GGAGGGGAACAACACACACCAGG - Intergenic
1019240085 6:170657949-170657971 GGAGGGGAACAACACACACCAGG - Intergenic
1019240106 6:170658026-170658048 GGAGGGGAACAACACACACCAGG - Intergenic
1019240147 6:170658180-170658202 GGAGGGGAACAACACACACCAGG - Intergenic
1019240166 6:170658257-170658279 GGAGGGGAACAACACACACCAGG - Intergenic
1019240186 6:170658334-170658356 GGAGGGGAACAACACACACCAGG - Intergenic
1019240207 6:170658411-170658433 GGAGGGGAACAACACACACCAGG - Intergenic
1019240228 6:170658488-170658510 GGAGGGGAACAACACACACCAGG - Intergenic
1019240246 6:170658565-170658587 GGAGGGGAACAACACACACCAGG - Intergenic
1019240265 6:170658642-170658664 GGAGGGGAACAACACACACCAGG - Intergenic
1019240283 6:170658719-170658741 GGAGGGGAACAACACACACCAGG - Intergenic
1019240303 6:170658796-170658818 GGAGGGGAACAACACACACCAGG - Intergenic
1019240323 6:170658873-170658895 GGAGGGGAACAACACACACCAGG - Intergenic
1019240343 6:170658950-170658972 GGAGGGGAACAACACACACCAGG - Intergenic
1019240362 6:170659027-170659049 GGAGGGGAACAACACACACCAGG - Intergenic
1019240381 6:170659104-170659126 GGAGGGGAACAACACACACCAGG - Intergenic
1019240401 6:170659181-170659203 GGAGGGGAACGACACACACCAGG - Intergenic
1019240421 6:170659258-170659280 GGAGGGGAACAACACACACCAGG - Intergenic
1019240441 6:170659335-170659357 GGAGGGGAACAACACACACCAGG - Intergenic
1019240461 6:170659412-170659434 GGAGGGGAACAACACACACCAGG - Intergenic
1019240481 6:170659489-170659511 GGAGGGGAACAACACACACCAGG - Intergenic
1019240499 6:170659566-170659588 GGAGGGGAACAACACACACCAGG - Intergenic
1019240517 6:170659643-170659665 GGAGGGGAACAACACACACCAGG - Intergenic
1019240536 6:170659720-170659742 GGAGGGGAACAACACACACCAGG - Intergenic
1019240557 6:170659797-170659819 GGAGGGGAACAACACACACCAGG - Intergenic
1019240577 6:170659873-170659895 GGAGGGGAACAACACACACCAGG - Intergenic
1019240596 6:170659950-170659972 GGAGGGGAACAACACACACCAGG - Intergenic
1019240614 6:170660027-170660049 GGAGGGGAACAACACACACCAGG - Intergenic
1019240634 6:170660104-170660126 GGAGGGGAACAACACACACCAGG - Intergenic
1019240653 6:170660181-170660203 GGAGGGGAACAACACACACCAGG - Intergenic
1019240673 6:170660258-170660280 GGAGGGGAACAACACACACCAGG - Intergenic
1019240692 6:170660335-170660357 GGAGGGGAACAACACACACCAGG - Intergenic
1019240729 6:170660489-170660511 GGAGGGGAACAACACACACCAGG - Intergenic
1019240749 6:170660565-170660587 GGAGGGGAACAACACACACCAGG - Intergenic
1019240769 6:170660642-170660664 GGAGGGGAACAACACACACCAGG - Intergenic
1019240789 6:170660719-170660741 GGAGGGGAACAACACACACCAGG - Intergenic
1019240809 6:170660796-170660818 GGAGGGGAACAACACACACCAGG - Intergenic
1019240829 6:170660872-170660894 GGAGGGGAACAACACACACCAGG - Intergenic
