ID: 967020969

View in Genome Browser
Species Human (GRCh38)
Location 3:185522291-185522313
Sequence CAACAACACTTCAGTAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967020969_967020974 11 Left 967020969 3:185522291-185522313 CCCTCATTACTGAAGTGTTGTTG 0: 1
1: 0
2: 1
3: 18
4: 180
Right 967020974 3:185522325-185522347 TGCCGTAAGGGTCATTCTCAGGG 0: 1
1: 1
2: 5
3: 5
4: 64
967020969_967020973 10 Left 967020969 3:185522291-185522313 CCCTCATTACTGAAGTGTTGTTG 0: 1
1: 0
2: 1
3: 18
4: 180
Right 967020973 3:185522324-185522346 CTGCCGTAAGGGTCATTCTCAGG 0: 1
1: 1
2: 4
3: 8
4: 59
967020969_967020972 -1 Left 967020969 3:185522291-185522313 CCCTCATTACTGAAGTGTTGTTG 0: 1
1: 0
2: 1
3: 18
4: 180
Right 967020972 3:185522313-185522335 GTCAGCTGTGTCTGCCGTAAGGG 0: 1
1: 0
2: 0
3: 23
4: 137
967020969_967020971 -2 Left 967020969 3:185522291-185522313 CCCTCATTACTGAAGTGTTGTTG 0: 1
1: 0
2: 1
3: 18
4: 180
Right 967020971 3:185522312-185522334 TGTCAGCTGTGTCTGCCGTAAGG 0: 1
1: 0
2: 2
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967020969 Original CRISPR CAACAACACTTCAGTAATGA GGG (reversed) Intronic
903859959 1:26358911-26358933 CAACAAAGCTTCAGAAATGTGGG + Intergenic
905981946 1:42236843-42236865 CAACCACACATCAGTAGAGAGGG - Intronic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
906431005 1:45755812-45755834 CCACAACACTTGAGTAAAAAAGG - Intergenic
909065182 1:70927615-70927637 CATCAACACATCAGTAACTAAGG + Intronic
909530460 1:76676111-76676133 CAAAAATCCTTCAGTGATGAAGG + Intergenic
909598864 1:77440218-77440240 AAACTACCCTTCAGAAATGAGGG - Intronic
912991119 1:114487424-114487446 CAAATACCCTTCAGGAATGAAGG + Intronic
915791490 1:158676735-158676757 CAAGAAAATTTCAGTAATGCTGG + Intronic
916540254 1:165746716-165746738 CAACGATACTGCAGTAAAGATGG - Intronic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
918176413 1:182050013-182050035 ACACAAAACATCAGTAATGAGGG + Intergenic
918545211 1:185674610-185674632 TCACAACTCTTCAGGAATGAAGG + Intergenic
921341064 1:214135180-214135202 CAAAAGCAATTCAGTAAGGAAGG - Intergenic
922061329 1:222095462-222095484 AAACAACACTTCAGTAGTAAAGG + Intergenic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
924316919 1:242807658-242807680 CAACCACACTTCGGTAATCAGGG + Intergenic
1063018273 10:2100274-2100296 CAACATCATTTCAGGAATGAAGG - Intergenic
1063739328 10:8799819-8799841 CCAAAACACTTCAGTCATCATGG - Intergenic
1067023440 10:42822163-42822185 CAAGAACACTTCATTTATTAAGG + Exonic
1068069514 10:52179326-52179348 AAACTATCCTTCAGTAATGAAGG - Intronic
1068105062 10:52604654-52604676 TAACCACTCTTCAGTAATAAAGG - Intergenic
1070316177 10:75314797-75314819 AAACTATACTTCAGAAATGAAGG + Intergenic
1070706654 10:78644075-78644097 CAACACCACATCAGTTTTGATGG - Intergenic
1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG + Intronic
1072103013 10:92247161-92247183 AAACAACATTTCAGTAGAGAAGG - Intronic
1073311645 10:102546966-102546988 CAGCACCACTTCACTAAGGAGGG - Intronic
1077255175 11:1578295-1578317 CAACAACACATCAGAAATTGTGG - Intergenic
