ID: 967022306

View in Genome Browser
Species Human (GRCh38)
Location 3:185533474-185533496
Sequence TGGCTTTGAACCCAAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967022298_967022306 25 Left 967022298 3:185533426-185533448 CCTTTTGCATGCAATGACCCACA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 205
967022302_967022306 7 Left 967022302 3:185533444-185533466 CCACACTCAGAGAGGTTAGGTAA 0: 1
1: 0
2: 1
3: 33
4: 184
Right 967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 205
967022301_967022306 8 Left 967022301 3:185533443-185533465 CCCACACTCAGAGAGGTTAGGTA 0: 1
1: 0
2: 16
3: 109
4: 451
Right 967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG 0: 1
1: 0
2: 3
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967022306 Original CRISPR TGGCTTTGAACCCAAGGAGT TGG Intronic
903482944 1:23667796-23667818 AGGATTTGAACCCAGGGTGTTGG - Intergenic
904493794 1:30875761-30875783 AGGATTTGAACCCAGGCAGTTGG - Intronic
904541519 1:31236942-31236964 AGGCTTTGAATCCAGGCAGTTGG - Intronic
905425357 1:37879314-37879336 AGGATTTGAACCCAGGCAGTGGG - Intronic
905434129 1:37945477-37945499 TGGGTTTGAACCCAGGCATTTGG + Intronic
905589027 1:39146010-39146032 TGGGTATAAACCTAAGGAGTGGG - Intronic
906599001 1:47107296-47107318 AGGACTTGAACCCAAGTAGTGGG + Intronic
909003921 1:70253521-70253543 TCACTTTGAACCCAAGGAGTTGG + Intergenic
920754300 1:208714095-208714117 TGGCTTTGGGACCAAGGAGAGGG - Intergenic
922546677 1:226463256-226463278 TGGATTAGAATCCAGGGAGTCGG - Intergenic
922610518 1:226923751-226923773 TTGGGTTGAACACAAGGAGTTGG - Intronic
1067699215 10:48556557-48556579 AGGATTTGAACCCAGGTAGTTGG - Intronic
1071069718 10:81677572-81677594 AGGCTTTAAACTCAAGAAGTGGG - Intergenic
1071322027 10:84471355-84471377 TGGCTTTGAACACAAACACTAGG - Intronic
1073527046 10:104193396-104193418 GGGATTTGAACCCAGGTAGTTGG - Intronic
1074675200 10:115840605-115840627 TGGCCTTGAACCCAGGCAGTTGG + Intronic
1074918842 10:117986307-117986329 TGGTTTTGAACCCAAGGAATGGG + Intergenic
1076108219 10:127841469-127841491 TGGCTTTCTACCCAAGGGGGAGG + Intergenic
1076941712 10:133614543-133614565 TGGCTATGAACCCATGGCCTGGG - Intergenic
1077610323 11:3639912-3639934 TCGCTTTGAACCCAAGAGGCTGG - Exonic
1078130480 11:8610201-8610223 TGCCATGGAACCCAAGGAGTCGG + Intergenic
1078641209 11:13098420-13098442 TGTGTTTGAATCCAAGGATTTGG + Intergenic
1078661762 11:13293179-13293201 TGGCTCTGAAACTAAGCAGTGGG + Intronic
1079082349 11:17422762-17422784 TGGCTTAGATCCCATGTAGTAGG - Intronic
1079348718 11:19674846-19674868 TAGATTTGAACCCAGGGAGGTGG - Intronic
1083863603 11:65440985-65441007 TGGCTTTGAGCCCAAAAACTTGG + Intergenic
1084506383 11:69570907-69570929 TGGCCTTGAAGCCAAAGAATTGG + Intergenic
1084900246 11:72304404-72304426 GGGATTTGAACCCAAGCAGCTGG + Intronic