1019240849 6:170660949-170660971 GGAGGGGAACAACACACACCAGG - Intergenic
1019240868 6:170661025-170661047 GGAGGGGAACAACACACACCAGG - Intergenic
1019240889 6:170661102-170661124 GGAGGGGAACAACACACACCAGG - Intergenic
1019240910 6:170661179-170661201 GGAGGGGAACAACACACACCAGG - Intergenic
1019240930 6:170661256-170661278 GGAGGGGAACAACACACACCAGG - Intergenic
1019240950 6:170661333-170661355 GGAGGGGAACAACACACACCAGG - Intergenic
1019240970 6:170661409-170661431 GGAGGGGAACAACACACACCAGG - Intergenic
1019240990 6:170661486-170661508 GGAGGGGAACAACACACACCAGG - Intergenic
1019241010 6:170661563-170661585 GGAGGGGAACAACACACACCAGG - Intergenic
1019241031 6:170661640-170661662 GGAGGGGAACAACACACACCAGG - Intergenic
1019241051 6:170661717-170661739 GGAGGGGAACAACACACACCAGG - Intergenic
1019354512 7:571702-571724 GGAGGGGAACTCCAGGGGCCTGG + Intronic
1019556883 7:1636301-1636323 TGAGGGGACACACAGAGACCTGG - Intergenic
1019899257 7:4007226-4007248 GGAGGGGAACCACTGTTACCGGG + Intronic
1019966230 7:4500900-4500922 GGAGGGGAAACCCAGCCCCCTGG + Intergenic
1020120240 7:5499143-5499165 GGAGGGGGACCACAGACTCCTGG - Intronic
1020682193 7:11251089-11251111 GGAGAGGAGGCACAGAGACCTGG + Intergenic
1021575379 7:22101437-22101459 GGAGGGGAACAACACACACCGGG + Intergenic
1022246236 7:28562468-28562490 GGAGGGGAGCCTCAGCAACCTGG + Intronic
1022441530 7:30437193-30437215 GGAGGGGAACAACACACACCAGG + Intronic
1022876637 7:34539864-34539886 GGAGGGGAACAACACACACCAGG - Intergenic
1023132241 7:37014647-37014669 GGAGGGGAACAACACACACCGGG - Intronic
1023229613 7:38012846-38012868 AGAGGGGAACAACAGACACCGGG - Intronic
1023348789 7:39298975-39298997 GGAGGGGAACAACACACACCAGG + Intronic
1024338214 7:48230974-48230996 GGAGGGGAACAACATACACCAGG + Intronic
1024368294 7:48549236-48549258 GGAGGGGAACAACACACACCTGG - Intronic
1027279720 7:76599039-76599061 AGAGGGGAACAACAGATACCAGG + Intergenic
1027294026 7:76747897-76747919 GGAGGGGAACAACACACACCAGG - Intergenic
1027490898 7:78825035-78825057 GGAGGGGAACAACATACACCAGG + Intronic
1027859970 7:83565362-83565384 GGAGGGGAACAACACACACCAGG + Intronic
1027862631 7:83604806-83604828 GGAGGGGAACGACACACACCAGG - Intronic
1027997253 7:85439952-85439974 GGAGGGGAACAACACACACCAGG + Intergenic
1029004308 7:97191654-97191676 GGAGGGGAACAACAGACACTGGG + Intergenic
1029888733 7:103904026-103904048 GGAGGGGAACAACACACACCTGG - Intronic
1030257079 7:107522089-107522111 GGAGGGGAACAACACACACCAGG + Intronic
1030852757 7:114511174-114511196 GGAGGGGAACATCACCCACCAGG + Intronic
1030946757 7:115732925-115732947 GGAGGGGAACAACACATACCAGG + Intergenic
1031513496 7:122675788-122675810 GGAGGGGAACAACATACACCAGG + Intronic
1031715503 7:125104182-125104204 GGAGGGGAACCTCACAGACTGGG + Intergenic
