ID: 967019819

View in Genome Browser
Species Human (GRCh38)
Location 3:185512910-185512932
Sequence GGTGTTAAGAAAACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 606}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967019819_967019821 8 Left 967019819 3:185512910-185512932 CCAGATTTTGTTTTCTTAACACC 0: 1
1: 1
2: 6
3: 75
4: 606
Right 967019821 3:185512941-185512963 TGAAAGAAACCAGAGCTCCCTGG 0: 1
1: 3
2: 22
3: 111
4: 553
967019819_967019826 28 Left 967019819 3:185512910-185512932 CCAGATTTTGTTTTCTTAACACC 0: 1
1: 1
2: 6
3: 75
4: 606
Right 967019826 3:185512961-185512983 TGGAGAAATGGTTGATTCCATGG 0: 12
1: 70
2: 178
3: 331
4: 695
967019819_967019822 16 Left 967019819 3:185512910-185512932 CCAGATTTTGTTTTCTTAACACC 0: 1
1: 1
2: 6
3: 75
4: 606
Right 967019822 3:185512949-185512971 ACCAGAGCTCCCTGGAGAAATGG 0: 1
1: 21
2: 127
3: 360
4: 857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967019819 Original CRISPR GGTGTTAAGAAAACAAAATC TGG (reversed) Intronic
900210802 1:1454913-1454935 GTGGTTAAGAAAATAAAAGCTGG + Intronic
901214353 1:7547258-7547280 GGTGTTTAGAAGCCAAGATCTGG + Intronic
901286773 1:8086329-8086351 GATGTTTAGAAACCAAGATCTGG + Intergenic
901291067 1:8124949-8124971 GGTGTTTAGAAACCAAGATCTGG + Intergenic
901346548 1:8549161-8549183 AGTGTTTAGAAACCAAGATCTGG - Intronic
905330709 1:37194438-37194460 GGTGTCAAGAACACACAATAGGG + Intergenic
905552328 1:38852964-38852986 GGTGTGAAGAAAAACAAATTAGG - Intronic
905840755 1:41176243-41176265 CCAGTAAAGAAAACAAAATCCGG + Intronic
905987043 1:42295031-42295053 GGTTTCAAGAAAACTAACTCTGG - Intronic
906338934 1:44961035-44961057 GCTGTTAAAAAAAAAAAATCTGG + Intronic
906753345 1:48285935-48285957 GGTGTCAAGAATACAAAATGTGG - Intergenic
908373895 1:63513526-63513548 GGTATTTAGACACCAAAATCTGG + Intronic
908634276 1:66145178-66145200 GGTGATGAGAAAACAAAGTAGGG + Intronic
908979756 1:69941502-69941524 GGTGGTAAGAAACCAATTTCTGG + Intronic
909628838 1:77749680-77749702 GGGATTAAGAAAATAAAACCAGG - Intronic
910758722 1:90716098-90716120 GATGTTAAGAAAATAAAGTGGGG + Intronic
910793432 1:91074698-91074720 TGTGTTAAAAAAACAAAACAAGG + Intergenic
910909721 1:92220207-92220229 GCTATTTAGAAACCAAAATCTGG + Intronic
912022329 1:105120804-105120826 AGTGTTAAGAAAACAAACCTAGG + Intergenic
913283019 1:117203320-117203342 GGTGCTGAGAAAACACAATGAGG + Intronic
914418486 1:147506514-147506536 GGTGGAAAGAAAACAAAATTTGG + Intergenic
915155167 1:153869661-153869683 GGTGTTGCGAAACCAAGATCTGG + Intronic
915703196 1:157817403-157817425 GGTGTTAAGAATACACGATGTGG + Intronic
915772308 1:158440268-158440290 GGTGTGAAGAATACACAATGGGG + Intergenic
915844995 1:159253450-159253472 TCTGTTAAGAAACCAAAATTTGG + Intergenic
916228247 1:162511853-162511875 GGTGCCAAGAAAACACAATGGGG - Intronic
916253620 1:162763672-162763694 GGTATTTAGAAAACACAAACTGG + Intronic
916863525 1:168832122-168832144 GGTGGTAAGAACACAGAAACTGG - Intergenic
917053443 1:170951343-170951365 GGTTCTAAGAAAGCAAAAACTGG + Intronic
918892825 1:190297264-190297286 GGTGTGAAGAACACACAATCAGG + Intronic
919060990 1:192632542-192632564 TGTGATAAGAAAAAAAAAACCGG + Intergenic
919348033 1:196411186-196411208 GTTGTCAAGAAAACACAATGTGG - Intronic
919465243 1:197917479-197917501 GGGGGGAGGAAAACAAAATCTGG - Exonic
919784630 1:201251454-201251476 GGTGCTAAGAGAACACAATATGG + Intergenic
920783456 1:209017261-209017283 GGTGTTTAGAAACCAAAATCTGG + Intergenic
920837821 1:209528267-209528289 GCTGATAAAAAAAAAAAATCAGG + Intergenic
920861853 1:209715380-209715402 GATATTTAGAAAACAAGATCTGG - Intronic
921667634 1:217891727-217891749 GGTATTTAGAAATCAAGATCTGG - Intergenic
921719821 1:218459212-218459234 GGAGCTAAGAATACAAAAGCAGG + Intergenic
921985087 1:221304028-221304050 GGTGTTAAGAACACATGCTCTGG - Intergenic
922195533 1:223356574-223356596 GGTAATCAAAAAACAAAATCTGG - Intronic
922250181 1:223842236-223842258 GGTTTTAAGAAAATAATAGCTGG - Intronic
922295196 1:224244062-224244084 GAAGTTATGAAAAAAAAATCTGG + Intronic
923007322 1:230061057-230061079 GGTATTTAGAAACCAAGATCTGG + Intronic
923072800 1:230581390-230581412 GATGTAAAGAAAACAAAAACGGG + Intergenic
923175358 1:231458592-231458614 GGTGCTAAGAACACACAATAGGG + Intergenic
923928312 1:238661570-238661592 GGGCTTAAAAAAACAAAATTAGG - Intergenic
924070183 1:240269308-240269330 GGTGTCAAGAACACAGAATGGGG - Intronic
924531628 1:244898780-244898802 AATGTTAAGAAAACAAAAATTGG + Intergenic
924790683 1:247244914-247244936 GGTATTTAGAAATCAAAATCTGG - Intergenic
1063154483 10:3366055-3366077 AGTTTTAACAAAATAAAATCAGG - Intergenic
1063583714 10:7332325-7332347 TGTGTTAATAAGACAAAAACAGG + Intronic
1064169014 10:13013205-13013227 GATATTTAGAAACCAAAATCTGG - Intronic
1064376772 10:14803519-14803541 GGTGTTTAGAAACCAATATTAGG - Intergenic
1064474370 10:15670967-15670989 GGTGTTAAGAAAACGGAGCCTGG - Intronic
1064555529 10:16543496-16543518 GGTGTGAAGAAAACAAAAGCAGG + Intergenic
1065261555 10:23928803-23928825 GAAGTGAACAAAACAAAATCTGG - Intronic
1065803248 10:29371668-29371690 GGGGTTAAGAAAAGAAATTAAGG - Intergenic
1066013251 10:31213588-31213610 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1066115982 10:32240493-32240515 GGTGTGAAGAATACACAATGAGG - Intergenic
1066151626 10:32626815-32626837 GGTGCTAAGAATACACAATGGGG - Intronic
1066756632 10:38718578-38718600 TGTCTCAAGAAAAAAAAATCGGG - Intergenic
1067099482 10:43324086-43324108 TGTGTTAAGAAAAAAAAGTCCGG - Intergenic
1067510287 10:46889080-46889102 TGTGTTCAGAAAACAAAAGCTGG - Intergenic
1067651968 10:48162777-48162799 TGTGTTCAGAAAACAAAAGCTGG + Intronic
1068089529 10:52415799-52415821 GGTATTTAGAAATCAAGATCTGG + Intergenic
1069267874 10:66485954-66485976 GGTGTCAAGAACACACAATGGGG + Intronic
1069320147 10:67159598-67159620 GGTGTCAAGAATACAGAATGGGG + Intronic
1069465119 10:68631566-68631588 TATCTTAAGAAAACAAAACCTGG - Intronic
1070581263 10:77721653-77721675 GCTGTTAAAAAGATAAAATCAGG - Intergenic
1070651684 10:78241895-78241917 GGTATTTAGAAGACAAGATCTGG + Intergenic
1070869273 10:79735266-79735288 GGTATTTAGAAACCAAGATCTGG + Intergenic
1071636192 10:87257453-87257475 GGTATTTAGAAACCAAGATCTGG + Intergenic
1071659049 10:87480490-87480512 GGTATTTAGAAACCAAGATCTGG - Intergenic