1088485773 11:110339039-110339061 TTGCTTTGAACCCCTGGAGGTGG - Intergenic
1088510939 11:110573959-110573981 TGGCTTAGAACTCTAGGAGTGGG - Intergenic
1089167827 11:116490770-116490792 TGGATTTGAGCCCAGGCAGTTGG - Intergenic
1089743884 11:120603660-120603682 TGTCTTTGAACCCAAGCCCTGGG - Intronic
1090864655 11:130688710-130688732 TGTCTTTGAAGCCAATGTGTTGG - Intronic
1091688167 12:2578428-2578450 TGGCTTTGACCCAGAGGAGAAGG + Intronic
1092467859 12:8749921-8749943 TCACTTTGCACCCAAGGGGTTGG - Exonic
1096655340 12:53087317-53087339 TGGCTTTAAACCCAAGAATTTGG + Intergenic
1101443112 12:104718282-104718304 GGGATTTGAACCCAGGGAGTTGG + Intronic
1102061899 12:109938854-109938876 TGCATTTGTACCCAAGGAGTTGG - Intronic
1102202156 12:111064721-111064743 TGGGTTTCAACCCAAGGCCTGGG + Intronic
1102436933 12:112931337-112931359 AGGATTTGAACCCAGGCAGTCGG - Intronic
1102797473 12:115701104-115701126 TGGCTTCAAACCACAGGAGTGGG + Intergenic
1102882562 12:116497141-116497163 TGGCTCTGAACCCCGGGAGCTGG - Intergenic
1104335726 12:127892916-127892938 TGGCTCTGAACCCAGGTAGAGGG - Intergenic
1104711670 12:130991521-130991543 TGGATTTGAACCCAAGCAGATGG - Intronic
1106359088 13:29013331-29013353 TGGCTTTGACCACCAAGAGTCGG - Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1110297840 13:73889383-73889405 TGTCTTTGAACACCTGGAGTAGG + Intronic
1111633672 13:90875552-90875574 AGGATTTGAACCCAAGGATCTGG + Intergenic
1112926740 13:104684935-104684957 TGACTCTGAACCCAAGTAGTGGG - Intergenic
1114680640 14:24481306-24481328 GGGATTTGAACCCAGGCAGTTGG + Intergenic
1116078761 14:40146088-40146110 TGGCTTTGGAATCAAGTAGTGGG + Intergenic
1117749409 14:58904368-58904390 GGGCACTGAACCCAAAGAGTAGG + Intergenic
1118504287 14:66393549-66393571 TGACTCTGTACCCAGGGAGTGGG - Intergenic
1118714461 14:68549086-68549108 GGGTTTTGAGCCCCAGGAGTAGG + Intronic
1118976058 14:70677535-70677557 TGGCATTGAGACCAGGGAGTGGG - Intergenic
1119428982 14:74553462-74553484 GGGCTTTGAACCCAAGGGCAGGG + Intronic
1119639671 14:76305267-76305289 TGGCTTTAAACTCAAGGACGAGG - Intergenic
1121228280 14:92337634-92337656 TGCCTTTTAACCCAAGGAAAGGG + Intronic
1121558633 14:94857779-94857801 GGGATTTGAACCCAAGGAATCGG + Intergenic
1122853621 14:104549351-104549373 AGCCTTTGATCCCAGGGAGTCGG + Intronic
1123232703 15:17144246-17144268 TGGCATTCAACCCACAGAGTTGG + Intergenic
1125003380 15:34794443-34794465 TGGCTTTCACACCAGGGAGTGGG + Intronic
1125416581 15:39460311-39460333 TGGCTTTGAGGCCAATGAGATGG - Intergenic
1125555497 15:40581368-40581390 TGGCTTTGAACACTGGGAATGGG - Intergenic
1126038942 15:44572311-44572333 AGGCTTTGAATCCATGGACTGGG + Intronic
1127851080 15:62912405-62912427 TTACCTTGGACCCAAGGAGTAGG + Intergenic
1128268465 15:66288278-66288300 AGACTTTGAACCCAAGCAGTTGG - Intergenic
1128269350 15:66294309-66294331 TGGCCTAGAAACCAAGGACTGGG - Intronic
