ID: 967028782

View in Genome Browser
Species Human (GRCh38)
Location 3:185586644-185586666
Sequence GCTCCCGCCAGGCTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967028778_967028782 -8 Left 967028778 3:185586629-185586651 CCTAGTGACGTAGTCGCTCCCGC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 199
967028772_967028782 22 Left 967028772 3:185586599-185586621 CCAGGCTCACCCGAAACAGGTCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 199
967028777_967028782 -1 Left 967028777 3:185586622-185586644 CCGGGATCCTAGTGACGTAGTCG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 199
967028775_967028782 13 Left 967028775 3:185586608-185586630 CCCGAAACAGGTCGCCGGGATCC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 199
967028776_967028782 12 Left 967028776 3:185586609-185586631 CCGAAACAGGTCGCCGGGATCCT 0: 1
1: 0
2: 0
3: 0
4: 30
Right 967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967028782 Original CRISPR GCTCCCGCCAGGCTGTAGGG AGG Intronic
900422677 1:2562395-2562417 GCTGCCGCCTGGCTGGAGGATGG - Intronic
901210850 1:7525230-7525252 GCTCCCACCCTGCTGCAGGGCGG - Intronic
901674617 1:10875638-10875660 GCTTGCTCCAGGCTGTAGTGCGG + Intergenic
903263647 1:22143731-22143753 GCTCCCGGAAGGCTGTAGGGAGG - Intronic
904423359 1:30408169-30408191 GCTGCCACCAGGATGTGGGGAGG + Intergenic
904524193 1:31120340-31120362 GCTTCTCCCAGGCTATAGGGTGG - Intergenic
907450348 1:54542275-54542297 GCTGCGGGCAGGCTGAAGGGAGG - Intronic
910374425 1:86553083-86553105 GCACACCCCAGGCTGCAGGGTGG - Intronic
913281607 1:117190315-117190337 GCTCCTGCCAGGTTCTTGGGTGG - Intronic
915730138 1:158047618-158047640 GATCCTGGCAGGCTGTGGGGAGG - Intronic
919855660 1:201704405-201704427 GCCCCCGCCAGGCTCTCTGGGGG - Intronic
921029611 1:211326137-211326159 TCTCACGCCAGGCTGGAGTGCGG - Intergenic
921741674 1:218692448-218692470 GCACCCATCAGGCTGTAGTGTGG + Intergenic
924623197 1:245679979-245680001 CCTCCCGCCTGGCTCTGGGGAGG + Intronic
1063918308 10:10906753-10906775 TCTGTCGCCAGGCTGTAGTGCGG + Intergenic
1066086833 10:31979329-31979351 GCCCCCGCCTGGCAGGAGGGAGG - Intergenic
1067167915 10:43879957-43879979 GCTCCCCGCTGGCTGTGGGGCGG - Intergenic
1067549883 10:47226888-47226910 GCACGGGCCAGCCTGTAGGGAGG - Intergenic
1070534064 10:77362130-77362152 GCTCCCAGCAGGCTGGAGGAGGG + Intronic
1073414966 10:103373158-103373180 TCTGTCGCCAGGCTGGAGGGCGG - Intronic
1075023134 10:118965830-118965852 ACTCCCTCCTGGCTGAAGGGTGG - Intergenic
1076355569 10:129850542-129850564 GCTCCTGCCAGGCTGGATGCGGG + Intronic
1077178018 11:1199360-1199382 GGTCTCGCCGGGCTGGAGGGAGG - Intronic
1077184906 11:1231613-1231635 ACTAGCGCCAGGCTGCAGGGAGG + Intronic
1080850680 11:36066775-36066797 GCTCCCTCAGGGCTGTTGGGGGG + Intronic
1082005225 11:47415475-47415497 CCTCCCGCCAGACAGGAGGGAGG + Exonic
1083275732 11:61595965-61595987 GCTACCTCCGGGTTGTAGGGTGG - Intergenic
1083490353 11:63010943-63010965 TCTCCCGCCAGGCTCTGAGGGGG + Intronic
1083554221 11:63613562-63613584 GGTCCGGCCAGGCGGAAGGGGGG + Intronic
1083653976 11:64220209-64220231 TCTCCCTCCAGGCTGTGAGGTGG + Exonic
1085322896 11:75585475-75585497 GCCACAGCCAGGCTGTGGGGAGG - Intergenic
1090954870 11:131504846-131504868 GCTTCCTCCAGGCTGGAGCGGGG - Intronic