1071838487 10:89444101-89444123 GGTTTTATGGAAACAAAAGCAGG + Intronic
1072582447 10:96751151-96751173 TGTGGAAAGTAAACAAAATCAGG + Intergenic
1072793279 10:98334955-98334977 GGTGTTTAGAAACCAAACACTGG + Intergenic
1072978415 10:100079156-100079178 GCTGTAGAGAAAACTAAATCAGG - Intronic
1073659004 10:105451738-105451760 GGTACTAAGAAAACACAATGGGG - Intergenic
1073752538 10:106545092-106545114 GGTGCTAAGAACACACAATAGGG - Intergenic
1074704153 10:116116504-116116526 GGAGTTAAGGAATCCAAATCAGG + Intronic
1074775452 10:116765210-116765232 GGTATTTAGAAACCAAAACCTGG - Intergenic
1074802641 10:117016975-117016997 GGTATTCAGAAACCAAGATCTGG - Intronic
1075235236 10:120721819-120721841 GCTGTGAAAAAAAAAAAATCCGG - Intergenic
1075308144 10:121386267-121386289 GATGTTTAGAAACCAATATCTGG - Intergenic
1076045291 10:127288374-127288396 GGTATTTAGAAATCATAATCTGG + Intronic
1076201485 10:128562315-128562337 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1077149281 11:1062033-1062055 GGTATTTAGAAACCAAGATCTGG + Intergenic
1077822230 11:5758125-5758147 GGTGGCAAGAAAACACAATGGGG + Intronic
1077823727 11:5780774-5780796 GGTGCCAAGAACACACAATCAGG + Intronic
1078186899 11:9059665-9059687 GGCATTAAGGAAACAAACTCTGG + Intronic
1078435273 11:11319924-11319946 AGCGTTTAGAGAACAAAATCTGG - Intronic
1078730624 11:13970816-13970838 GCTATGAAGAAAACAAAATCAGG - Intronic
1079040212 11:17052668-17052690 GGTGGGAAGAAAACCAAATATGG - Intergenic
1079609331 11:22412409-22412431 GGTGCCAAGAACACAAAATGGGG + Intergenic
1079610696 11:22429370-22429392 GGTGTTATGCAAACAAACACTGG - Intergenic
1080851703 11:36076062-36076084 GGTATTTAGAAACCAAGATCTGG + Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081489920 11:43559240-43559262 GGTTACAAGAAAAAAAAATCTGG + Intronic
1081800571 11:45856267-45856289 TGTGTTAAGGAAAAAAATTCTGG + Intronic
1082098793 11:48154232-48154254 GGGGTTAAGAACACAGACTCTGG - Intronic
1082742764 11:56929154-56929176 AAAGTTAAGAAAACAAAAACTGG + Intergenic
1082766402 11:57171514-57171536 GCTGTGAAGAAAACCAAATCAGG - Intergenic
1083055274 11:59813159-59813181 GGTGCCAAGAAAACATAATGGGG + Intergenic
1083241926 11:61394963-61394985 AATGTTTAAAAAACAAAATCTGG - Intronic
1083937687 11:65878792-65878814 TGTGTCAAAAAAACAAAACCAGG - Intergenic
1083985668 11:66213478-66213500 GGTGTTCAGAAACCAAGATCTGG + Intronic
1085116170 11:73934120-73934142 GGTATTCAGAAACCAAGATCCGG + Intergenic
1085424900 11:76395639-76395661 GGTGTTTAGAAAGCAAGATATGG + Intronic
1085433399 11:76476808-76476830 GGTGTTTAGATACCACAATCTGG + Intronic
1085495057 11:76961483-76961505 GATTTTTAGAAAACAAGATCTGG - Intronic
1085817264 11:79752483-79752505 GGTGTTAAGAACACACATTGAGG + Intergenic
1086525263 11:87717799-87717821 GATATTTAGAAATCAAAATCTGG - Intergenic
1086549872 11:88043344-88043366 GGGGTGAAGAAAACAAAGGCAGG + Intergenic
1086640104 11:89143231-89143253 GGTGCTAAGAATACACAATAAGG + Intergenic
1087310906 11:96541972-96541994 GGTGATAAGAACACACAATGAGG - Intergenic
1087506250 11:99026266-99026288 GGTTTTAAAATAACAAAATAAGG - Intronic
1087750645 11:102003258-102003280 GGTATTTAGAAACCAAGATCTGG - Intergenic
1088441226 11:109872795-109872817 GGTGTCAAGAACACACAATGGGG + Intergenic
1089914310 11:122138012-122138034 GCTGTTAAAAAAACATAATGTGG + Intergenic
1090156355 11:124442247-124442269 GTTATTAAGAACACCAAATCTGG - Intergenic
1090289674 11:125531434-125531456 TGTCTTAAGAAAAAAAAATTAGG - Intergenic
1090603072 11:128392547-128392569 AGTGTTCAGAAGACAAATTCTGG - Intergenic
1090684953 11:129105947-129105969 AGTATTAAAAAAACAAAGTCTGG + Intronic
1090795469 11:130131941-130131963 GGTGTTTAGATAACAGAATAGGG - Intronic
1091365736 11:135018817-135018839 GGTATTCAGAAACCAAGATCTGG - Intergenic
1091441531 12:514725-514747 GTGGTTAAGAACACAAATTCTGG + Intronic
1092365900 12:7876789-7876811 GGTGCAAAGAAAAAAAAATTAGG + Intronic
1092458005 12:8661876-8661898 TGTGTTAAGAAAAAAAGTTCAGG - Intronic
1092525075 12:9304909-9304931 GGTTTTAAGAAAAAAAAGGCAGG - Intergenic
1092542192 12:9426909-9426931 GGTTTTAAGAAAAAAAAGGCAGG + Intergenic
1092775363 12:11940724-11940746 GATGTTTAGAAACCAACATCTGG - Intergenic
1092855060 12:12665536-12665558 GGTATTAAGAAAACAAAGATCGG + Intronic
1093011557 12:14112298-14112320 GATATAAAGAAAACAAAAACGGG + Intergenic
1093327147 12:17790579-17790601 GATATTAAGAAAAATAAATCTGG + Intergenic
1094071288 12:26416850-26416872 GGTTTAAAGAAAAAAAAATCTGG + Intronic
1094510821 12:31095524-31095546 GGTTTTAAGAAAAAAAAGGCAGG - Intronic
1095395241 12:41755794-41755816 TGTGTTTAGAAACCAATATCTGG + Intergenic
1095734267 12:45539252-45539274 GTTGTTATGAAGACAAAATAAGG + Intergenic
1095773178 12:45985102-45985124 GGTATTTAGAAAACAAGATTTGG + Intronic
1096150936 12:49312154-49312176 GTTATTTAGAAACCAAAATCTGG - Intergenic
1097482456 12:60147111-60147133 GGTGTTCATAAAACACAAGCTGG + Intergenic
1098399915 12:70064012-70064034 GGTATTTAGAAATCAATATCTGG + Intergenic
1098700940 12:73625019-73625041 GGTGTTAAGAAACCAAGATGGGG - Intergenic
1098777382 12:74637786-74637808 GGTGTCAAGAACACACAATGAGG + Intergenic
1099028006 12:77490369-77490391 GATGTTTAGAAAAAAAAATTAGG + Intergenic
1099232160 12:80039454-80039476 AGTCTTAAAAAAAAAAAATCTGG + Intergenic
1099971933 12:89509475-89509497 GGTATTTAGAAACCAATATCTGG + Intronic
1100972467 12:100085210-100085232 AGGGTTAAGACAATAAAATCAGG + Intronic
1101261367 12:103034327-103034349 GGTGTTAAGGAAAAGAATTCTGG - Intergenic
1101434264 12:104651670-104651692 GGTTCTAAGGAAACAAAACCAGG + Intronic
1102705780 12:114879200-114879222 AGTGTGAAGAAAATAAAATGAGG - Intergenic
1103606485 12:122089775-122089797 CATGTCAAGAAAACAAAATGTGG - Intronic
1103890576 12:124235728-124235750 GGGGATAGGAAAAAAAAATCAGG + Intronic
1104393531 12:128411661-128411683 GGTATTTAGAAACCAATATCTGG + Intronic
1104595245 12:130116066-130116088 TCTGTTTAGAAAACAAAATATGG + Intergenic
1105537597 13:21283099-21283121 GGTATTTAGAAACCAAATTCTGG + Intergenic
1105897502 13:24728659-24728681 GGTTTTATTAAAACAAAAACAGG + Intergenic
1105980005 13:25509616-25509638 AGTATTACGAAAACAAAATTGGG - Intronic
1106151459 13:27107636-27107658 GGTGTTTAGAGAACACAATCTGG - Intronic
1106675298 13:31952111-31952133 GGTTTTAAACAAACAAAATTAGG - Intergenic