1086457141 11:86970171-86970193 CAAAAACACCTCAGTAAAGCTGG - Intergenic
1088215806 11:107507783-107507805 AAAGAACACTGCAGTAGTGAAGG + Intronic
1091092453 11:132784673-132784695 CAGCAACAATTCATTCATGAGGG - Intronic
1091193036 11:133710118-133710140 CACCAACACTACCCTAATGAAGG + Intergenic
1091508438 12:1097295-1097317 AAACAACCCTTCATTAAGGAAGG - Intronic
1091940784 12:4479023-4479045 CAAAAATTCTTCAGGAATGAAGG - Intergenic
1093263567 12:16971896-16971918 AAACTACACTTCAGAAATGAAGG - Intergenic
1093320664 12:17709493-17709515 CAACGACATTTGAGTAAGGAAGG + Intergenic
1094213130 12:27913393-27913415 CATCAGCCCTTCAGTCATGAAGG + Intergenic
1095313736 12:40732528-40732550 CAACTACAATTCTGCAATGAAGG - Intronic
1101983601 12:109428508-109428530 CACCAACACTTCTTCAATGATGG + Intronic
1102762728 12:115402817-115402839 CTAAAGCACTTCAGTGATGAAGG + Intergenic
1103880189 12:124160040-124160062 CAACAGCACTCCAGTGATGATGG + Intronic
1108119908 13:47173752-47173774 CTACAACACTTCAATAAAGTTGG - Intergenic
1108369019 13:49748900-49748922 AAATAACACTTCATTAATGTTGG - Intronic
1108584424 13:51856886-51856908 GAAATACACTTCAATAATGAAGG + Intergenic
1109315744 13:60747283-60747305 TACCAACCCTTCAGAAATGAAGG - Intergenic
1109656594 13:65399457-65399479 CAAGAACATTTCTGTGATGAAGG - Intergenic
1110107170 13:71692054-71692076 CACATACACTTCTGTAATGAAGG + Intronic
1111441126 13:88283605-88283627 CCAAAACCCTTCAGGAATGAAGG + Intergenic
1114847040 14:26335079-26335101 CAACTACACTCCAGAAATAAAGG + Intergenic
1115178644 14:30595929-30595951 CAACAAGACTAGAGCAATGATGG - Intronic
1115933668 14:38527363-38527385 CATCAACACATCAGAAACGAAGG + Intergenic
1117521068 14:56551959-56551981 CAGCAACATTTCAGGAATAATGG + Intronic
1117697135 14:58377009-58377031 CAACCAACCTTCACTAATGATGG - Intergenic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1120163271 14:81168244-81168266 CAAGATCACTTCTGAAATGAGGG - Intergenic
1122121992 14:99559625-99559647 CAAAAACACTGCAGTGAGGAAGG + Intronic
1123102005 14:105810377-105810399 CAATAACATATAAGTAATGAAGG - Intergenic
1130142377 15:81238864-81238886 AAACTACCCTTCAGGAATGATGG - Intronic
1132037545 15:98499187-98499209 CAAGAATACTTCAGAAATAAGGG - Intronic
1136180907 16:28551262-28551284 CAGCAACATTTCAGTTATGATGG - Intergenic
1136860273 16:33696521-33696543 CAAGAACACTTCATTTATTAAGG - Intergenic
1137341819 16:47614967-47614989 TAACTACCCTTCAGTAATGAAGG - Intronic
1137511836 16:49107414-49107436 CAACGACACTCCAGCAATGGGGG + Intergenic
1203121780 16_KI270728v1_random:1544689-1544711 CAAGAACACTTCATTTATTAAGG - Intergenic
1143154675 17:4828677-4828699 CACTAACACTTAAGCAATGAAGG - Intergenic
1148715720 17:49714375-49714397 CCACTACACTTCAGTAGTCAGGG - Intronic
1149014371 17:51890993-51891015 CAACAATAGTTCAGGAAAGATGG + Intronic
1151098296 17:71524818-71524840 AAACAACTCATCAGAAATGACGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1155437422 18:25827613-25827635 TAACAACATTTCTGTAATAAAGG + Intergenic
1156860218 18:41827553-41827575 CAAGAACACTTTAGAAAAGAAGG - Intergenic
