ID: 967018540

View in Genome Browser
Species Human (GRCh38)
Location 3:185502855-185502877
Sequence ACAGTCCCACATTTATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967018539_967018540 0 Left 967018539 3:185502832-185502854 CCGGTCTAAAGTAGGAACTCTTA No data
Right 967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG No data
967018537_967018540 6 Left 967018537 3:185502826-185502848 CCATGCCCGGTCTAAAGTAGGAA No data
Right 967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG No data
967018538_967018540 1 Left 967018538 3:185502831-185502853 CCCGGTCTAAAGTAGGAACTCTT No data
Right 967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG No data
967018535_967018540 9 Left 967018535 3:185502823-185502845 CCACCATGCCCGGTCTAAAGTAG No data
Right 967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967018540 Original CRISPR ACAGTCCCACATTTATAGCC TGG Intergenic
No off target data available for this crispr