1107046618 13:35999635-35999657 TGTGTCAAGAAAACAAAATTAGG - Intronic
1107206962 13:37803286-37803308 GGTGTTTAGGAATCAATATCTGG + Intronic
1107628513 13:42317041-42317063 GCTATTAAAAATACAAAATCCGG - Intronic
1107703168 13:43070503-43070525 GCTTTTGAGAAAACCAAATCAGG + Intronic
1107866427 13:44707713-44707735 GGTATTTAGAAACCAAGATCTGG + Intergenic
1108250931 13:48567160-48567182 GATATTTAGAAACCAAAATCTGG + Intergenic
1108894043 13:55300431-55300453 GGTGCTAAGAAAAAAAAAATAGG - Intergenic
1109068922 13:57737727-57737749 GTTATCAAGAACACAAAATCTGG + Intergenic
1109128585 13:58550554-58550576 GATGTAAAGAAAACAGAACCAGG - Intergenic
1109207932 13:59502067-59502089 AGTGTTTAGAAACCAAGATCTGG + Intergenic
1109333528 13:60962077-60962099 GGTGATAAGAACACAAATTAAGG - Intergenic
1109462479 13:62679758-62679780 AGTGGTTACAAAACAAAATCTGG - Intergenic
1110724411 13:78803082-78803104 GGTGCCAAGAACACAAAATAGGG - Intergenic
1111031522 13:82606076-82606098 GGTGTCAAGAACACACAATGGGG - Intergenic
1111115713 13:83774156-83774178 TGTGTGAAGAAAACTAAAACTGG + Intergenic
1111152482 13:84274218-84274240 GGTGTCAAGAACACACAATGAGG - Intergenic
1111362804 13:87197386-87197408 GGAATTAAGAAAACAAATTCTGG - Intergenic
1111861537 13:93713343-93713365 GTTGTTAATAAAGCAAGATCTGG + Intronic
1111988357 13:95089321-95089343 TGTGTTAAGAACACTAAGTCCGG + Intronic
1113059354 13:106305135-106305157 GGTTTTAAAAAAATTAAATCAGG - Intergenic
1114440529 14:22743035-22743057 GGTATTTAGAAACCAAGATCTGG - Intergenic
1114906022 14:27127543-27127565 GTAGAAAAGAAAACAAAATCTGG + Intergenic
1115578045 14:34730294-34730316 GGTGCTAAGAACACACAATGGGG - Intergenic
1116465262 14:45224206-45224228 GAAGTTAAGAAAACCAAAGCAGG - Exonic
1116660378 14:47702317-47702339 GTTGTAAAGAAAAAAAAATTAGG + Intergenic
1117520524 14:56546909-56546931 GGATTTAAAAAAAAAAAATCAGG - Intronic
1117662117 14:58018000-58018022 GGTGCTAAGAACACACAATGGGG + Intronic
1118168854 14:63365143-63365165 GGTATTTAGAAACCAAGATCTGG - Intergenic
1118342558 14:64907105-64907127 GGTTTTAAGAAAAGTAACTCTGG - Intergenic
1119072431 14:71600361-71600383 GGTGTCAAGAACACACAATGGGG - Intronic
1119350850 14:73964132-73964154 GAAGTTATGCAAACAAAATCAGG + Exonic
1120021011 14:79530108-79530130 GGTGCTAATAAAACTAACTCAGG - Intronic
1120322006 14:82975511-82975533 AGCATTTAGAAAACAAAATCTGG - Intergenic
1120467551 14:84880015-84880037 GGTATAAAAAAAACAAGATCTGG - Intergenic
1120558251 14:85956968-85956990 AGTTTTAGGAAAACAAACTCAGG + Intergenic
1120918186 14:89729139-89729161 GCTGTTAAACAAACAAAACCAGG + Intergenic
1121391503 14:93579789-93579811 GGTATTTAGAAACCAAGATCTGG + Intronic
1122188706 14:100022685-100022707 GGTGCCAAGGAAACAAAAACAGG - Intronic
1123462367 15:20485019-20485041 GGTTCTAAGAGACCAAAATCTGG - Intergenic
1123483896 15:20666310-20666332 GGTTTTTAGAAACCAAGATCTGG - Intergenic
1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG + Intergenic
1123773254 15:23550355-23550377 GGTGCTGAGAATACAAAATGGGG - Intergenic
1124227966 15:27912283-27912305 GGTGTTTAGAAATCAAAATCTGG - Intronic
1125139021 15:36381379-36381401 GGTGTTATGAAAATAAATTCAGG - Intergenic
1125526611 15:40380186-40380208 GGTGAGAAGAAAACAAAAAAGGG - Intergenic
1126427448 15:48544478-48544500 GGAATAAAGAAAATAAAATCAGG - Intronic
1126535836 15:49763195-49763217 GGTGTTAAGACTACAAAATGGGG - Intergenic
1126613320 15:50551474-50551496 GGTATTTAGAAACCAAGATCTGG + Intergenic
1127322496 15:57860899-57860921 GGTATTTAGAAACCAAGATCTGG + Intergenic
1127474956 15:59324438-59324460 GGTTTTAAAAGAAAAAAATCAGG + Intronic
1127560170 15:60128338-60128360 GGTGTTAAGAAGAGGAAACCGGG - Intergenic
1128394168 15:67206879-67206901 GGTATTTAGAAAGCAAGATCTGG + Intronic
1128908076 15:71486253-71486275 GCTGTTAAGGAAAAAAATTCAGG - Intronic
1129102853 15:73282239-73282261 GGTGTGAAAAAAAGAAAATGAGG - Intronic
1130875351 15:88009003-88009025 GGCAGAAAGAAAACAAAATCAGG - Intronic
1132329978 15:101005582-101005604 GGTATTTAGAAACCAAGATCTGG - Intronic
1132993470 16:2810167-2810189 GATCTTAAGAAAACTAAATGAGG - Intergenic
1133919980 16:10143662-10143684 AGTATTAAGAAAACAAGATTGGG + Intronic
1134060705 16:11197929-11197951 GGTGGGAAGAAAACAAAAACAGG + Intergenic
1134407467 16:13973925-13973947 GAGGTTAAGAATACAAACTCTGG + Intergenic
1134478402 16:14596131-14596153 GATGTTTAGAAACCAAGATCTGG - Intronic
1135545322 16:23362041-23362063 GGTATTTAGAAACCAAGATCTGG + Intronic
1136084074 16:27872059-27872081 GGAGTTAAGAAAACAGATTTTGG + Intronic
1136496703 16:30649580-30649602 TCTGTTAAGAAAACAAAATAAGG + Intergenic
1137913042 16:52398303-52398325 GTTGTAAAGAAAACAAAACAGGG + Intergenic
1138786272 16:59850358-59850380 GGTGTTAGGAAGATAAAATGAGG + Intergenic
1140024885 16:71277950-71277972 GGTGTTAAAAAAACCACATATGG + Intergenic
1141007278 16:80364039-80364061 GGTGTAAACAACAGAAAATCTGG + Intergenic
1141074355 16:80989606-80989628 GGTATTTAAAAAACAAAATCTGG + Intronic
1141545875 16:84768407-84768429 GGTGGAAAGAACACAAAATTAGG + Intronic
1143737002 17:8918200-8918222 GGTATTTAGAAACCAAGATCTGG - Intronic
1144131191 17:12249300-12249322 GGAGTAAAGGAAACAAATTCCGG + Intergenic
1145109430 17:20149209-20149231 GTTGTTAAGAACACAAACTCTGG + Intronic
1145245740 17:21268259-21268281 GGTGTGAGGAAAACAGAATTAGG - Intergenic
1145285742 17:21505062-21505084 GGTGTTAAAAAAAAAAAAAAAGG + Intergenic
1147480600 17:40758135-40758157 GGTGCCAAGAACACAAAATGGGG - Intergenic
1147530939 17:41276408-41276430 GGTGTAAGGAAAAAAGAATCAGG - Exonic
1147771435 17:42870755-42870777 GGTATTTAGAAACCAATATCTGG + Intergenic
1148042468 17:44719263-44719285 GCTGTTAAGAAAAAAAAAATAGG - Intronic
1149052287 17:52320439-52320461 GGTGTTTAGAAACTAACATCTGG - Intergenic
1149106337 17:52971907-52971929 GGTGTTTAGAAAACAAAATTTGG + Intergenic
1149190845 17:54059617-54059639 GATATTTAGAAAACAATATCTGG - Intergenic
1149309554 17:55380768-55380790 GGTGTTAAGACAAGAAGACCTGG - Intergenic
1149823570 17:59804744-59804766 AGTGTAATGAAAACAAAACCAGG - Intronic
1150040229 17:61852327-61852349 GATTTTAAAAAAACATAATCGGG - Intronic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1153595997 18:6725771-6725793 GGGGCTCAGAAAACAAAATGAGG + Intergenic