1091315303 11:134610262-134610284 GGCCCCTGCAGGCTGTAGGGAGG - Intergenic
1091829122 12:3536688-3536710 GCCCCAGCCAGGCTGGATGGAGG + Intronic
1092728121 12:11504409-11504431 CCTCTCACCAGGCTGTGGGGAGG + Intergenic
1095043736 12:37474703-37474725 CCTCCCTCCAGGGTATAGGGTGG + Intergenic
1096326419 12:50666562-50666584 ACTTCCGCTGGGCTGTAGGGAGG + Intronic
1096644879 12:53027173-53027195 TCTCTCGCCAGGCTGGAGTGCGG + Intronic
1096859662 12:54516135-54516157 GCTCCCACCAGGGTATAGGCTGG + Intronic
1098230148 12:68365137-68365159 GGCCCAGCCAGGCCGTAGGGAGG + Intergenic
1103091966 12:118103977-118103999 GCTCCCGCCTGGCTGGGAGGCGG - Intronic
1103309056 12:119989806-119989828 GCGCGCGCCAGGCTGCAGGGGGG - Intergenic
1103870191 12:124085745-124085767 GCACCAGCCAGGTTGCAGGGAGG - Intronic
1104724255 12:131066393-131066415 GCACCTTCCAGGCTGTGGGGCGG + Intronic
1105401442 13:20099621-20099643 GCTGCCGCTAGGATGGAGGGAGG - Intergenic
1107862983 13:44678472-44678494 GCTCCTGCCTGGCTGCAGAGGGG - Intergenic
1107881180 13:44833365-44833387 GGTCCCTCCAGGCTGGAGAGAGG + Intergenic
1111441775 13:88291118-88291140 GCTCCCAACAGGCTGTTGTGAGG + Intergenic
1111442158 13:88293846-88293868 GCTCCCAACAGGCTGTTGTGAGG - Intergenic
1113650192 13:112028914-112028936 GCTCCCACCAGGCAGCTGGGTGG - Intergenic
1116912360 14:50482738-50482760 TCTGCCGCCAGGCTGGAGTGCGG - Intronic
1117957286 14:61132349-61132371 GCTCCTGACAGGCTGTCGAGAGG - Intergenic
1122662913 14:103309837-103309859 GCTCCAGCCAGGGTGCCGGGGGG + Intergenic
1122876022 14:104665805-104665827 GCTGCCTGCAGGCTGTAGAGAGG + Intergenic
1123044370 14:105504120-105504142 GGGACCGCCAGGCTGGAGGGGGG + Intergenic
1202942269 14_KI270725v1_random:162299-162321 CCTCCCTCCAGGGTATAGGGTGG + Intergenic
1124025842 15:25964788-25964810 GCTCCAGCCAGGCTGTGGCAAGG + Intergenic
1125721993 15:41849625-41849647 GCTCACTCCAGGCTCTAGTGTGG - Intronic
1125918579 15:43510806-43510828 GGTCTCGCCAGGCTAGAGGGTGG - Intergenic
1126291151 15:47081166-47081188 CCTCCCTCCAGGGTATAGGGTGG - Intergenic
1127071247 15:55289907-55289929 GCCCCCGCCCGGCTGGCGGGGGG + Intronic
1129711009 15:77820165-77820187 GCTCCGGCCTGGCGCTAGGGTGG + Intronic
1132404037 15:101531437-101531459 GCACCGGCTAGGCTGTGGGGTGG + Intergenic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1134366157 16:13581251-13581273 GCTCCAGTCTGGCTGTAAGGAGG - Intergenic
1136117082 16:28101327-28101349 GCTGCCGCCAAGCTGCAGGGTGG + Intronic
1137970158 16:52976714-52976736 GCTCCCTCCTGGCTGTAAGAGGG + Intergenic
1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG + Intergenic
1141518385 16:84561578-84561600 GCTCCCTGCAGGCTGGAGGAAGG - Intergenic
1141634717 16:85308042-85308064 GCTTCCACCAGGCAGGAGGGAGG + Intergenic
1142135913 16:88452014-88452036 GCTCCCAGCAGGCTGGCGGGTGG + Intergenic
1142282370 16:89155206-89155228 ACTTCCCCCAGGCTGTGGGGAGG - Exonic
1142796711 17:2313391-2313413 TCTGCCGCCAGGCTGGAGTGCGG - Intronic
1143514291 17:7411646-7411668 CCCCCCACAAGGCTGTAGGGAGG - Intronic
1143779445 17:9221671-9221693 TGTTCCGCCAGGCTGTAGCGGGG + Intronic
1145869081 17:28258755-28258777 TTTCCTGCCAGGCTGCAGGGAGG - Intergenic
1147923162 17:43931144-43931166 CTTCCTGCCAGGCTGCAGGGAGG + Intergenic