1130006874 15:80107973-80107995 TGGGATTCAACCCAAGCAGTTGG - Intronic
1130447201 15:84014285-84014307 TGGAATGGAAACCAAGGAGTAGG - Intronic
1130726216 15:86442220-86442242 TGGCTTTGAATCTGAGGAGCAGG + Intronic
1133763823 16:8821502-8821524 TGGCTTCAAACCCCTGGAGTGGG + Intronic
1134218625 16:12335911-12335933 AGGATTTGAACCCAGGCAGTTGG + Intronic
1141770137 16:86084989-86085011 GGGCTTTGAACTCAAGTGGTTGG - Intergenic
1141871836 16:86791983-86792005 GGGATTTGAACCCAGGGACTAGG - Intergenic
1141932595 16:87216049-87216071 TGGCCTTGTCCCCAAGGATTTGG - Intronic
1142421848 16:89975737-89975759 GGGTTTGGAACCCAAGGTGTGGG - Intergenic
1144164574 17:12596895-12596917 TGGCCTTGTACCCAGTGAGTGGG + Intergenic
1144462037 17:15466172-15466194 TGGATTTGAACCCAGGGACTCGG + Intronic
1146138545 17:30344692-30344714 TAGCTTTAAAAACAAGGAGTAGG - Intergenic
1146935836 17:36812233-36812255 TGGATTTGAAGCCAAGGACCTGG - Intergenic
1147818620 17:43228492-43228514 TGGCTTTGGACCGAAGGAGATGG - Intergenic
1147831903 17:43303194-43303216 TGGCTTTGGACCGAAGGAGATGG - Intergenic
1149238716 17:54623770-54623792 TGGATTTGAACCCAAGCATCTGG + Intergenic
1152099058 17:78290556-78290578 GAGATTTGAACCCAGGGAGTGGG + Intergenic
1153360073 18:4184628-4184650 TGGCTTTTTATCCAAGTAGTAGG - Intronic
1154062294 18:11073235-11073257 TGGATGTGAACACAAGGAGATGG - Intronic
1157947538 18:51997751-51997773 TGGGTTTGAACCCACGAAGGTGG + Intergenic
1159298483 18:66528466-66528488 TGGGTTAGAACCCAAGGATTTGG - Intronic
1161089458 19:2352799-2352821 GGGCTCTGGACCCAAGGAGGGGG - Intronic
1161397740 19:4053332-4053354 TGGCTTTGGGCCCAAGAGGTGGG + Intronic
1163148855 19:15399588-15399610 TGGCCTAGGCCCCAAGGAGTGGG + Intronic
1165257770 19:34589920-34589942 TGGCCTGGAGCCCAGGGAGTTGG + Intergenic
1166214876 19:41328264-41328286 TGACTGTGAACCCATGGAGGAGG + Intronic
1166793694 19:45413644-45413666 TGGGAAAGAACCCAAGGAGTTGG - Exonic
1167638973 19:50669847-50669869 GGACTTTGAACGCCAGGAGTTGG + Intronic
925309554 2:2872771-2872793 TGGCTTTTACCCCAATGAGATGG - Intergenic
926534462 2:14093442-14093464 AGGGTTTGAACACAAGCAGTTGG - Intergenic
929879486 2:45823639-45823661 TGGCATTTAAACCAAGAAGTTGG - Intronic
931155615 2:59625239-59625261 AAGATTTGAACCCAAGCAGTTGG - Intergenic
933966971 2:87437952-87437974 TGGCTTTGAACCAAGGAAGCAGG - Intergenic
936326826 2:111512545-111512567 TGGCTTTGAACCAAGGAAGCAGG + Intergenic
940376184 2:152961682-152961704 TGGCTTAGAACACGAGTAGTTGG - Intergenic
940934993 2:159483038-159483060 TGGTTTTGAACACAAAGAATGGG - Intronic
942776112 2:179584599-179584621 TGGCTTAGAAGGCATGGAGTGGG + Intronic
943743406 2:191435994-191436016 TGGCTTTGAACCTACGCAGCTGG + Intergenic
944429841 2:199621229-199621251 TGACTTTTAACCCAATAAGTGGG + Intergenic
945950313 2:216033406-216033428 GGGATTCGAACCCAAGCAGTTGG + Intronic