1031893034 7:127317195-127317217 GGAAGGGAACCACAGACACTGGG + Intergenic
1032173374 7:129604347-129604369 GGAGGGGAACAACACTTACCGGG + Intergenic
1032388158 7:131538684-131538706 GGAGAGGAACCAGAGCGGGCAGG - Intronic
1032625391 7:133586259-133586281 GGAAGGGAACAACAGACACCAGG - Intronic
1033720185 7:144050869-144050891 GGATGAGAACCACATGGACCAGG - Exonic
1034200732 7:149281675-149281697 GCAGGGGAGCCACGGCCACCGGG + Exonic
1034646929 7:152656034-152656056 GGAGGGGAACAACAGACACCGGG + Intronic
1035030224 7:155852110-155852132 GGAGGGGTGCCACAGCAACTTGG - Intergenic
1035343603 7:158182495-158182517 GGAGGGGAACAACACACACCAGG - Intronic
1035507042 8:146301-146323 GGAGGGGAACAACACACACCAGG + Intergenic
1035507062 8:146378-146400 GGAGGGGAACAACACACACCAGG + Intergenic
1035507083 8:146455-146477 GGAGGGGAACAACACACACCAGG + Intergenic
1035507103 8:146532-146554 GGAGGGGAACAACACACACCAGG + Intergenic
1035507124 8:146609-146631 GGAGGGGAACAACACACACCAGG + Intergenic
1035507145 8:146686-146708 GGAGGGGAACAACACACACCAGG + Intergenic
1035507164 8:146763-146785 GGAGGGGAACAACACACACCAGG + Intergenic
1035507183 8:146840-146862 GGAGGGGAACAACACACACCAGG + Intergenic
1035507204 8:146917-146939 GGAGGGGAACAACACACACCAGG + Intergenic
1035507223 8:146994-147016 GGAGGGGAACAACACACACCAGG + Intergenic
1035507241 8:147071-147093 GGAGGGGAACAACACACACCAGG + Intergenic
1035507260 8:147148-147170 GGAGGGGAACAACACACACCAGG + Intergenic
1035507281 8:147225-147247 GGAGGGGAACAACACACACCAGG + Intergenic
1035507301 8:147302-147324 GGAGGGGAACAACACACACCAGG + Intergenic
1035507320 8:147379-147401 GGAGGGGAACAACACACACCAGG + Intergenic
1035507338 8:147456-147478 GGAGGGGAACAACACACACCAGG + Intergenic
1035507358 8:147533-147555 GGAGGGGAACAACACACACCAGG + Intergenic
1035507379 8:147610-147632 GGAGGGGAACAACACACACCAGG + Intergenic
1035507399 8:147686-147708 GGAGGGGAACAACACACACCAGG + Intergenic
1035507420 8:147763-147785 GGAGGGGAACAACACACACCAGG + Intergenic
1035507439 8:147840-147862 GGAGGGGAACAACACACACCAGG + Intergenic
1035507458 8:147917-147939 GGAGGGGAACAACACACACCAGG + Intergenic
1035507479 8:147994-148016 GGAGGGGAACAACACACACCAGG + Intergenic
1035507540 8:148224-148246 GGAGGGGAACAACACACACCAGG + Intergenic
1035921087 8:3676972-3676994 GGAGGGGAACATCATGGACCGGG + Intronic
1036093117 8:5690918-5690940 GGAGGGGAACAACACACACCGGG - Intergenic
1036434884 8:8723835-8723857 GGAGGGGAACATCACCCACCGGG + Intergenic
1036943786 8:13075310-13075332 GGAGGGAAGACACAGCGAGCAGG + Intergenic
1037816732 8:22116486-22116508 GGAAGCGAACCTCAGGGACCAGG - Intronic
1038685139 8:29709490-29709512 AGAAGGGAACCACAGCCATCAGG - Intergenic
1038942011 8:32315257-32315279 GGAGGGGAACAACACACACCAGG - Intronic