1153833830 18:8946966-8946988 GGAATTAAGAAAGCAAAAACAGG + Intergenic
1153874851 18:9360419-9360441 TGTGTTAAGTAAAAAAAGTCAGG + Intronic
1153892907 18:9534714-9534736 AATGTTAAGAAAAGAACATCAGG - Intronic
1154288886 18:13087506-13087528 GATGCCAAGAAAAAAAAATCAGG - Intronic
1154350324 18:13577785-13577807 CCTCTTAAGAAAACAAAATCAGG + Intronic
1155763358 18:29593996-29594018 GGCATCAAGAAAACAAAATGGGG + Intergenic
1156364294 18:36411488-36411510 GCTCTTAAGACAATAAAATCTGG + Intronic
1156877938 18:42038780-42038802 GCTGTTACGGAAAGAAAATCTGG + Exonic
1157030189 18:43896598-43896620 GGTATTTAGAAATCAAGATCTGG + Intergenic
1157094028 18:44670511-44670533 GGTCCAAAGAAAACAAAATTGGG - Intergenic
1157688122 18:49659233-49659255 GTTGTGAAGAAAAGAAAAGCAGG - Intergenic
1158733923 18:60057824-60057846 GGTGTTAAGAAGACAGAACTGGG - Intergenic
1158780865 18:60648995-60649017 GAGGTTAAGAACACAAATTCTGG + Intergenic
1158797435 18:60864197-60864219 AGTGATAAGAAAACAAAATATGG - Intergenic
1159434931 18:68404647-68404669 GGTGTGAAGAATACACAATGGGG + Intergenic
1159440197 18:68468862-68468884 AGTATTAAGAACAAAAAATCAGG + Intergenic
1159933471 18:74338876-74338898 AATGTTAAGAAAGCAAAATAAGG - Intronic
1160122647 18:76144723-76144745 GAGGATAAGAAAACATAATCGGG - Intergenic
1160261882 18:77301688-77301710 GGTGGCAACAAAATAAAATCAGG + Intergenic
1161171608 19:2815081-2815103 GGGGTTCAGAAAAGAAAAGCTGG + Exonic
1161559283 19:4962813-4962835 CGTTTTAAAAAAAAAAAATCGGG + Intergenic
1161727009 19:5935338-5935360 GGTCATAAAAAAACAAACTCAGG + Intronic
1164023859 19:21332378-21332400 AGTGTTCAGAAAACAGATTCTGG + Intergenic
1164483014 19:28630143-28630165 GGTATTAAGAATACACAATGGGG + Intergenic
1164808389 19:31136893-31136915 GCTGGGAAGAAAACAAGATCTGG + Intergenic
1164906101 19:31969395-31969417 GGTCTTAAGAAGACAAACCCAGG + Intergenic
1164927644 19:32142890-32142912 GATGTTAAGAAAACAAAGGAAGG - Intergenic
1165046987 19:33112787-33112809 TTTGTTACTAAAACAAAATCTGG + Intronic
1165174524 19:33917887-33917909 GATATTTAGAAAACAAGATCTGG - Intergenic
1167110114 19:47455368-47455390 GCTGTGAAGAAAAATAAATCAGG - Intronic
1167855829 19:52238962-52238984 GGTATAAAGAAAGCAGAATCTGG + Intergenic
1168491286 19:56812348-56812370 GATGTTAACAAAACAAATTAAGG + Exonic
926555140 2:14348765-14348787 GGTGTTAAAAAGCCAAAATGTGG + Intergenic
926792714 2:16591382-16591404 GGTGTTCAGAAAATACAAACAGG + Intronic
926792858 2:16592842-16592864 GGTGTTCAGAAAATACAAACAGG - Intronic
927327128 2:21818113-21818135 TGTGGAAAGTAAACAAAATCAGG + Intergenic
927659143 2:24977498-24977520 GGTATTTAGAAACCAAGATCTGG + Intergenic
928276410 2:29904738-29904760 TGTGTTAAGGAAGCAGAATCTGG - Intronic
928970949 2:37028839-37028861 GGTGTTAATATAACAGAAACTGG - Exonic
928996023 2:37292147-37292169 GGGGTTTAGAAAAGAGAATCAGG - Intronic
929924926 2:46200145-46200167 AGTGTAAAGAAAGCAAAAGCTGG - Intergenic
930530738 2:52585201-52585223 AGTGCTAAGAAAAAAAATTCAGG - Intergenic
930721888 2:54645996-54646018 GCTGTTAATAAAGAAAAATCAGG + Exonic
930901932 2:56517730-56517752 GGTGTTATGAGAATAAAATGAGG - Intergenic
931297207 2:60938941-60938963 GGTATTTAGAAACCAAGATCTGG - Intergenic
931909614 2:66884346-66884368 GGTGCTAAGAATACAAAATGGGG - Intergenic
932537091 2:72610388-72610410 GGTATTTAGAAACCAAGATCTGG - Intronic
933289742 2:80424738-80424760 GGTGTTAAAAAACAAAAATTGGG - Intronic
933455938 2:82519137-82519159 AGAGATAAGAAAATAAAATCAGG + Intergenic
933563662 2:83921799-83921821 GGTATTTAGAAGCCAAAATCTGG - Intergenic
933673914 2:85036208-85036230 GCTGTTAAGACAGCAAAATTTGG - Intronic
934125373 2:88883419-88883441 GGTGTAAAGAGCACAAAATTAGG + Intergenic
934319926 2:91962828-91962850 TGTCTCAAGAAAAAAAAATCAGG - Intergenic
934844502 2:97654013-97654035 GGTATTTAGAAACCAAGATCTGG + Intergenic
934905507 2:98197886-98197908 GGTATTTAGAAACCAAGATCTGG + Intronic
935092882 2:99913608-99913630 GGTATTTAGAAACCAAGATCCGG - Intronic
935895338 2:107730847-107730869 GTTTTTAAGCAAACAAAATATGG - Intergenic
936416858 2:112323297-112323319 GGTGTTAGAAAATGAAAATCTGG - Intronic
936668951 2:114633048-114633070 CATATTTAGAAAACAAAATCTGG + Intronic
936677385 2:114731022-114731044 GATGTGAAGAACACAATATCGGG + Intronic
937274797 2:120677145-120677167 GGTGTTTAGAAATCAAGATCTGG - Intergenic
937522733 2:122732065-122732087 TGGGTTAAAAAAACAAAATATGG - Intergenic
938312680 2:130303246-130303268 GGCATAAAGAAAACAAAAACAGG - Intergenic
938932531 2:136099393-136099415 GAGGTTAAGAAAAATAAATCTGG + Intergenic
939347207 2:140981000-140981022 AGTGATAAGAAAACAATATTTGG - Intronic
939444798 2:142294989-142295011 GGTATTTAGAAATCAATATCTGG + Intergenic
941020765 2:160406541-160406563 CTTGTTGAGAAAACAAAAACAGG - Intronic
941640726 2:167985218-167985240 GGTGGTAAGAGAACAATATCAGG - Intronic
941689014 2:168479014-168479036 TGGGGGAAGAAAACAAAATCTGG - Intronic
942271088 2:174276095-174276117 GGTGTGAAGAAAAGGATATCTGG + Intergenic
942797074 2:179834234-179834256 GGTATTTAGAAACCAAAATCTGG - Intronic
943004332 2:182371294-182371316 TCTGTTAATAAAACAAAATTTGG - Intronic
943119899 2:183722826-183722848 GATTTTAGGAAAACAAAACCTGG + Intergenic
943438544 2:187897888-187897910 AGTGATAAGAAAAGAACATCTGG + Intergenic
943520005 2:188937270-188937292 GGTGTTGGGAAAACTGAATCTGG + Intergenic
943669378 2:190645299-190645321 GGTGTTAAAAATTCAGAATCTGG + Intergenic
944330104 2:198455539-198455561 GGTCTTAAGAAAGCAAGCTCAGG - Intronic
945469054 2:210206135-210206157 ACTGATAAGAAAAGAAAATCTGG + Intronic
946318928 2:218937075-218937097 GGTGTTTAGAAACTAAGATCTGG - Intergenic
947658823 2:231851368-231851390 AGGGGTAAGGAAACAAAATCAGG + Intergenic
947803347 2:232946620-232946642 GCTGTTTAGAAACCAAGATCTGG - Intronic
1169920307 20:10727827-10727849 GGTGTTGTGAAAACAGAATGGGG - Intergenic
1169947321 20:11003133-11003155 GATGTAAAGAATACAAAAACAGG - Intergenic
1170079768 20:12461256-12461278 GGTGTTGAGAATACACAATGGGG - Intergenic
1170177388 20:13487397-13487419 GGTGTGTAGAATACACAATCAGG - Intronic
1170215900 20:13890755-13890777 AGAATAAAGAAAACAAAATCTGG + Intronic
1172310444 20:33913804-33913826 GATGTGAAGAAAATAAAACCAGG - Intergenic
1172522111 20:35574278-35574300 GGTTTTTAGAAACCAAAATCTGG + Intergenic