946724723 2:222651036-222651058 TGGCTTTGGAACCAAGCAGTGGG + Intronic
947606167 2:231487209-231487231 TGGCTGTGAACAGAAGGAGAGGG + Intergenic
1169386744 20:5156370-5156392 TGTTTTTGAACCCACTGAGTTGG + Intronic
1169677389 20:8169291-8169313 AGGTTTTGAACCCTGGGAGTTGG - Intronic
1171313645 20:24166940-24166962 TGGCTTTTGACCCAAGGCCTGGG + Intergenic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1172142335 20:32732167-32732189 TTGCTTTGAACCCAAGAGGTTGG - Intronic
1173988959 20:47285161-47285183 AGGATTTGAACCCAGGTAGTCGG + Intronic
1174036955 20:47674343-47674365 AGGATTTGAACCCAGGTAGTTGG - Intronic
1174251517 20:49223318-49223340 AGGCTCTGAACCAAAGGAGCAGG + Exonic
1174287044 20:49481157-49481179 TGAGTTTGAACACAAAGAGTGGG - Intronic
1175182135 20:57156217-57156239 TGGGATGGAGCCCAAGGAGTGGG + Intergenic
1177921123 21:27153866-27153888 TGGCTTTGAAACCAAGTGGATGG + Intergenic
1178830271 21:36050451-36050473 TCACTTTGCACCCAAGGGGTTGG - Intronic
1179359638 21:40693894-40693916 TGGATTTGAACCCAGGGAGTTGG - Intronic
1179933713 21:44589986-44590008 TGGCTTTGCTTCCAAGGAGGTGG + Intronic
1179941176 21:44639533-44639555 TGGCTTTGCTTCCAAGGAGGTGG - Intronic
1182190898 22:28459543-28459565 TGGCTTTGACCTGAAGGAGGGGG - Intronic
1182429763 22:30292632-30292654 TGGCTTTGGAGCCAGGGAGGGGG + Exonic
1183603159 22:38851653-38851675 GGACTTTGAAGTCAAGGAGTTGG + Intergenic
1184343779 22:43900736-43900758 TGGCTTGGAAGACAAGGAGGAGG + Intergenic
949867734 3:8560314-8560336 TGGCTTTGAACCCAGGTTATGGG - Intronic
951678501 3:25269413-25269435 GGGATTTGAACCCAGGTAGTTGG - Intronic
951711354 3:25587016-25587038 GGGATTTGAATCCAGGGAGTTGG - Intronic
954830872 3:53420379-53420401 TTGCTTGTAAGCCAAGGAGTTGG + Intergenic
955055082 3:55447494-55447516 AGGCTCTGAACCCAGGCAGTTGG + Intergenic
955973940 3:64462987-64463009 AGGCTTTGAACCTAATGAGCTGG - Intergenic
956209058 3:66784670-66784692 TGGCTTTGGGACCAAGTAGTGGG - Intergenic
956911115 3:73818269-73818291 AGGATTTGAACCCAGGCAGTTGG + Intergenic
963561848 3:146875881-146875903 TGGCTGTGAAGGGAAGGAGTGGG + Intergenic
964833257 3:160909739-160909761 TGTCATAGAAGCCAAGGAGTCGG + Intronic
965817853 3:172655375-172655397 TGGCTCTGTACCCAGGTAGTTGG + Intronic
967022306 3:185533474-185533496 TGGCTTTGAACCCAAGGAGTTGG + Intronic
967665332 3:192165036-192165058 TCACTTTCAACCCAGGGAGTCGG - Intronic
969095348 4:4728672-4728694 AGGCTTTGAATCCAGGGAGGTGG - Intergenic
969785546 4:9454435-9454457 GGACTTTGAACCCAAACAGTGGG + Intergenic
970316638 4:14834361-14834383 TGGCTTTTGAACCAAGGATTGGG + Intergenic
974025013 4:56725824-56725846 GGACTTTGAAGTCAAGGAGTGGG + Intergenic
975377445 4:73662350-73662372 TTGCTTAGTTCCCAAGGAGTTGG - Intergenic
976735130 4:88301459-88301481 TGGCTTTGGAGGGAAGGAGTAGG + Intergenic
978867733 4:113535242-113535264 TGTCTTTGAACCCAATGTCTGGG + Intronic