1038949702 8:32401110-32401132 GGAGGGGAACGACAGACACTGGG + Intronic
1039265735 8:35821946-35821968 GGAGGGGAACCACACACACTAGG + Intergenic
1039658725 8:39438964-39438986 GGAGGGGAACAACACACACCAGG + Intergenic
1040355484 8:46613849-46613871 GGAGGGGAACATCATCCACCGGG + Intergenic
1040748639 8:50677947-50677969 GGAGGGGAACAACATACACCAGG + Intronic
1040957763 8:52996894-52996916 GGAGGGGAACAACACACACCAGG - Intergenic
1041743664 8:61183115-61183137 GGAGGGGAACAACACACACCAGG + Intronic
1042108104 8:65349974-65349996 AGAGGGGAACAACAGATACCGGG - Intergenic
1042693926 8:71534721-71534743 GGAGGGGAACAACATGCACCAGG + Intronic
1043176177 8:77025964-77025986 GGAGGGGAACAACACACACCAGG + Intergenic
1044662882 8:94608799-94608821 GGAGGGGAACAACAGACACTAGG + Intergenic
1045018860 8:98024009-98024031 GGAGGGGAACAACACACACCGGG + Intronic
1045483847 8:102614613-102614635 GGAGGGGAACAACATACACCGGG + Intergenic
1045704935 8:104911384-104911406 GGAGGGGAACAACACATACCAGG - Intronic
1045829739 8:106444656-106444678 GGAGGGTAACAACACCCACCAGG + Intronic
1045874282 8:106961188-106961210 GGAGGGGAACAACACACACCAGG + Intergenic
1045952991 8:107872873-107872895 GGAGGGGAACAACATGCACCAGG - Intergenic
1045997812 8:108383828-108383850 GGAGGGGAACAACACACACCAGG - Intronic
1046247319 8:111581444-111581466 GGAGGGGAACAACACACACCGGG - Intergenic
1046470873 8:114672225-114672247 GGAGGGGAACCTCACACACCGGG - Intergenic
1046498304 8:115042848-115042870 GGAGGGGAACATCACCCACCGGG - Intergenic
1047558100 8:125955379-125955401 GGAGGGGAACAACACACACCAGG + Intergenic
1047571925 8:126108509-126108531 GGAGGGGAACAACACACACCAGG + Intergenic
1048254418 8:132894959-132894981 GGATGGGAAGCCCAGAGACCTGG + Intronic
1048340047 8:133531630-133531652 GGAGGGGAACAACACACACCAGG + Intronic
1050019650 9:1269734-1269756 GCAGGGGATCCACAGGGAGCCGG - Intergenic
1050143632 9:2542375-2542397 GGAGGGGAACAACACACACCAGG - Intergenic
1050432096 9:5572570-5572592 GGAGGGGAACATCACCCACCAGG + Intergenic
1050656643 9:7835898-7835920 GGAGGGGAACAACACACACCAGG - Intronic
1052052173 9:23860782-23860804 GGAGGGGAACAACACACACCAGG - Intergenic
1052165924 9:25327646-25327668 GGAGGGGAACAACACACACCAGG - Intergenic
1052263529 9:26545720-26545742 GGAGTGGAACAACAGCCACTGGG + Intergenic
1052369831 9:27651545-27651567 GGAGGGGAACAACACACACCAGG + Intergenic
1052589199 9:30469275-30469297 GGAGGGGAACAACAGACACTAGG + Intergenic
1053383041 9:37664492-37664514 GGAGGGGAACAACACACACCGGG - Intronic
1055387812 9:75782590-75782612 AGAGGGGAACAATAGCAACCAGG - Intergenic
1056211615 9:84369830-84369852 AGAGGGGAACAACAGACACCGGG - Intergenic
1057017896 9:91669807-91669829 GGAGGGGAACAACACACACCGGG - Intronic
1057199712 9:93133704-93133726 GGAGGGGAGTCACAGCCTCCGGG - Intronic