1173182963 20:40818437-40818459 AGTGTTAAGGAAACAAACACTGG + Intergenic
1173697796 20:45035673-45035695 GGTGTTATGAATACAAAGACGGG - Intronic
1173748848 20:45459936-45459958 TGTATTAGAAAAACAAAATCTGG - Intergenic
1173990416 20:47298099-47298121 GCTGTGAAGAAAACAAATTCAGG - Intronic
1174514794 20:51083465-51083487 GGTGTAAAGAAAACTGAAGCAGG + Intergenic
1175369480 20:58478279-58478301 GGTGTTTAGAAACCAAGATCTGG + Intronic
1175528435 20:59653898-59653920 GGTATTTAGTACACAAAATCTGG - Intronic
1177282217 21:18995250-18995272 TGTGATAAGGAAACAAAATGTGG + Intergenic
1178137870 21:29648713-29648735 GCTATGAAGAAAACAAAAACAGG + Intronic
1178862063 21:36297832-36297854 GGGGCTAAGAAAAAAATATCAGG - Intergenic
1178877079 21:36421774-36421796 GGTATTAAGAAAACAGAGGCTGG - Intergenic
1178951202 21:36987214-36987236 GGTATTTAGAAAACAAGATATGG + Intronic
1179931100 21:44571531-44571553 GGCATTTAGAAACCAAAATCTGG - Intronic
1181373016 22:22432664-22432686 GGTGTCCAGAAAACAAAAGCAGG + Intergenic
1182316365 22:29449917-29449939 GTTGTTAAGAAAAGAAAAAAGGG + Intergenic
1183146933 22:36001756-36001778 TGTCTTAAGAAAAGAAAAACAGG + Intronic
1183692083 22:39396115-39396137 GATGTTAAGTCAACAAGATCTGG - Intergenic
1184054691 22:42037212-42037234 GGTGCTAAGAACACACAATCGGG - Intronic
1184629835 22:45768172-45768194 GGTATTAAGAAAGCACAATTTGG - Intronic
1184902141 22:47453050-47453072 GCTGCAAAGACAACAAAATCAGG - Intergenic
949723821 3:7021046-7021068 TGTGTATAGAAAACATAATCTGG - Intronic
949762210 3:7483264-7483286 GCTGTGAGGAAAACAAAATAAGG + Intronic
950152743 3:10700564-10700586 GGTATTACGAACACAAAATGGGG - Intronic
950169894 3:10831184-10831206 GTTGTTTAGAAAAAAAAATGGGG - Intronic
951021499 3:17785724-17785746 GGTGTCAAGAACACACAATGGGG - Intronic
951062740 3:18228729-18228751 GGTGTTAAGAACAAAAACTGAGG - Intronic
951907139 3:27716519-27716541 GGGGTTAAGGAATCAAAGTCAGG + Exonic
952018083 3:28983816-28983838 GGTGATACGTAAAGAAAATCAGG + Intergenic
952465508 3:33580713-33580735 TGTGTTAAAGAAAAAAAATCTGG + Intronic
952528218 3:34235881-34235903 TGTGTTAAAAAAAAAAAAGCAGG - Intergenic
952645395 3:35651562-35651584 TTGGTTAAGAAAAGAAAATCTGG + Intronic
952950222 3:38517491-38517513 GATGTTTAGAAACCAAGATCTGG + Intronic
953095665 3:39773127-39773149 GGTATTTAGAAACCAAGATCTGG - Intergenic
953501270 3:43437099-43437121 GCTCTTAAGAAAACAACCTCAGG + Intronic
953648672 3:44779327-44779349 GGTATTTAGAAACCAAGATCTGG + Intronic
953738000 3:45512940-45512962 AGTGATAAGAAAATAAATTCAGG - Intronic
953811839 3:46119467-46119489 GCTGATGAGAATACAAAATCTGG + Intergenic
954702788 3:52459878-52459900 GAGGTTAAAAAAAAAAAATCAGG + Intronic
955245021 3:57217157-57217179 GGTGTTTAGAGGGCAAAATCTGG + Intronic
955550290 3:60077377-60077399 GGTATTTAGAAACCAAGATCTGG - Intronic
955647139 3:61151881-61151903 GGATTTAAGAAAAGAATATCAGG - Intronic
955987174 3:64585866-64585888 GGGGATAAGCAAAGAAAATCAGG - Intronic
956660239 3:71590412-71590434 GGTATTTAGAAACCAAGATCTGG - Intergenic
956889315 3:73595966-73595988 AGTGTTTAGAAACCAAAATATGG - Intronic
957539877 3:81554040-81554062 TGTATTAAGAAAATAATATCTGG - Intronic
957713075 3:83889305-83889327 GGTCTTAAGAAAAAAACATATGG + Intergenic
958848958 3:99299423-99299445 GGTGTTAAAAAATCCAAATTTGG - Intergenic
958921910 3:100116540-100116562 GGTATTTAGAAACCAAGATCTGG + Intronic
959790649 3:110357319-110357341 GCTGTTTAGAAACCAAGATCTGG - Intergenic
960095567 3:113686453-113686475 TGTACAAAGAAAACAAAATCAGG - Intronic
960877338 3:122310198-122310220 GGTTTTAAAAAAACAAGAGCAGG + Intergenic
961070806 3:123924168-123924190 GGTGACAAGAAAACAAAATGGGG + Intronic
961099251 3:124184760-124184782 GATGATAAGAATACAAAATTTGG - Intronic
961570628 3:127795984-127796006 GATGTTAAGGAATCAAAAGCAGG - Intronic
961834966 3:129650164-129650186 GGTGTTAACAAAATAAATTAAGG + Exonic
962175352 3:133148137-133148159 GATATTCAGAAACCAAAATCTGG - Intronic
962238989 3:133734255-133734277 GGTATTTAGAAAGCAAATTCTGG - Intergenic
962536258 3:136331736-136331758 GATACTAAGAAAACAAAAACAGG - Intronic
962910580 3:139845609-139845631 GGTGCTAGGAAAACAAAAATTGG - Intergenic
963231354 3:142911451-142911473 GGAGCTAAGAAACCAAAGTCTGG - Intergenic
963945152 3:151137473-151137495 GGTATTTAGAAAGCAAGATCTGG + Intronic
964186954 3:153957232-153957254 GCTGCTGAGAAAACAAATTCTGG + Intergenic
965718335 3:171631517-171631539 GGTATTTATAAAGCAAAATCTGG - Intronic
966141635 3:176764002-176764024 GGTATTTAGAAATCAAAATCTGG - Intergenic
966504741 3:180686931-180686953 GGTGTTTAGAAACCAAGATCTGG + Intronic
967019819 3:185512910-185512932 GGTGTTAAGAAAACAAAATCTGG - Intronic
967379509 3:188841659-188841681 GTAGTTAAGAAAACAAATTCAGG - Intronic
967433267 3:189414022-189414044 GGTCTCAAGAAAACACAATCAGG - Intergenic
967585659 3:191211620-191211642 GGTTTTAGGAAAAAAAATTCTGG - Intronic
967791359 3:193552270-193552292 GGAGTTAAAAAACCAAAAACAGG - Intronic
968476772 4:814215-814237 CGTCTTAAAAAAAAAAAATCAGG - Intronic
968490753 4:889440-889462 GGTGTTAAAAAAAAAACACCTGG + Intronic
969479287 4:7439049-7439071 GGTGTTTAGAAACCAAGATCTGG + Intronic
969723016 4:8903634-8903656 GGTGATTAGAAACCAAGATCTGG + Intergenic
969827712 4:9771088-9771110 GGTGTTTATAAACCACAATCTGG + Intergenic
970382509 4:15522246-15522268 AATGTTAAGAAAACAAAAGTTGG + Intronic
971074067 4:23127767-23127789 GGGCATTAGAAAACAAAATCAGG + Intergenic
971109765 4:23572352-23572374 GGTGTTAAGATTTCAACATCTGG - Intergenic
971633389 4:29025279-29025301 GGTGGTAAGACAACAAGATTCGG + Intergenic
971679651 4:29680222-29680244 GGTTTTAAGAAAGCAAAGGCAGG + Intergenic
971928523 4:33047618-33047640 GGTATTAAGAAAACAGGATCTGG - Intergenic
972245437 4:37242313-37242335 TGTGCTAAGAAATCAATATCTGG + Intergenic
972308067 4:37851400-37851422 GGTGTAAAGAATGCAAACTCAGG - Intronic
972436035 4:39036393-39036415 GGTGTCCTGAAAAAAAAATCGGG + Intergenic
973019029 4:45177102-45177124 GGTGTCAAGAAGACATAATAAGG + Intergenic
974217590 4:58871486-58871508 GGTATTTAGAAAACAGACTCTGG - Intergenic
974291896 4:59943883-59943905 GCTGTTTAGAAACCAAGATCTGG + Intergenic
974501478 4:62710088-62710110 GTTGTTTGGAAAAAAAAATCTGG + Intergenic
974652636 4:64775268-64775290 GGAGTTAAGAACACTAAATGTGG + Intergenic