1156893196 18:42214010-42214032 AAACTACACTTCATAAATGAAGG - Intergenic
1158327772 18:56328986-56329008 CAACAACATTGCAGTCATCAAGG - Intergenic
1160284589 18:77529397-77529419 CCTCAACACTTCAGTAAAGAAGG - Intergenic
1161307599 19:3576590-3576612 CAAGAACTCTTCAGTGAAGATGG - Exonic
1161722559 19:5911413-5911435 AAACAGCACTTCAGTAATAGTGG + Intronic
1168485272 19:56756400-56756422 CAACATCACTTCATTCATTAGGG - Intergenic
926617582 2:15012801-15012823 AAACTACCCTTCAGAAATGAAGG + Intergenic
928788826 2:34925857-34925879 AAACTACAATTCAGTAATGTTGG - Intergenic
931495431 2:62801388-62801410 TCACAACACTTCAGTATAGATGG - Intronic
933029627 2:77312012-77312034 CATCAACACTCCAATATTGAGGG - Intronic
934099946 2:88643130-88643152 CAACTACACTTCATAAGTGAAGG + Intergenic
934458645 2:94197635-94197657 CAAGAACACTTCATTTATTAAGG - Intergenic
936134784 2:109881080-109881102 GAACTATACTTCAGGAATGAAGG - Intergenic
936209913 2:110490405-110490427 GAACTATACTTCAGGAATGAAGG + Intergenic
938090694 2:128432333-128432355 AAACTATACTTCAGGAATGAAGG - Intergenic
938241928 2:129748712-129748734 CAACAACAGTGCATTAAGGAGGG - Intergenic
938966131 2:136390182-136390204 AAACAACACTTTAGTAACCAGGG - Intergenic
939635708 2:144580460-144580482 GATAAACAATTCAGTAATGAGGG - Intergenic
940206393 2:151207101-151207123 CAGGAAAACTTCAATAATGAGGG - Intergenic
940888259 2:159009937-159009959 TGACAACATTTCAGCAATGATGG + Intronic
942007655 2:171721828-171721850 AAACAACAGTGCACTAATGATGG + Intronic
943495658 2:188617805-188617827 CACCAAAGCTTCAGAAATGAAGG - Intergenic
945637762 2:212378181-212378203 CAACAATACTGCATTAATGACGG - Intronic
1170185783 20:13589019-13589041 CCACAACAATTCAATAAAGAAGG + Intronic
1170904207 20:20497630-20497652 CTACAAAACTTCAATAATCACGG - Intronic
1173680649 20:44878512-44878534 CAACAAAACTATAGTAATCAAGG + Intergenic
1173752949 20:45490996-45491018 CAACATAACTCCAGTCATGACGG - Intergenic
1178037246 21:28598999-28599021 GTACAGCACTTCAGAAATGATGG + Intergenic
951085281 3:18505554-18505576 CCACAAAACTTCAGTAAGGTAGG - Intergenic
951173719 3:19574668-19574690 CAACAAAGCTACAGCAATGAAGG + Intergenic
951986550 3:28627714-28627736 CCCAAACCCTTCAGTAATGAAGG + Intergenic
953218402 3:40944514-40944536 TAACACCACCTCAGTAAGGAGGG + Intergenic
955545542 3:60025025-60025047 CAACAAGACTTAACTAATGGGGG + Intronic
956734798 3:72230134-72230156 CAATAAAACTTCATTTATGAAGG - Intergenic
957180253 3:76868673-76868695 CAATAACACAACAGGAATGAAGG + Intronic
957373919 3:79332793-79332815 CAAGAACACCTTAGAAATGATGG - Intronic
960234918 3:115271051-115271073 GAACACCACTTCAGCAGTGATGG - Intergenic
961084586 3:124055936-124055958 GAACAAAGCTTCAGTACTGAGGG - Intergenic
962088157 3:132213733-132213755 CAACAACACATCACCAAGGAAGG + Intronic
962433192 3:135339173-135339195 CAACTATTCTTCAGGAATGAAGG + Intergenic
962705625 3:138040806-138040828 CAAATACACTTCAAGAATGAAGG + Intergenic
963712480 3:148762535-148762557 CTAAAGCACTTCAGTAATGTTGG - Intergenic
964372289 3:156012982-156013004 CAACAAAACTACAGTAATGGAGG + Intergenic