1148340438 17:46870391-46870413 TTTCCTGCCAGGCTGCAGGGAGG + Intronic
1161039313 19:2101576-2101598 GCGCCAGCCAGGCTGTGGGCAGG - Exonic
1161217769 19:3103005-3103027 GCCCCCACCAGGCTGCGGGGAGG - Intronic
1161330482 19:3684501-3684523 GCTGGGGCCAGGCTGGAGGGTGG + Intronic
1161495039 19:4581811-4581833 GCTCCAGCCCGGCTTTGGGGAGG - Intergenic
1162564218 19:11436215-11436237 CCTCCCGCCAGGCTGGAGGTGGG + Intronic
1162809163 19:13153937-13153959 GCTTCCCCCAGGATGGAGGGGGG - Exonic
1165245837 19:34497970-34497992 GCTGCCGCGAGGCTGTTGGATGG + Intronic
1165511395 19:36268608-36268630 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165511943 19:36271131-36271153 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165512495 19:36273632-36273654 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513042 19:36276173-36276195 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513598 19:36278728-36278750 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514148 19:36281262-36281284 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514700 19:36283799-36283821 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515252 19:36286332-36286354 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515802 19:36288868-36288890 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516353 19:36291405-36291427 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516905 19:36293931-36293953 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165517458 19:36296454-36296476 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518010 19:36298989-36299011 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518561 19:36301524-36301546 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519110 19:36304056-36304078 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519660 19:36306571-36306593 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165520209 19:36309099-36309121 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165623858 19:37269483-37269505 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624403 19:37272023-37272045 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624948 19:37274550-37274572 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165625484 19:37277088-37277110 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626020 19:37279613-37279635 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626564 19:37282140-37282162 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627103 19:37284665-37284687 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627646 19:37287189-37287211 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628181 19:37289713-37289735 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628722 19:37292238-37292260 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629263 19:37294764-37294786 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629805 19:37297289-37297311 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630348 19:37299817-37299839 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630884 19:37302355-37302377 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1166109870 19:40615132-40615154 GCTCCAGCGAGGCAGGAGGGTGG + Intronic