1058512201 9:105731478-105731500 GGTGGGGAACCTCACAGACCAGG - Intronic
1058549664 9:106100653-106100675 GGAGGGGAACAACACCCACTGGG - Intergenic
1059511192 9:114849260-114849282 GGAGGGGAACATCACAGACCGGG + Intergenic
1059562966 9:115352954-115352976 GGAGGGGAACAACACACACCGGG - Intronic
1059601689 9:115785596-115785618 GGAGGGGAACAACACACACCAGG + Intergenic
1060089868 9:120733184-120733206 GAGGGAGAACCACACCGACCAGG - Intergenic
1061548002 9:131315829-131315851 GGAGTTGAACCACAGTGACCAGG - Intergenic
1062142391 9:134966822-134966844 GGAGGGGGATCCCAGCCACCTGG + Intergenic
1203470189 Un_GL000220v1:112716-112738 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1203478010 Un_GL000220v1:156688-156710 GGCGGCGAACCGCGGCGACCGGG - Intergenic
1203600326 Un_KI270748v1:7414-7436 GGAGGGGAACAACACACACCAGG - Intergenic
1203600347 Un_KI270748v1:7491-7513 GGAGGGGAACAACACACACCAGG - Intergenic
1203600368 Un_KI270748v1:7568-7590 GGAGGGGAACAACACACACCAGG - Intergenic
1203600387 Un_KI270748v1:7645-7667 GGAGGGGAACAACACACACCAGG - Intergenic
1203600407 Un_KI270748v1:7722-7744 GGAGGGGAACAACACACACCAGG - Intergenic
1203600427 Un_KI270748v1:7799-7821 GGAGGGGAACAACACACACCAGG - Intergenic
1203600467 Un_KI270748v1:7953-7975 GGAGGGGAACAACACACACCAGG - Intergenic
1203600485 Un_KI270748v1:8030-8052 GGAGGGGAACAACACACACCAGG - Intergenic
1203600505 Un_KI270748v1:8107-8129 GGAGGGGAACAACACACACCAGG - Intergenic
1203600524 Un_KI270748v1:8184-8206 GGAGGGGAACAACACACACCAGG - Intergenic
1203600545 Un_KI270748v1:8261-8283 GGAGGGGAACAACACACACCAGG - Intergenic
1203600565 Un_KI270748v1:8338-8360 GGAGGGGAACAACACACACCAGG - Intergenic
1203600584 Un_KI270748v1:8415-8437 GGAGGGGAACAACACACACCAGG - Intergenic
1203600604 Un_KI270748v1:8492-8514 GGAGGGGAACAACACACACCAGG - Intergenic
1203600622 Un_KI270748v1:8569-8591 GGAGGGGAACAACACACACCAGG - Intergenic
1203600641 Un_KI270748v1:8646-8668 GGAGGGGAACAACACACACCAGG - Intergenic
1203600661 Un_KI270748v1:8723-8745 GGAGGGGAACAACACACACCAGG - Intergenic
1203600682 Un_KI270748v1:8800-8822 GGAGGGGAACAACACACACCAGG - Intergenic
1203600703 Un_KI270748v1:8877-8899 GGAGGGGAACAACACACACCAGG - Intergenic
1203600723 Un_KI270748v1:8954-8976 GGAGGGGAACAACACACACCAGG - Intergenic
1203600744 Un_KI270748v1:9031-9053 GGAGGGGAACAACACACACCAGG - Intergenic
1203600765 Un_KI270748v1:9108-9130 GGAGGGGAACAACACACACCAGG - Intergenic
1203600786 Un_KI270748v1:9185-9207 GGAGGGGAACAACACACACCAGG - Intergenic
1203600805 Un_KI270748v1:9262-9284 GGAGGGGAACAACACACACCAGG - Intergenic
1203600826 Un_KI270748v1:9339-9361 GGAGGGGAACAACACACACCAGG - Intergenic
1203600844 Un_KI270748v1:9416-9438 GGAGGGGAACAACACACACCAGG - Intergenic