974896534 4:67946721-67946743 TGTGTTAAAAAAAAAAAATCAGG + Intronic
975021280 4:69492957-69492979 AGAGTTAAGAAAAGAAAATATGG - Intronic
975120659 4:70725149-70725171 GGTTTTAAGAAAATAAAATATGG - Intronic
975133152 4:70848122-70848144 CGTATTAAAAAAAAAAAATCAGG - Intergenic
975273648 4:72468333-72468355 AGTCTTAAGAAAAATAAATCAGG + Intronic
975631094 4:76403109-76403131 GCTGTTTATAAAACAAAATGGGG - Intronic
975743124 4:77449928-77449950 GCTGTTAAGAAACCAAGATCTGG + Intergenic
975893415 4:79056566-79056588 GGTTTAAAGAAAAAAAAATGAGG - Intergenic
976501818 4:85799183-85799205 GATGTTTAGAAACCAAAATCTGG - Intronic
977183586 4:93908407-93908429 GAGGTTAAGAAAACAGATTCTGG - Intergenic
977342872 4:95781845-95781867 GATGTTAAATAAACAAAATAAGG - Intergenic
977483681 4:97613924-97613946 GGTATTTAGAAAATAAGATCTGG + Intronic
979353789 4:119677722-119677744 GCTGTAAAAAAAACTAAATCAGG + Intergenic
979721194 4:123902352-123902374 GGTGTTAATAAAACAAGTTAAGG + Intergenic
979725985 4:123961892-123961914 GGTGTTAAAAGAATAAACTCTGG - Intergenic
980035426 4:127877976-127877998 GGTGCTTAAAAAACAATATCTGG - Intergenic
980442303 4:132865201-132865223 TTTGTTAAGATAACAAAAGCTGG - Intergenic
980756254 4:137166230-137166252 GGTGTTTAGAAATTAAAATATGG - Intergenic
981154626 4:141419274-141419296 GGTGCTAAGAACATAAAATGGGG - Intergenic
981248183 4:142565159-142565181 GGTATTTAGAAACCAAAGTCTGG - Intronic
981509155 4:145536296-145536318 AGTATTTAGAAACCAAAATCTGG - Intronic
981669334 4:147268965-147268987 GATGTTAAGAACACACAATAGGG - Intergenic
981764073 4:148227960-148227982 GGTATTAAGAAGTCAAGATCTGG + Intronic
982378873 4:154726346-154726368 GGTATTTAGAAATAAAAATCTGG - Intronic
982461856 4:155679853-155679875 GGTGTCAAGGCAATAAAATCAGG - Intronic
982548950 4:156772639-156772661 GCTGTTAAGAAAATTAAATGAGG + Intronic
983021850 4:162686272-162686294 CTTGTTTATAAAACAAAATCTGG + Intergenic
983090149 4:163493787-163493809 TGTGAGAAGAAAACAAAAACTGG + Intergenic
983433329 4:167679180-167679202 GGTATAAAGAAAATAAATTCTGG - Intergenic
984035335 4:174661071-174661093 GGTTTTTAGAAACCAAGATCTGG + Intronic
986097336 5:4572375-4572397 GGTACTTAGAAAACAAGATCTGG - Intergenic
986243802 5:5986439-5986461 GGTGTTTAGAAGCCAAAATGAGG + Intergenic
986729011 5:10621278-10621300 GGTATTTAGAAACCAAAATCTGG + Intronic
988029749 5:25748606-25748628 GGTATTTAGAAACCAAAATATGG - Intergenic
988291331 5:29291708-29291730 GGTGTCAAGAAAACTCAATGGGG + Intergenic
988676047 5:33434179-33434201 GGAGGGAAGAAAACAAAATCAGG - Intergenic
988946607 5:36208708-36208730 GGAGAAAAGAAAACAAAATTGGG + Intronic
989198618 5:38740876-38740898 GGTATTAAGAAACCAAGATCTGG + Intergenic
989395884 5:40956087-40956109 GGGCTTAAGGAAAAAAAATCAGG + Intronic
990027354 5:51210526-51210548 GGTATTAAGAAAATGAAATAAGG - Intergenic
990073549 5:51815316-51815338 ATTTTTAAAAAAACAAAATCAGG - Intergenic
990807399 5:59681058-59681080 GGTTTTTAGAAATCAAAATTTGG - Intronic
990926215 5:61027334-61027356 GGTGTTAAATAAGCATAATCAGG + Intronic
991112430 5:62916112-62916134 GCTGTGAAGAAAATAAAATAGGG + Intergenic
991512091 5:67389795-67389817 GATGTGAAGAATACAAAATGGGG - Intergenic
991553683 5:67871539-67871561 GTTGTGAAGAAAATAAAATTTGG + Intergenic
992133058 5:73714373-73714395 GGTGTGAAGAAAAATAAAACTGG + Intronic
992139506 5:73781645-73781667 GGTTTTGAAAACACAAAATCAGG - Intronic
993336640 5:86667736-86667758 GATGTTAAGAATACAAAAAATGG - Intergenic
993726171 5:91368797-91368819 TGTTTTAAGAAAACAATATGTGG - Exonic
994020949 5:95025294-95025316 GGTGTCAAGAATACACAATGGGG + Intronic
994036298 5:95205217-95205239 GGTGCCAAGAAAATAAAATGGGG + Intronic
994047309 5:95324755-95324777 GTTGTTAAAAACACAGAATCTGG - Intergenic
994252960 5:97558441-97558463 GGTGATAAGAAAACAAGAGCTGG + Intergenic
996940273 5:128996324-128996346 GCTTTTAAGAAAACAAAATAAGG - Intronic
997112072 5:131086339-131086361 GGTGTCAAGAACACACAATGGGG - Intergenic
997170967 5:131720226-131720248 GGTGCTAAGAATACACAATGGGG + Intronic
997313215 5:132908038-132908060 GGAGTTAAGGATACAAAATGAGG + Intronic
997466018 5:134088572-134088594 AGGGTTAAGAAAACAAAAACAGG - Intergenic
998096391 5:139397856-139397878 AGTGTTAAGAAAAATAAAGCAGG - Intronic
998420371 5:141979728-141979750 TGTCTTAAAAAAAAAAAATCAGG + Intronic
998489621 5:142535159-142535181 GGTATTTAGATACCAAAATCAGG - Intergenic
999809756 5:155116362-155116384 GATTTTAAGAAAAAAAAAACAGG - Intergenic
1001456917 5:171870035-171870057 GGAGATAAGAAAACAACTTCAGG + Intronic
1001532879 5:172476941-172476963 GGTCTTTAGAAACCAAGATCTGG - Intergenic
1001584354 5:172823200-172823222 GGTATTAAGAAACCACGATCTGG + Intergenic
1002659912 5:180784577-180784599 GGTTTTTAAAAATCAAAATCTGG - Intergenic
1003342814 6:5238126-5238148 TGTGTTAAGTAAGAAAAATCAGG - Intronic
1003423971 6:5984195-5984217 GCTGTAAATGAAACAAAATCAGG + Intergenic
1004129698 6:12907773-12907795 GGTGTTAAGAAGATAGAATTGGG + Intronic
1005087092 6:22018231-22018253 GGTGTTAAGTGATTAAAATCAGG + Intergenic
1005294036 6:24406470-24406492 TTAGTTAAGAATACAAAATCAGG + Intronic
1005848702 6:29802347-29802369 GGTGGAACAAAAACAAAATCTGG - Intergenic
1005868896 6:29958494-29958516 GGTGGAACAAAAACAAAATCTGG - Intergenic
1007762853 6:44143758-44143780 GGTGCTAAGAAAACCACAGCAGG + Intronic
1008461136 6:51773883-51773905 GAAGATAAGAAAACTAAATCAGG + Intronic
1008528820 6:52435237-52435259 GGGGGTAAGAAGACAAAATTGGG - Intronic
1009678782 6:66863539-66863561 GATGTTAAGAAAATACAATGGGG - Intergenic
1009729564 6:67582559-67582581 GATGTTAAAAAAAAAAAAGCTGG - Intergenic
1010243376 6:73638852-73638874 GGTTTTAAGACAACAAGATAAGG + Intronic
1010266076 6:73869350-73869372 GGTATTTAGAAAACAAGATCTGG + Intergenic
1010409840 6:75548751-75548773 GTTTTTAAGAAAAAAAAATATGG + Intergenic
1011231869 6:85170965-85170987 GTGCTTAAGAACACAAAATCTGG - Intergenic
1011500797 6:87987254-87987276 GGTGCTAAGAACACATAATGGGG + Intergenic
1011710622 6:90049309-90049331 AGTGTTATAAAAACAAAATAGGG + Intronic
1012197741 6:96365372-96365394 GGTGCTAAGAACACATAATAGGG + Intergenic
1012479013 6:99647366-99647388 GGTGTCAAGACTACAACATCAGG - Intergenic
1012536381 6:100302798-100302820 TGTTTTAAGACAACAAAATTAGG + Intergenic
1012792536 6:103715095-103715117 GCTGTTAAGAAAAAAAAAAATGG + Intergenic
