ID: 967017810

View in Genome Browser
Species Human (GRCh38)
Location 3:185497630-185497652
Sequence TGCTACTATAACCCTTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967017810 Original CRISPR TGCTACTATAACCCTTGGGC AGG (reversed) Intronic
909952996 1:81742018-81742040 TGCTAATGTAAACCTAGGGCAGG - Intronic
915904518 1:159868036-159868058 TTCAACTTTATCCCTTGGGCTGG - Intronic
1085197068 11:74679232-74679254 TCCTGCAAAAACCCTTGGGCTGG - Intergenic
1089453784 11:118613971-118613993 TGCTCCTTTCATCCTTGGGCTGG - Intronic
1090446253 11:126767224-126767246 AGCTCCTCTGACCCTTGGGCGGG - Intronic
1091823829 12:3494650-3494672 AGATACTCTAACCATTGGGCAGG + Intronic
1104226974 12:126844640-126844662 GGCTTCTCTTACCCTTGGGCTGG + Intergenic
1110663815 13:78091920-78091942 TGTTAATATCACCCTTAGGCTGG - Intergenic
1112368617 13:98775665-98775687 TGCTACTGTAACCCTGTGGGTGG - Intergenic
1114458316 14:22871749-22871771 GGCTACTCCAACCCCTGGGCGGG + Exonic
1115778218 14:36739835-36739857 TTCTGCTTTATCCCTTGGGCTGG - Intronic
1118520241 14:66575554-66575576 TGCTACTAGAATTCTTGGGAAGG + Intronic
1118796493 14:69150476-69150498 TACTACTTTTATCCTTGGGCAGG - Intronic
1120438350 14:84505429-84505451 TGCTGCTATGTTCCTTGGGCTGG + Intergenic
1128375077 15:67068371-67068393 TGCTTCTTTAATCTTTGGGCTGG + Intronic
1129536781 15:76319620-76319642 TACTACTATACCCCCTGGGATGG + Intergenic
1131466141 15:92655967-92655989 TGCCACGATGACACTTGGGCTGG + Intronic
1133326978 16:4947784-4947806 TGCTACTATATCCCCAGAGCCGG - Intronic
1136391993 16:29971343-29971365 TCCTTCTATAGCCCTTGGACTGG + Intronic
1140570692 16:76103469-76103491 TGCTGCTGGAGCCCTTGGGCTGG + Intergenic
1141430956 16:83969903-83969925 TGCTCCTGGAACCCTTGGCCGGG + Intronic
1142792897 17:2282210-2282232 TCCTCTTATAACTCTTGGGCGGG - Intronic
1144412195 17:15012136-15012158 TACTACTATAATCCTTAAGCTGG + Intergenic
1146354215 17:32120392-32120414 TGCTATTATCACCCTTAGCCTGG + Intergenic
1157224236 18:45848534-45848556 TGCGACTCTAACCCCAGGGCTGG + Exonic
1157716391 18:49890643-49890665 TGCTACTAGAAACCTTGCGCTGG - Intronic
931902489 2:66805311-66805333 TGCAACTAAGAGCCTTGGGCTGG - Intergenic
933108802 2:78371043-78371065 TGCTACTCTGTCACTTGGGCTGG + Intergenic
934744633 2:96751089-96751111 CTCTACTACAACCCTTGGGTAGG + Intergenic
943750552 2:191505380-191505402 TGATCCTAAAACCCCTGGGCTGG + Intergenic
1175034570 20:55988029-55988051 TGCTTCTATAAGCCTAGGGTGGG - Intergenic
1177489834 21:21808432-21808454 TGCTACTATAACCGTTTTGATGG - Intergenic
1181272973 22:21671197-21671219 TGCTGCTGTGACCCTTGGGCAGG + Intronic
950061567 3:10076189-10076211 TGCTACTATTAACTCTGGGCAGG - Intronic
955118563 3:56031415-56031437 TGCTGCTAGAGTCCTTGGGCTGG - Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
962152949 3:132912281-132912303 AGCTACTGTCACCCTTAGGCTGG + Intergenic
964512727 3:157470741-157470763 TTCTACTATCACCCTTAGACAGG + Intronic
964623158 3:158734982-158735004 TGCTACTATAACCTCTTGGAGGG - Intronic
967017810 3:185497630-185497652 TGCTACTATAACCCTTGGGCAGG - Intronic
971066028 4:23034628-23034650 TGGTACTATAATTCTTGTGCTGG + Intergenic
984738727 4:183138194-183138216 TCCCCCTATAACCTTTGGGCTGG + Intronic
986783973 5:11094211-11094233 TCCTACTTTAACCATTGGGATGG + Intronic
990532947 5:56692150-56692172 TGCTATTATAACCCCTTTGCGGG - Intergenic
996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG + Intergenic
998218906 5:140259364-140259386 TGCTTCTACAACCCTTGTGTTGG - Intronic
1006832257 6:36976108-36976130 TCCTACTCTTACTCTTGGGCGGG - Intronic
1008012894 6:46487872-46487894 TGCTACTAGAACCATTGGTTTGG - Intronic
1021355777 7:19651767-19651789 TGCTATTTTTACCCTTGGACTGG + Intergenic
1030143370 7:106328132-106328154 TGCTCCTAGATCCCTCGGGCAGG - Intergenic
1033904858 7:146190534-146190556 TGGTACCAAAACCCTTTGGCAGG + Intronic
1053109027 9:35440814-35440836 TTCTACTATAGCCTTTGGTCAGG + Intergenic
1055865208 9:80805032-80805054 TGCTAATGTAACCTATGGGCTGG + Intergenic
1058465747 9:105225491-105225513 TGCTACTATATCCCTTGACTAGG + Intergenic
1185874356 X:3690158-3690180 TGCTGCTATAACCAGTGGGTGGG + Intronic
1187408669 X:19027097-19027119 TGGCTCTATAACCTTTGGGCTGG + Intronic
1189753658 X:44248967-44248989 TCTTACTATAACCCCAGGGCTGG + Intronic
1192805071 X:74501520-74501542 TGCAACTATAACCCTGGAGCAGG + Intronic