1203600864 Un_KI270748v1:9493-9515 GGAGGGGAACAACACACACCAGG - Intergenic
1203600885 Un_KI270748v1:9570-9592 GGAGGGGAACAACACACACCAGG - Intergenic
1203600905 Un_KI270748v1:9647-9669 GGAGGGGAACAACACACACCAGG - Intergenic
1203600923 Un_KI270748v1:9724-9746 GGAGGGGAACAACACACACCAGG - Intergenic
1203600943 Un_KI270748v1:9801-9823 GGAGGGGAACAACACACACCAGG - Intergenic
1203600961 Un_KI270748v1:9878-9900 GGAGGGGAACAACACACACCAGG - Intergenic
1203600981 Un_KI270748v1:9955-9977 GGAGGGGAACAACACACACCAGG - Intergenic
1203601001 Un_KI270748v1:10032-10054 GGAGGGGAACAACACACACCAGG - Intergenic
1203601021 Un_KI270748v1:10109-10131 GGAGGGGAACAACACACACCAGG - Intergenic
1203601041 Un_KI270748v1:10185-10207 GGAGGGGAACAACACACACCAGG - Intergenic
1203601061 Un_KI270748v1:10262-10284 GGAGGGGAACAACACACACCAGG - Intergenic
1203601082 Un_KI270748v1:10339-10361 GGAGGGGAACAACACACACCAGG - Intergenic
1203601103 Un_KI270748v1:10416-10438 GGAGGGGAACAACACACACCAGG - Intergenic
1203601123 Un_KI270748v1:10493-10515 GGAGGGGAACAACACACACCAGG - Intergenic
1203601144 Un_KI270748v1:10570-10592 GGAGGGGAACAACACACACCAGG - Intergenic
1203601164 Un_KI270748v1:10647-10669 GGAGGGGAACAACACACACCAGG - Intergenic
1203601184 Un_KI270748v1:10724-10746 GGAGGGGAACAACACACACCAGG - Intergenic
1203601204 Un_KI270748v1:10800-10822 GGAGGGGAACAACACACACCAGG - Intergenic
1203601224 Un_KI270748v1:10877-10899 GGAGGGGAACAACACACACCAGG - Intergenic
1203601244 Un_KI270748v1:10954-10976 GGAGGGGAACAACACACACCAGG - Intergenic
1203601264 Un_KI270748v1:11030-11052 GGAGGGGAACAACACACACCAGG - Intergenic
1185466682 X:358969-358991 GGCGGGGAAGCACCGCGGCCGGG + Intronic
1185984108 X:4811309-4811331 GGAGGGGAACAACACCCACTGGG - Intergenic
1188298121 X:28475043-28475065 GGAAGGGAACAACAGACACCAGG + Intergenic
1188966555 X:36560724-36560746 AGAGGGGAACAACAGACACCGGG - Intergenic
1189861978 X:45281987-45282009 GGAGGGGAACAACACACACCAGG - Intergenic
1189921303 X:45905475-45905497 GGAGGGGAACAACAGACACTGGG - Intergenic
1189979286 X:46492959-46492981 GGAGGGGAACAACACACACCAGG + Intronic
1190373900 X:49769846-49769868 GGAGGGGAACAACACACACCAGG - Intergenic
1190385672 X:49880108-49880130 GGTGTGGAACCCCAGAGACCAGG + Exonic
1190493709 X:51007153-51007175 GGAGGGGAACAACACACACCAGG - Intergenic
1190603528 X:52117076-52117098 GGAGGGGAACAACACACACCGGG + Intergenic
1191163441 X:57360848-57360870 GGAGGGGAACAACACACACCGGG - Intronic
1191656682 X:63606117-63606139 GGAGGGGAACAACATTGACTGGG + Intergenic
1191763800 X:64673660-64673682 GGAGGGGAACAACAGGCACCAGG + Intergenic
1191906495 X:66096890-66096912 GGAGGGGAACAACACACACCAGG + Intergenic
1192852671 X:74974156-74974178 GGAGGGGAACAACAGCCACCAGG + Intergenic
1193119403 X:77807657-77807679 GAAGGGCATCCACAGCAACCTGG - Intergenic