1013145752 6:107389779-107389801 GGTATTTAGAAACCAATATCTGG - Intronic
1013555500 6:111252864-111252886 GGAATTAATAAAACAAAAGCTGG + Intergenic
1013593849 6:111644172-111644194 GGTTTTAAGAAAACCAAACGAGG + Intergenic
1014127443 6:117793352-117793374 GGTATTAAGAAAACAGCCTCAGG - Intergenic
1014200053 6:118599147-118599169 GGTATTCAGAAACCAAGATCTGG - Intronic
1014652573 6:124058627-124058649 GGTGGTCAGAAAACAACAACTGG + Intronic
1014783825 6:125595179-125595201 GGTGTTCATAAACCAAATTCGGG - Intergenic
1015479773 6:133695465-133695487 GGTGTTTAGAAACCAATAACTGG + Intergenic
1015798817 6:137040404-137040426 GGTGTTTAGAAACCAAAATCTGG - Intronic
1016125385 6:140395952-140395974 GGGGTTAAGAAAACAGAATATGG - Intergenic
1016455621 6:144227559-144227581 GGTATTTAGAAACCAAAATCTGG + Intergenic
1016770433 6:147843720-147843742 GGTGCCAAGAAAACAAAATGGGG + Intergenic
1017401512 6:154069767-154069789 GGTGCTAAGTAAACACAATGGGG - Intronic
1018482762 6:164208251-164208273 GGTGATAAGAAAAGAAAAATAGG - Intergenic
1018749887 6:166795159-166795181 GGTATTAATAAAGCAAAACCTGG + Intronic
1020196866 7:6047246-6047268 CCTATGAAGAAAACAAAATCAGG + Intronic
1020362723 7:7347046-7347068 GGTATTAAGAAATGAAAGTCAGG - Intergenic
1020441862 7:8225543-8225565 GGTATTTAGAAAGCAAGATCTGG + Intronic
1020649012 7:10852543-10852565 GATGTTTAGAAAATAAGATCTGG - Intergenic
1020769697 7:12373607-12373629 GCTGTGAAGAAAACTAAATTGGG - Intronic
1020919760 7:14248114-14248136 GGTGCCAAGAACACATAATCAGG - Intronic
1021288206 7:18809067-18809089 GGTATCAAGAATACAAAATGGGG + Intronic
1021666637 7:22988509-22988531 GGTATTTGGAAAACAAGATCTGG + Intronic
1021944327 7:25710979-25711001 AATGTTTAGAAACCAAAATCTGG + Intergenic
1022779913 7:33569928-33569950 GGTAATTAGAAACCAAAATCTGG - Intronic
1023288010 7:38639019-38639041 GGTATTTAGAAACCAAGATCTGG + Intergenic
1023561714 7:41480793-41480815 GGTATTTAGAAACCAAAATCTGG - Intergenic
1023673003 7:42599367-42599389 GGTGTTAAAGAAATAAAATAGGG + Intergenic
1023896663 7:44439447-44439469 GGTATTTAGAAACCAAGATCTGG - Intronic
1023927398 7:44679634-44679656 GGTGTTTAGCAAAAAAAACCTGG - Intronic
1024132377 7:46367365-46367387 GGTATTTAGAAATCAAGATCTGG + Intergenic
1024425907 7:49226376-49226398 AGGTTTTAGAAAACAAAATCAGG + Intergenic
1024605175 7:51017038-51017060 GGTAGTAAGAAAAAAAAATTGGG - Exonic
1024781095 7:52848917-52848939 GGTATTTAGAAACCAATATCTGG + Intergenic
1024824440 7:53374521-53374543 GGCATTTAGAAACCAAAATCCGG + Intergenic
1024881380 7:54089225-54089247 GGTGCTAAGAATACACAATAGGG - Intergenic
1025650610 7:63465042-63465064 CGTCTTAAGAAAAAAAAATGTGG - Intergenic
1025736102 7:64148204-64148226 TATCTTAAGAAAACAAAACCTGG - Intronic
1025914722 7:65856482-65856504 GGTATTAAGAAAAAAAAAAAAGG + Intergenic
1026108801 7:67442195-67442217 GGGGTTAAGAAGACAGACTCTGG - Intergenic
1026276741 7:68885537-68885559 GGCATTTAGAAACCAAAATCCGG - Intergenic
1027713943 7:81645046-81645068 GTTGAAAAAAAAACAAAATCTGG + Intergenic
1028057061 7:86258795-86258817 GGTGCTAAGAATACATAATAGGG + Intergenic
1028672322 7:93416723-93416745 GATGTGAAGAAAACACAATGTGG - Intergenic
1028914917 7:96248278-96248300 AGTGGTAAGAAAATAAATTCGGG - Intronic
1029165228 7:98584276-98584298 AGTATTTAGAAACCAAAATCTGG + Intergenic
1030437154 7:109537114-109537136 GGTGTTTGGAAACCAATATCTGG - Intergenic
1030471594 7:109970615-109970637 GGTGCTAAGAGAACACACTCTGG + Intergenic
1030886005 7:114938254-114938276 ACTATTAAGAATACAAAATCTGG - Intronic
1031819410 7:126480854-126480876 GGTATTTAGAAATCAAAATCTGG - Intronic
1032272423 7:130422391-130422413 GGAGTTAAGAAAACAGAAAAGGG - Intronic
1032864586 7:135913274-135913296 GATGTTCAGAAACCAAGATCAGG + Intergenic
1032910551 7:136424463-136424485 AGAGTGAACAAAACAAAATCAGG - Intergenic
1032936356 7:136736857-136736879 GGTGTTCAGAAACCAAGATTTGG + Intergenic
1033297662 7:140155598-140155620 CTAGTTAAGAAAACAAAATTAGG + Intronic
1033446503 7:141427431-141427453 GGTGTCAAGAACACACAATAGGG + Intronic
1033534138 7:142296696-142296718 GGTATTTAGAAAACAGAATATGG - Intergenic
1033820923 7:145133348-145133370 GGTATTGAGAAACCAAGATCTGG + Intergenic
1035076957 7:156185986-156186008 AGGGTTAAGCAAACAAAATTGGG - Intergenic
1036530247 8:9578355-9578377 GGTATTTAAAAAACAAAACCAGG + Intronic
1037021182 8:13973237-13973259 GGAGGAAAAAAAACAAAATCTGG - Intergenic
1037295935 8:17400403-17400425 GTTGTTAAGAACACACACTCTGG - Intronic
1037572223 8:20167921-20167943 GGTGTTTAGAAACCAAACTATGG - Intronic
1039202612 8:35113108-35113130 GGTTCTGAGAAAATAAAATCAGG + Intergenic
1040973117 8:53159081-53159103 GGTGCCAAGAAAACAGAATGGGG - Intergenic
1041764429 8:61403530-61403552 GGTGGGAAGACAACAAATTCCGG + Intronic
1041832865 8:62176550-62176572 GGTGTCAAGAACACACAATGGGG + Intergenic
1041899446 8:62964948-62964970 GGTGTTATGAAAGCAAGAGCAGG + Intronic
1042400242 8:68336702-68336724 GGTATTTAGAAACCAAAATGTGG - Intronic
1042467517 8:69144789-69144811 GCTTTAAAGAAAACAACATCGGG + Intergenic
1042639848 8:70921823-70921845 GGTGTTAAGAAAACAAAATTTGG - Intergenic
1043371742 8:79602391-79602413 GGTATTTCAAAAACAAAATCTGG + Intergenic
1043432019 8:80204451-80204473 GGTATTTAGAAACCAAGATCTGG - Intronic
1043853475 8:85240045-85240067 GGTGTTTAGGAAACAAGATCTGG + Intronic
1044367164 8:91361555-91361577 AGTGTTAAGAAAATATAACCTGG + Intronic
1045171286 8:99671889-99671911 GGTGTCAAGAACACAAAATGGGG - Intronic
1045175034 8:99713702-99713724 GGTATCTAGAAACCAAAATCTGG - Intronic
1045529471 8:102970748-102970770 GGTGCTATTAAAACAAAATCTGG - Intronic
1045692581 8:104774776-104774798 TGAGTTAAAAAAAAAAAATCTGG + Intronic
1045965996 8:108025216-108025238 GGTATTTAGAAAACAAAATCTGG - Intronic
1046532753 8:115469342-115469364 GGTGCTAAGAAGACAGAACCTGG + Intronic
1046842149 8:118871299-118871321 TGTTTTGAGAAAAAAAAATCAGG + Intergenic
1046895929 8:119473374-119473396 GGTATTTTGAAACCAAAATCTGG - Intergenic
1047183844 8:122614375-122614397 GTTATGAAGAAAACAAAATAGGG - Intergenic
1047467387 8:125130575-125130597 GGTATTGAGAAACCAAGATCTGG + Intronic
1048226843 8:132595922-132595944 GGTGTTAAGAAACTGAATTCAGG + Intronic
1048341445 8:133542204-133542226 GGTGTTTAGAAACCAAGATCTGG - Intronic