927397671 2:22672770-22672792 GCTCCCTGAAGCCTGTAGGGGGG + Intergenic
927501684 2:23587505-23587527 GCTCCTGCCAGGCAGTGGAGGGG - Intronic
932343119 2:70979005-70979027 GCCCCCGCCTGGCTGGTGGGCGG - Intronic
934522694 2:95030019-95030041 GCGCCTCCCAGGCTGTTGGGAGG - Intronic
935251470 2:101265712-101265734 GTTACTGACAGGCTGTAGGGAGG + Intronic
945244053 2:207702042-207702064 GCTCCCTTCAGGCTGTGGGCTGG - Intergenic
945309074 2:208289464-208289486 TCTCTCGCCAGGCTGGAGTGCGG + Intronic
946239619 2:218345614-218345636 CCTTCTTCCAGGCTGTAGGGAGG - Exonic
949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG + Intergenic
1171538193 20:25917436-25917458 CCTCCCTCCAGGGTATAGGGTGG + Intergenic
1171802946 20:29644005-29644027 CCTCCCTCCAGGGTATAGGGTGG - Intergenic
1171841137 20:30212737-30212759 CCTCCCTCCAGGGTATAGGGTGG + Intergenic
1172011706 20:31849529-31849551 GCTTCCTCCAGGCGGTAGGACGG - Intronic
1172181864 20:33008457-33008479 GTTCCCTCCAGGCTGGAGTGGGG + Intronic
1176580901 21:8524631-8524653 CCTCCCTCCAGGGTATAGGGTGG - Intergenic
1179585129 21:42369991-42370013 GCTCTCGCCAGACCGCAGGGAGG - Intergenic
1181020727 22:20100820-20100842 GCTCCAGACAGGCTGCAGTGTGG - Intronic
1181701269 22:24622833-24622855 GCCCCAGCCCGGCTGTTGGGTGG + Intronic
1182352228 22:29705416-29705438 GCTCTGGCCAGGCCCTAGGGAGG + Intergenic
1183640317 22:39088808-39088830 GGTCCCTCTGGGCTGTAGGGAGG + Intergenic
1183912740 22:41091731-41091753 GCTACCGCTAGCCTGTAAGGAGG + Intergenic
1184343276 22:43897859-43897881 GCTCCTGCGAGGGTGCAGGGCGG - Intergenic
1184691003 22:46117227-46117249 CCTCCCCCCAGGCTCTGGGGAGG - Intergenic
1184893704 22:47394736-47394758 GCTCTCTGCAGGCTCTAGGGGGG - Intergenic
1185072838 22:48666778-48666800 TCTCCCAGCAGGCTGGAGGGAGG - Intronic
1185294663 22:50047136-50047158 GCTCCCGCCACGCTCAAGCGCGG + Intronic
1185374923 22:50478111-50478133 CCTCCCGCCAGCTTGTGGGGAGG - Intergenic
949529027 3:4935439-4935461 GCACCAGACAGGCTGGAGGGAGG - Intergenic
950453079 3:13076419-13076441 GTTCCTGCCAGCCTGCAGGGTGG - Intergenic
950547833 3:13648993-13649015 CCTCCCTCCAGGTTGTAGGTGGG - Intergenic
952788092 3:37176025-37176047 GCTCCCACCGGGCTGGCGGGAGG + Intronic
960961085 3:123070782-123070804 GCTCCATCCAGCCTGTAGGATGG + Intronic
960992654 3:123322010-123322032 CCTCCCTCCAGGCTGTAAAGTGG + Intronic
962352126 3:134663921-134663943 CCTCCCTTCTGGCTGTAGGGAGG - Intronic
962620634 3:137174573-137174595 GCTGCAGCCAGTCTGCAGGGTGG + Intergenic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
968542567 4:1175483-1175505 TCTCCAGCTAGGATGTAGGGCGG + Intronic
968805877 4:2772109-2772131 GCTCCCGTCATGCTGCAGTGGGG + Intergenic
970760754 4:19483422-19483444 TCTACCGCCAGGCTGGAGTGCGG - Intergenic
971019039 4:22516002-22516024 GCTCGCGCCGGGCGGTAGAGCGG - Exonic
975710524 4:77157033-77157055 CCTCCCGCCTGGCGCTAGGGCGG - Intergenic
980360930 4:131754412-131754434 GCTCCACCCAGGATGGAGGGAGG + Intergenic
980362013 4:131759367-131759389 GCTCCACCCAGGATGGAGGGAGG + Intergenic
985922559 5:2990140-2990162 GAACCCGCCAGGCTGTGGGCAGG - Intergenic
997470692 5:134115310-134115332 TCTCCCTCCAGGCTCTCGGGCGG + Exonic