964436875 3:156662817-156662839 CAACAACACTACATAGATGATGG + Intergenic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
968114483 3:196079273-196079295 CAAGAAAACTTGAGGAATGATGG - Intronic
974666173 4:64964538-64964560 CAAGAAAACTGCAGTAATGGTGG - Intergenic
975586291 4:75953561-75953583 CAACATCATTTAAATAATGACGG - Intronic
977103001 4:92842555-92842577 CAACAACCACTCAGTAATGTAGG + Intronic
977320111 4:95503156-95503178 CAACAATAATTCATTGATGAAGG - Intronic
977398048 4:96496085-96496107 AAACTACCCTTCAGAAATGAAGG + Intergenic
978201813 4:106031386-106031408 AAACTACACTTCATAAATGAAGG - Intergenic
981515077 4:145598971-145598993 CAACAACAATCCATTCATGAAGG + Intergenic
981867083 4:149435301-149435323 TAACAACATTTCAGTAATGATGG + Intergenic
982335898 4:154237674-154237696 CAACTACATTTCAGCAATAAGGG - Intronic
984982582 4:185297312-185297334 CAACATAACCTCTGTAATGATGG - Intronic
986228581 5:5840680-5840702 CAGCAACATTTCAGTCAAGAAGG - Intergenic
986613967 5:9597741-9597763 CAATTATACTTCAGTAAAGATGG - Intergenic
988310772 5:29554765-29554787 CATCTATACTTCAGGAATGAGGG - Intergenic
989784144 5:45307045-45307067 CAAGAACCCCACAGTAATGAAGG + Intronic
993357557 5:86933580-86933602 CCACAAAACTTCAGGAAAGAGGG - Intergenic
994205355 5:97028690-97028712 CAAAGACACTTCAGAAAAGATGG - Exonic
994870054 5:105336047-105336069 CAAAAATACTTCAGTAAACAAGG + Intergenic
995102387 5:108328522-108328544 CTACAAGACTTCATTATTGATGG - Intronic
996669366 5:126099330-126099352 CAAACACACTTGAGTGATGACGG - Intergenic
997059389 5:130482696-130482718 CCACAACATTTCAGCATTGATGG - Intergenic
1000739812 5:164954396-164954418 TAAAAACATTTCAGTAATAATGG + Intergenic
1003342018 6:5230794-5230816 CAACAACACATGAGCAAGGAAGG + Intronic
1003473728 6:6462004-6462026 CAACCACACCTCAGAGATGAAGG + Intergenic
1004979580 6:21008340-21008362 CACCAATATTTCAGTAATAATGG + Intronic
1005111670 6:22288562-22288584 CAGCAACCCTTCAGTGGTGAGGG + Intronic
1009948041 6:70362987-70363009 AAAAAACACTTCAGGTATGACGG - Intergenic
1010625108 6:78129489-78129511 AAACAATCCTTCAGAAATGAAGG + Intergenic
1011339371 6:86296092-86296114 CACCAACAAATCAGTAAGGAAGG + Intergenic
1015431754 6:133139510-133139532 CAAGAACAATTCAGTAGAGAAGG - Intergenic
1018105942 6:160486482-160486504 CAAAAACACTTCACTTATTAAGG + Intergenic
1018117333 6:160600174-160600196 CAACAACACTTCACTTCTCAGGG + Intronic
1018117874 6:160605741-160605763 CAAAGACACTTCAGTTATCAGGG + Intronic
1018619134 6:165713969-165713991 CAACCACACCTCAGTAAGGCAGG - Intronic
1020582330 7:10018938-10018960 CAACAAAACTTGCATAATGAGGG - Intergenic
1023298228 7:38739194-38739216 CAAGAACCATTCAGTAATGTAGG - Intronic
1025988610 7:66477356-66477378 CAACATTAATTCATTAATGAGGG + Intergenic
1026973921 7:74484925-74484947 TAACAACATTGCTGTAATGAGGG + Intronic
1028356407 7:89915564-89915586 AAACCACACTGCAGTAATGAAGG + Intergenic
1028731582 7:94157374-94157396 CAAAAATATTTCAGTAAAGAAGG + Intergenic
1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG + Intronic