1049805945 8:144539107-144539129 GGTATTTAGAAACCAAGATCTGG + Intronic
1049864684 8:144926857-144926879 AGTTTTTAGAAAACAAGATCTGG - Intergenic
1050703229 9:8365104-8365126 TGAGTTGAGAAAACAAAATTAGG - Intronic
1050981437 9:12020790-12020812 GCTGATTAGAAAAAAAAATCTGG - Intergenic
1051471947 9:17453496-17453518 GGTGTTGATTAAAAAAAATCAGG + Intronic
1051939398 9:22486961-22486983 GGTGTTAAGAGGTCAAAAGCGGG + Intergenic
1052308725 9:27040673-27040695 GGTCAACAGAAAACAAAATCAGG - Intronic
1052961838 9:34304890-34304912 GGTAGGAAGAAAAAAAAATCTGG - Intronic
1053234867 9:36444281-36444303 GGTTTCAAGAAAAAAAAATGAGG + Intronic
1053930147 9:43109333-43109355 GTGATTAAGAAAAAAAAATCTGG + Intergenic
1055972071 9:81921447-81921469 GGCTTTAAGAGAACAAAATTGGG + Intergenic
1055973824 9:81936519-81936541 GGCTTTAAGAGAACAAAATTGGG + Intergenic
1056070953 9:82986011-82986033 GGGGTTAAAAATACAAAAACTGG + Intronic
1056510524 9:87300297-87300319 GTTGTTAAGAAAACAACAACAGG - Intergenic
1057850269 9:98561349-98561371 TGTGTTAAGAAACCAACATTTGG - Intronic
1057876449 9:98758474-98758496 GGTATTTAGAAACCAAAATCTGG + Intronic
1058760231 9:108123464-108123486 GGTGTTAAAATAATAAAATCTGG - Intergenic
1059088503 9:111331187-111331209 GGTGTTTAGAAACTAATATCTGG - Intergenic
1059584272 9:115589260-115589282 ATTGTTCAGAGAACAAAATCAGG + Intergenic
1059975685 9:119714399-119714421 GGTGCCAAGAAAACACAATGTGG + Intergenic
1060385429 9:123222407-123222429 GGTATTAAAAAAACAATATATGG + Intronic
1060444283 9:123673564-123673586 GGTATTTAGAAACCAAGATCTGG + Intronic
1060648152 9:125300142-125300164 GGTATTAAGACAATAAAATGTGG - Intronic
1061026104 9:128050829-128050851 TGTCTTAAGAAAAAAAAATTCGG + Intergenic
1061600222 9:131664302-131664324 GGTATTTAGAAACCAAGATCGGG + Intronic
1061653713 9:132071116-132071138 GGTGTTATGAGGACAAAATGAGG - Intronic
1203735178 Un_GL000216v2:130748-130770 GGTCTTAAGAAAAAAAAAAAAGG - Intergenic
1185765654 X:2723899-2723921 ACTGTAAAGAAAACAAAATGAGG + Intronic
1185838958 X:3370756-3370778 TCTGCTAAGTAAACAAAATCCGG - Intergenic
1185922668 X:4111531-4111553 GGTGTTAAAAAAAGAAAATTTGG + Intergenic
1186400539 X:9254894-9254916 GGGATTTAGAAAACAAGATCTGG - Intergenic
1186444626 X:9616610-9616632 CGTGTTATTAAAAGAAAATCAGG - Intronic
1186471227 X:9823596-9823618 TGTGCTAGGAAAACAGAATCAGG + Intronic
1186561876 X:10621385-10621407 GGAGTTAAGAAAGCAAACTTTGG - Intronic
1186831548 X:13395315-13395337 AGTGTGAAGAAAACAAAAAAGGG + Intergenic
1187041039 X:15596272-15596294 GTTGTTAAGAAAATCAAATGAGG - Intronic
1187622414 X:21072726-21072748 GGTGTTAAGAGTAAAAAATAAGG + Intergenic
1187782886 X:22848462-22848484 TCTGGTAAAAAAACAAAATCTGG + Intergenic
1187864333 X:23710290-23710312 GGTATTTAGACATCAAAATCTGG - Intronic
1188219177 X:27518947-27518969 GGTGCATAAAAAACAAAATCAGG - Intergenic
1188224732 X:27583415-27583437 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1188228152 X:27627592-27627614 TGTGTTAAGAATACATAATATGG + Intronic
1188321457 X:28743202-28743224 AGTGGGAAGAAAACAAAATTGGG - Intronic
1188398066 X:29709410-29709432 GGTGCTAAGAAAACACAATGGGG - Intronic
1188796087 X:34467631-34467653 GGTATTTAGAAACCAAGATCTGG - Intergenic
1188834460 X:34939584-34939606 GGTATTTAGAAACCAAGATCTGG + Intergenic
1189041687 X:37548189-37548211 GGTATTTAGAAACCAAGATCTGG - Intronic
1189454729 X:41175637-41175659 GGTGTTTAGAAACCAAGATCTGG + Intronic
1189961853 X:46332029-46332051 GGTATTTAGAAACCAAGATCTGG + Intergenic
1190171070 X:48112261-48112283 GCTGTTAATGAAACAAACTCTGG - Intergenic
1190177170 X:48159994-48160016 GCTGTTAATGAAACAAACTCAGG - Intergenic
1190181074 X:48193200-48193222 GCTGTTAATGAAACAAACTCTGG + Intronic
1190194110 X:48302683-48302705 GCTGTTAATGAAACAAACTCTGG + Intergenic
1190203907 X:48386365-48386387 GCTGTTAATGAAACAAACTCTGG - Intronic
1190206629 X:48409038-48409060 GCTGTTAATGAAACAAACTCTGG + Intronic
1190459346 X:50656515-50656537 GGTGTCAAGAACACATAATGGGG - Intronic
1190655585 X:52609617-52609639 GCTGTTAATGAAACAAACTCTGG + Intergenic
1190666779 X:52703553-52703575 GCTGTTAATGAAACAAACTCTGG + Intronic
1190672639 X:52754855-52754877 GCTGTTAATGAAACAAACTCTGG - Intronic
1192009096 X:67249148-67249170 GATGTTAGGCAAAAAAAATCAGG + Intergenic
1192625550 X:72723635-72723657 GGTGTTTGGAAATAAAAATCTGG + Intergenic
1193109498 X:77713376-77713398 AGTGTTTAGAAATCAAGATCAGG - Intronic
1193476045 X:81967189-81967211 GGTGTTAAGGATAGAAAGTCAGG + Intergenic
1193524162 X:82568042-82568064 GGTGTCAAGAAAACATACTGGGG - Intergenic
1193964478 X:87968271-87968293 GCTGTAAAGAAAAAAAAATAGGG - Intergenic
1194609710 X:96027236-96027258 GCTGTTAAGAGAACAAAATTAGG + Intergenic
1194700160 X:97104367-97104389 GCTCTTAAAAAAAAAAAATCAGG - Intronic
1194712437 X:97251945-97251967 GGGGTTCAGAACACAATATCTGG - Intronic
1194789895 X:98134844-98134866 GGTATTTAGAAACCAAGATCTGG - Intergenic
1194831473 X:98627976-98627998 GGTGATAAAAGAAAAAAATCAGG + Intergenic
1195039538 X:101001535-101001557 GGTGTTTAGAAACCAAGATCCGG - Intergenic
1195306650 X:103589621-103589643 GGTGTTAGAAAAACAAGATCTGG + Intergenic
1195745935 X:108118327-108118349 GCTGTTATGAAAAAAAAAGCTGG - Intronic
1196388564 X:115186398-115186420 GGTATTAAGAAACCAGATTCTGG - Intronic
1196410101 X:115409512-115409534 AGAGTTAAAAAAACAAAATTTGG - Intergenic
1197836567 X:130700435-130700457 GTCGTTAAGAAAACAAGATGTGG + Intronic
1197875938 X:131106409-131106431 GGTGCCAAGAATACAAAATGAGG - Intergenic
1197895770 X:131312879-131312901 AGTGTTTAGAAACCAAGATCTGG - Intronic
1198065397 X:133091482-133091504 GGTGTTAAAAAGTCAAAATCAGG + Intronic
1198592286 X:138197598-138197620 GGTGTCAAGAATACACAATGGGG - Intergenic
1199260121 X:145763002-145763024 GGTGTTAAGATCACATAATGAGG + Intergenic
1199342760 X:146701121-146701143 GATGTTAAAAAAATAAAAGCAGG - Intergenic
1199588599 X:149442933-149442955 GGTATTTTGAAATCAAAATCTGG - Intergenic
1199689285 X:150295717-150295739 GGTATTTAGAAATCAAGATCTGG + Intergenic
1201785611 Y:17774701-17774723 GGTGGCAAGAAAACCAAATGAGG + Intergenic
1201815942 Y:18131287-18131309 GGTGGCAAGAAAACCAAATGAGG - Intergenic
1202365000 Y:24153907-24153929 GGTGAAGAGTAAACAAAATCAGG + Intergenic
1202505781 Y:25516215-25516237 GGTGAAGAGTAAACAAAATCAGG - Intergenic