983117864 4:163842033-163842055 TGGCTTTTAACCTAAGGAATTGG + Intronic
985044446 4:185926167-185926189 TGGCTTTTAAGCACAGGAGTGGG + Intronic
986564127 5:9093869-9093891 AGGCTGTGAACCCAAGGACATGG - Intronic
987113988 5:14712485-14712507 TGGCTGTGCACACAAGGACTGGG - Intronic
989385830 5:40853887-40853909 TGGCTGTGAATCCAGGGAATAGG - Exonic
990757141 5:59086158-59086180 GAGATTTGAACCTAAGGAGTTGG + Intronic
991258744 5:64644105-64644127 AAGATTTGAACCCAAGCAGTTGG - Intergenic
991596073 5:68307157-68307179 TGGCTTTTTCCCCAAGGAGAAGG + Intergenic
992178588 5:74174845-74174867 TGGCTGGGAGCCTAAGGAGTGGG - Intergenic
992324954 5:75651443-75651465 TTGCTTAGTGCCCAAGGAGTCGG - Intronic
992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG + Intronic
993692546 5:91020226-91020248 TGGCCTTGATCCCAAAGAGTAGG + Intronic
996185207 5:120465352-120465374 TGGCATTGAACCCGAGAAGCAGG + Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996615596 5:125437253-125437275 TGGCTCTGAATCCAGGCAGTGGG - Intergenic
998978314 5:147672728-147672750 TGGCTTGGAACTTGAGGAGTGGG + Intronic
999075685 5:148793199-148793221 TGGATTTGGACCCAGAGAGTCGG - Intergenic
1000168266 5:158676713-158676735 TGGAGTTGCACCCAAAGAGTGGG - Intergenic
1001032776 5:168274973-168274995 TGGGTTTGAACCCCAGGAGAGGG - Intergenic
1001985789 5:176073678-176073700 TGGCTATGAACCCATGGCCTGGG - Intronic
1002231082 5:177764446-177764468 TGGCTATGAACCCATGGCCTGGG + Intronic
1002264256 5:178019302-178019324 TGGCTATGAACCCATGGCCTGGG - Intronic
1003157389 6:3608080-3608102 TGGCTTTCAGACCAGGGAGTTGG - Intergenic
1003978715 6:11369086-11369108 TGGATTTGAACTCAGGCAGTTGG + Intronic
1006807200 6:36796408-36796430 TGGCTTTGGACCCAGGCAGCTGG + Intronic
1010417791 6:75633876-75633898 TTGCTTTGAATCTTAGGAGTAGG + Intronic
1010773566 6:79860105-79860127 AGGCCCTGAACACAAGGAGTGGG - Intergenic
1011644876 6:89448028-89448050 TGGCTTTAAATCCAAAGAATAGG + Intronic
1013012883 6:106135686-106135708 AAGCTTTGAACTCCAGGAGTGGG - Intergenic
1014508627 6:122292211-122292233 AGGATTCAAACCCAAGGAGTTGG + Intergenic
1014791201 6:125674394-125674416 TGGCTCTGTATCCAAGAAGTAGG - Intergenic
1015719483 6:136226612-136226634 GGGATTTGAACCCAAGCAGATGG - Intergenic
1019477992 7:1253128-1253150 TGGCTCTGAAACCAGGGAGGAGG - Intergenic
1021290039 7:18831970-18831992 TGGCTGTGACCCAAAGTAGTAGG - Intronic
1021869085 7:24985878-24985900 TGGCTTGTAACAGAAGGAGTAGG - Intergenic
1022802527 7:33789903-33789925 AGGATTTGAACCCAGGCAGTTGG + Intergenic
1023130656 7:36999501-36999523 TGGCCCTGGACCCAAGGAGTGGG - Intronic
1023333901 7:39148350-39148372 GGACTCTGAACCCAAGAAGTGGG - Intronic
1023899332 7:44463281-44463303 TGGCATTGAACCCAGAGAGAAGG + Intronic
1024013144 7:45287717-45287739 AGTTATTGAACCCAAGGAGTGGG - Intergenic