1033373881 7:140738425-140738447 CATGAACACTCCAGTAATTATGG + Intronic
1033387682 7:140894199-140894221 AAAGACCACTTCAGAAATGAAGG + Intronic
1034149914 7:148906950-148906972 TAACAAGACTTAAGTAATTAAGG + Intergenic
1035187942 7:157140180-157140202 AAAGAACATTTCAGAAATGATGG - Intronic
1035346190 7:158200337-158200359 AAACAACAATCCACTAATGATGG + Intronic
1036396077 8:8372366-8372388 CAAAAATACTTCAGGAAAGAAGG - Intronic
1036487647 8:9194139-9194161 CAACAACTCTTCAGGAATGTGGG + Intergenic
1037072370 8:14667688-14667710 CAACAAGAGTTCAATAGTGATGG - Intronic
1037895961 8:22655654-22655676 CTACAAAGCTACAGTAATGAAGG - Intronic
1038316241 8:26486857-26486879 CAACAAACATTCAGGAATGAAGG - Intronic
1039141491 8:34393951-34393973 CAACAAGACCTAAGAAATGAAGG + Intergenic
1039199199 8:35069416-35069438 CAATAACTCTGCACTAATGATGG + Intergenic
1041011397 8:53547381-53547403 CATCAACTCATCAGTAATGAAGG - Intergenic
1042005786 8:64178238-64178260 CATCAAGGATTCAGTAATGATGG - Intergenic
1043402151 8:79894263-79894285 CTTCAAAACTTCAGTACTGAAGG + Intergenic
1044191197 8:89319835-89319857 CAATAACACTTAATTCATGAGGG - Intergenic
1045120042 8:99027590-99027612 AAACTACCCTTCAGAAATGAAGG - Intronic
1046501250 8:115080282-115080304 CAATCACACTTCAGTTTTGATGG - Intergenic
1046997917 8:120544856-120544878 CTACAAGACTTCAACAATGATGG + Intronic
1052113671 9:24621638-24621660 AAAAAACACTTCAGTAATGGTGG + Intergenic
1052223409 9:26054974-26054996 CAACTACACTTTAGTAATCCAGG + Intergenic
1053262717 9:36684166-36684188 AAACATCAGTTCAGTACTGATGG - Intergenic
1053689140 9:40573450-40573472 CAAGAACACTTCATTTATTAAGG - Intergenic
1054274893 9:63057616-63057638 CAAGAACACTTCATTTATTAAGG + Intergenic
1054300384 9:63374382-63374404 CAAGAACACTTCATTTATTAAGG - Intergenic
1054399932 9:64707313-64707335 CAAGAACACTTCATTTATTAAGG - Intergenic
1054433520 9:65191574-65191596 CAAGAACACTTCATTTATTAAGG - Intergenic
1054496865 9:65830095-65830117 CAAGAACACTTCATTTATTAAGG + Intergenic
1054844643 9:69781148-69781170 GAACTACACTTCATAAATGAAGG - Intergenic
1057697024 9:97330481-97330503 CAGCACCTCTTCAGTTATGAAGG - Exonic
1058919813 9:109602818-109602840 AAATAAAACATCAGTAATGATGG + Intergenic
1059188237 9:112297191-112297213 AAACAAAACTTGAGTGATGATGG - Intronic
1059970181 9:119659292-119659314 CATCAATACTTCATTAATAAAGG - Intergenic
1186757351 X:12686301-12686323 CAACAAAACTGCAGAAATAAAGG - Intronic
1188714226 X:33441329-33441351 CACTGACACTTCAGTGATGATGG + Intergenic
1190625129 X:52330037-52330059 CAACAACAACCCAGTAATGCAGG - Intergenic
1192935096 X:75850723-75850745 CACCAACACTTCAACAGTGATGG + Intergenic
1193119035 X:77804249-77804271 CAACAATCCTTCAAAAATGAAGG - Intergenic
1195031604 X:100932026-100932048 CAACAAAAGTACAGTAATAAGGG - Intergenic
1195736373 X:108016950-108016972 CAACTGCACTTGAGTAGTGAGGG - Intergenic
1199079120 X:143556720-143556742 CAACAACACATGAGTGATGATGG + Intergenic
1200015479 X:153159280-153159302 CAACAATTCTTAAGTAATTATGG + Intergenic
1201529418 Y:14976025-14976047 CACAGACACTTCAGGAATGAAGG - Intergenic