1193479229 X:82006883-82006905 GGAGGGGAACAACAAACACCGGG - Intergenic
1193479655 X:82011268-82011290 GGAGGGGAACATCACAGACCAGG - Intergenic
1193741111 X:85218083-85218105 GGAGGGGAACAACAGACACTGGG + Intergenic
1193768009 X:85555580-85555602 GGAGGGGAACAACACACACCAGG - Intergenic
1194228655 X:91294665-91294687 GGAGGGGAACATCAGACACCAGG - Intergenic
1194347096 X:92779301-92779323 AGAGGGGAACAACAGCCACTGGG + Intergenic
1194376167 X:93136485-93136507 GGAGGGGAACAACACACACCAGG + Intergenic
1194404437 X:93477440-93477462 GGAGGGGAACAACACACACCAGG + Intergenic
1194637263 X:96361295-96361317 GGAGGGGAACAACACACACCAGG + Intergenic
1194909144 X:99617707-99617729 GGAGGGGAACAACACACACCAGG - Intergenic
1194910964 X:99644086-99644108 GGAGGGGAACAACACACACCTGG - Intergenic
1195148333 X:102041159-102041181 GGAGGGGAACAACAAACACCAGG + Intergenic
1195347928 X:103969410-103969432 GGAGGGGAACATCACCCACCTGG - Intergenic
1195359514 X:104069431-104069453 GGAGGGGAACATCACCCACCTGG + Intergenic
1195488266 X:105435861-105435883 GGAGGGGAACAACACATACCGGG + Intronic
1195549180 X:106146992-106147014 AGAGGGGAACAACAGACACCGGG + Intergenic
1195738530 X:108038272-108038294 GGAGGGGAACAACACACACCGGG - Intergenic
1195978604 X:110554625-110554647 GGAGGGGAACAACACACACCAGG - Intergenic
1196242581 X:113360550-113360572 GGAGGGGAACAACACACACCAGG - Intergenic
1196551447 X:117031468-117031490 GGAGGGGAACAACAGACACTGGG + Intergenic
1196671613 X:118374110-118374132 GGAGGGGAACAACACACACCAGG - Intronic
1197029562 X:121797320-121797342 GGAGGGGAACAACACACACCAGG - Intergenic
1197142858 X:123135890-123135912 GGAGGGGAACAACAGACACTGGG + Intergenic
1197698171 X:129573402-129573424 GGAGGGGAACAACACACACCAGG - Intronic
1197732229 X:129820949-129820971 GGAGGGGAACAACACACACCGGG - Intronic
1197913123 X:131507131-131507153 GGAGGGGAACGACACACACCAGG + Intergenic
1198210304 X:134509949-134509971 GGAGGGGAACAACACACACCGGG - Intronic
1198268371 X:135032068-135032090 GGAGAGGAACCAGGGAGACCTGG - Intergenic
1198644107 X:138787731-138787753 GGAGGGGAACAACACACACCAGG - Intronic
1199141635 X:144320479-144320501 GGAGGGGAACATCACCCACCGGG + Intergenic
1199477992 X:148267361-148267383 GGAGGGGAACAACACACACCAGG - Intergenic
1199567837 X:149234595-149234617 GGAGGGGAACAACACACACCAGG + Intergenic
1199719139 X:150529627-150529649 AGAGGGGAACCACAGACACTGGG - Intergenic
1200097201 X:153669928-153669950 GGAGGGGAGCCACTGCCCCCAGG + Intronic
1200327004 X:155251317-155251339 GGAGGGGAACAACACACACCAGG + Intergenic
1200370091 X:155715869-155715891 GGAGGGCAAGCACAGCGACTGGG - Intergenic
1200405086 Y:2801928-2801950 GGAGGGGAACCACACACACTGGG - Intergenic
1200655422 Y:5895939-5895961 AGAGGGGAACAACAGCCACTGGG + Intergenic