1024902715 7:54339422-54339444 TGGCCTTCAGTCCAAGGAGTTGG - Intergenic
1026363851 7:69627739-69627761 GGGCTGTGAACCCAAGTAATGGG - Intronic
1027026543 7:74856183-74856205 TCGCTTTGAAACCCAGGAGGTGG + Intergenic
1028678527 7:93496659-93496681 TGGCTATGAGAACAAGGAGTAGG + Intronic
1029226400 7:99031796-99031818 TGTCTTGGAACCCAAGGATGCGG - Intronic
1030458708 7:109804781-109804803 TGGATTTGAACCCAGCTAGTTGG - Intergenic
1030505932 7:110422383-110422405 TTGTTTTGAAGCCAAGCAGTAGG - Intergenic
1033302459 7:140198624-140198646 TGGGGTTGAACCCAAGGGTTGGG + Intergenic
1037627551 8:20621193-20621215 TAGCTTTGAATCCAAGCATTGGG - Intergenic
1037738665 8:21587461-21587483 TAGACTTGAACCCAAGCAGTTGG + Intergenic
1037754808 8:21703780-21703802 TGGCTGTGAACCAGAGCAGTGGG - Intronic
1038391652 8:27207484-27207506 TGACATTGAAACCAAGGGGTTGG - Intergenic
1038752875 8:30313199-30313221 TGCCTTTGAAGCCAATAAGTTGG - Intergenic
1039410321 8:37349517-37349539 TGGTTTTGAACCCGTTGAGTTGG - Intergenic
1040523577 8:48198573-48198595 TGCCTTGGAGGCCAAGGAGTTGG + Intergenic
1040575844 8:48650448-48650470 TGACGTTCCACCCAAGGAGTAGG - Intergenic
1044623504 8:94213910-94213932 TGGGATTGGGCCCAAGGAGTTGG - Intronic
1045076296 8:98573042-98573064 TGGATTTGAAACTAAGCAGTGGG + Intronic
1046726954 8:117686201-117686223 GGGATTTGAACCCATGTAGTTGG + Intergenic
1051523702 9:18018919-18018941 TGGCTTTGGAACCAGGTAGTGGG + Intergenic
1051598690 9:18850526-18850548 TGGCTTGGAACCAAGGCAGTAGG - Intronic
1054697796 9:68378149-68378171 TGGCTTTAATCCCAAGGAACTGG + Intronic
1055389583 9:75805474-75805496 GAGCTTTGAACCCAAGCTGTTGG - Intergenic
1057874918 9:98746638-98746660 TGGCTTTGAACCCTGGCAGAGGG + Intronic
1060381869 9:123182926-123182948 ATCCTTTGAGCCCAAGGAGTTGG + Intronic
1062060001 9:134490153-134490175 TGGATTTGAACCCAAGTTGGTGG - Intergenic
1185752685 X:2626842-2626864 TGACTTATATCCCAAGGAGTGGG + Intergenic
1191393411 X:60167432-60167454 TGGCATTCAACACATGGAGTTGG + Intergenic
1191402964 X:60295299-60295321 TGGCATTCAACACATGGAGTTGG + Intergenic
1191406301 X:60340021-60340043 TGGCATTCAACACATGGAGTTGG + Intergenic
1191446633 X:60880220-60880242 TGGCATTCAACACATGGAGTTGG + Intergenic
1191474982 X:61259756-61259778 TGGCATTCAACACATGGAGTTGG + Intergenic
1192330192 X:70169280-70169302 TGACTTCAAACCCAAGAAGTTGG + Intergenic
1193312557 X:80024985-80025007 TAGCTTTGAAAGCAAGGAGAAGG + Intronic
1194654609 X:96557331-96557353 TGGCTTTGAATTCAGGTAGTCGG + Intergenic
1195899582 X:109783376-109783398 TGGTTTTTAACAGAAGGAGTAGG - Intergenic
1195961617 X:110393163-110393185 AGGATTTGAACCCATGTAGTTGG - Intronic
1199733407 X:150660580-150660602 TGTCTTTGACCTCAAAGAGTAGG + Intronic
1201853465 Y:18515182-18515204 TGGCCATGAAGCCATGGAGTGGG - Intergenic
1201879856 Y:18805202-18805224 TGGCCATGAAGCCATGGAGTGGG + Intronic