997560256 5:134840268-134840290 TCTGTCGCCAGGCTGTAGTGGGG - Intronic
999763694 5:154722376-154722398 GCTCTCCCCAGGCTGGTGGGTGG + Intronic
1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG + Intronic
1006352147 6:33528887-33528909 GCTACAGCCAGCCTGCAGGGTGG - Intergenic
1006746429 6:36346056-36346078 GTTCACGCCTGGCTGGAGGGTGG - Intergenic
1016136815 6:140554514-140554536 GGTCCCCCCAGGCTGTGGGTGGG + Intergenic
1017710918 6:157167143-157167165 GCGGGCGCCATGCTGTAGGGCGG - Exonic
1019354498 7:571673-571695 GCTGCCCCCAGGCTGTGGGGAGG + Intronic
1019522817 7:1468299-1468321 ACTCCAGCCAGGCTGCGGGGTGG - Intergenic
1022140174 7:27486934-27486956 GCTCCCGGAAGGCTGGAGGCTGG - Intergenic
1023557325 7:41436818-41436840 GCTCCTGCCAGACTCTTGGGTGG - Intergenic
1024292640 7:47816016-47816038 GCTTCCGCAAGCCTGAAGGGTGG + Intronic
1025142605 7:56478578-56478600 GCCACCTCCAGGCTGTGGGGTGG + Intergenic
1025289651 7:57704263-57704285 CCTCCCTCCAGGGTATAGGGTGG + Intergenic
1025708665 7:63889179-63889201 GCCACCTCCAGGCTGTGGGGTGG + Intergenic
1027632194 7:80620622-80620644 CCTTCCCCCAGGATGTAGGGTGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029640549 7:101816784-101816806 GCTCCGGCCAGGCGGGCGGGTGG + Intronic
1033241031 7:139680303-139680325 GCACCAGCCACGCTGTGGGGAGG - Intronic
1034414896 7:150959248-150959270 GCTCAAGCCAGGCTGGAGAGAGG + Intronic
1036402874 8:8426058-8426080 GTTCCCTCCAGGCTGGAGGAAGG + Intergenic
1036709579 8:11069416-11069438 GCTCTGGCCAGGCTCCAGGGAGG - Intronic
1037447216 8:18978079-18978101 GCTCCCACCTGACTTTAGGGAGG + Intronic
1037806267 8:22059373-22059395 GGTCCAGCCAGGCTGGAGGCCGG - Exonic
1037936931 8:22921331-22921353 GCTACCGGCAGGCTGTAGAGCGG - Intronic
1039330817 8:36534671-36534693 CCTTCCTCCAGGGTGTAGGGTGG + Intergenic
1039982277 8:42417914-42417936 GCTCCCGCAAGGCTGTGGACTGG - Exonic
1040503181 8:48023250-48023272 TCTATCGCCAGGCTGTAGTGCGG + Intronic
1041950450 8:63495363-63495385 CCTCCCGCTAGGGTATAGGGTGG - Intergenic
1049092441 8:140526337-140526359 GCTCCTGCCAGCCTGAAGGATGG + Intergenic
1049205481 8:141361636-141361658 GCCCCCGCCAGCCTGGAGGGAGG + Intronic
1049344326 8:142130377-142130399 GCTCCCTGGAAGCTGTAGGGTGG - Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049554478 8:143275199-143275221 GCTCCAACCAGGCTGAGGGGAGG - Intronic
1056078228 9:83062861-83062883 GCCCCCGCCAGGCGGGATGGAGG - Exonic
1056161657 9:83901834-83901856 TCTCTCGCCAGGCTGGAGTGTGG - Intronic
1056358471 9:85827374-85827396 TCTCTCGCCAGGCTGGAGTGTGG + Intergenic
1057385774 9:94604900-94604922 GTTCCCAGCAGGCTGCAGGGTGG - Intronic
1060201548 9:121654500-121654522 GCTGCAGCCAGGGTGTAGGGTGG + Intronic
1060980230 9:127787520-127787542 TCTCCCGCAAGGCTGTAATGGGG - Exonic
1061861882 9:133472498-133472520 GTGCCCACCAGGCTGCAGGGCGG - Intronic
1061903529 9:133685014-133685036 GCTCCCAACAGCCTGTAGGAGGG + Intronic
1062013314 9:134278358-134278380 CCCCCCGCCAGGCTGCAGGTTGG - Intergenic
1062721581 9:138047055-138047077 GTCCCCGCCAGGCTGTGGCGGGG + Intronic
1203610911 Un_KI270749v1:2679-2701 CCTCCCTCCAGGGTATAGGGTGG - Intergenic
1188916716 X:35920137-35920159 GCTCCTGCCGGGATGGAGGGAGG + Intronic
1200059061 X:153476021-153476043 GCCCCCCTCAGGCTGTGGGGTGG - Intronic