ID: 967038732

View in Genome Browser
Species Human (GRCh38)
Location 3:185669819-185669841
Sequence CACCCTATGCTGCTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967038729_967038732 24 Left 967038729 3:185669772-185669794 CCTATGTGACAGGAAAACAATAC 0: 1
1: 0
2: 0
3: 20
4: 241
Right 967038732 3:185669819-185669841 CACCCTATGCTGCTGTTCTCAGG 0: 1
1: 0
2: 2
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967038732 Original CRISPR CACCCTATGCTGCTGTTCTC AGG Intronic
900844076 1:5082218-5082240 GCCCATTTGCTGCTGTTCTCAGG + Intergenic
902366867 1:15981388-15981410 ACCCCCATGCTGCTGTTCTCAGG - Intergenic
902527904 1:17071270-17071292 TTCCCTGTGCTGCTGTGCTCGGG + Intronic
905456563 1:38092234-38092256 CACTTTACCCTGCTGTTCTCTGG + Intergenic
907663203 1:56412455-56412477 CTCCCTTTGCTGTTGTTCTCCGG - Intergenic
912648563 1:111418233-111418255 CACCCTCTGCTGCTCATCCCAGG + Intronic
915612642 1:157006865-157006887 GAGCTCATGCTGCTGTTCTCAGG - Intronic
918238948 1:182604784-182604806 CACCCTGTGCGCCTGTCCTCAGG - Intergenic
919371807 1:196738127-196738149 ATCCCCATGCTTCTGTTCTCAGG - Intronic
919820811 1:201470777-201470799 CTCCCTCTTCTGCTGCTCTCTGG - Intergenic
919919419 1:202159466-202159488 GGCCCTCCGCTGCTGTTCTCTGG + Intronic
920521579 1:206631405-206631427 CATCCTTTGCAGCTGTTCCCAGG - Intergenic
920597019 1:207282220-207282242 GACCATATCCTGCTTTTCTCAGG + Intergenic
921314514 1:213877647-213877669 CCCCCTTTGCTGATGTTCACTGG - Intergenic
922442155 1:225664800-225664822 CACCCTTTCTTGCTGCTCTCTGG + Intergenic
922485819 1:225972449-225972471 CAGCCCATGCTGCTGTGCCCCGG + Intergenic
1065049144 10:21773013-21773035 CCCCCTTTGGTGCTGTTCTCGGG - Intronic
1066962494 10:42235058-42235080 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1067476276 10:46568920-46568942 CACCCTGGGCTGCTGATCTCTGG + Intergenic
1067618461 10:47772860-47772882 CACCCTGGGCTGCTGATCTCTGG - Intergenic
1069519897 10:69110591-69110613 CACCCAATGCTCCTGCTCACTGG - Intergenic
1069987196 10:72292495-72292517 CAGCCTCTGCCGCTGCTCTCAGG - Intergenic
1071215379 10:83394438-83394460 CACGCCATGCTGCTGCTGTCAGG + Intergenic
1071429986 10:85599518-85599540 CTCCCTATGCTCTTATTCTCTGG - Intergenic
1071721277 10:88148818-88148840 CACCCTATGCTGTTCTTGTGAGG - Intergenic
1072744007 10:97927506-97927528 CATCCTAAGCTGCTGATGTCTGG + Intronic
1074556046 10:114491332-114491354 CCTCCCAGGCTGCTGTTCTCTGG - Intronic
1075312891 10:121429725-121429747 CACCTTATGCAGCTTTTTTCAGG + Intergenic
1076090130 10:127678346-127678368 CACCCTAGGCTACTTTTGTCTGG - Intergenic
1076289721 10:129335772-129335794 CACCCTATAGTGCTGTTGTGAGG - Intergenic
1076373375 10:129968483-129968505 CACCCTATCCCGCAGTTCCCGGG - Intergenic
1076426043 10:130368342-130368364 CACCCTATCCTCCTCATCTCTGG - Intergenic
1076645159 10:131948702-131948724 CACCATAACCTGCTGTTCACAGG - Intronic
1077065279 11:638248-638270 AGCCCTAAGCTGCTTTTCTCTGG - Intronic
1079106726 11:17576790-17576812 CACCCCATGTTGCTGCACTCGGG - Intronic
1079940302 11:26672234-26672256 CATGCTATTCTGCTGTTTTCTGG + Intronic
1080746959 11:35116739-35116761 CACCCTATGCTATGGTTCCCAGG + Intergenic
1083424701 11:62577197-62577219 CACCCTCCGCTGCTGGGCTCAGG - Exonic
1084007641 11:66331790-66331812 AAGCCTTTGCTGCTGTTCTGTGG + Intronic
1084280575 11:68088280-68088302 CACCATATCCTCCTATTCTCAGG - Intronic
1089304250 11:117516813-117516835 CACCCTGCGGTGCTCTTCTCAGG + Intronic
1090072965 11:123560359-123560381 CTCCCTCTGCTGCTGTTATTTGG - Intronic
1090901873 11:131039111-131039133 CACCCTATGCACAAGTTCTCTGG + Intergenic
1092921509 12:13235885-13235907 CACCCTATAATGCTGGTCTTGGG - Intergenic
1094658315 12:32441979-32442001 CACGCCATGCTGCTGCTCTCAGG + Intronic
1096257234 12:50070874-50070896 CACCTTCAGCTGCTGTCCTCAGG - Intronic
1098810751 12:75087756-75087778 CAGCCTGTGCTCATGTTCTCAGG - Intronic
1099691079 12:85952517-85952539 CCACCTCTGCTCCTGTTCTCAGG - Intergenic
1102260609 12:111440948-111440970 CACACTATGCTCATATTCTCAGG + Intronic
1108699645 13:52932988-52933010 CACCCTCTGCTGCTACCCTCTGG + Intergenic
1113065895 13:106374158-106374180 CACCCTTTGAGGGTGTTCTCTGG + Intergenic
1115253266 14:31372141-31372163 CACAAAATGCTGCTGTTCTAGGG + Intronic
1122658314 14:103278018-103278040 ACCTCCATGCTGCTGTTCTCAGG + Intergenic
1202929881 14_KI270725v1_random:27328-27350 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1123442581 15:20302437-20302459 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1123987780 15:25660008-25660030 CACCCTCTCCTGGTGTTCTGGGG - Intergenic
1126968394 15:54082933-54082955 CACCATCTCCTGCTGTGCTCCGG + Intronic
1127754970 15:62083367-62083389 CATCCTGTGCAGCTGTTCTCTGG - Intergenic
1127951116 15:63807230-63807252 CACCCTGTGAGGCTGTCCTCTGG + Intronic
1129744254 15:78007246-78007268 ATCCCTCTGCTGCTGTTGTCTGG - Intronic
1131076858 15:89500797-89500819 CTCCCTCTGCTGGTGATCTCAGG + Intergenic
1132517285 16:371623-371645 CTCCCTATGGTCCTGTTCCCTGG - Exonic
1135068305 16:19330358-19330380 ATCCCTATGCTGCTGGTCTAGGG + Intergenic
1136718625 16:32303099-32303121 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1136723659 16:32341475-32341497 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1136773284 16:32858860-32858882 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1136836997 16:33509363-33509385 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1136841992 16:33547520-33547542 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1136862328 16:33711444-33711466 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1136897331 16:34002659-34002681 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1139609984 16:68049067-68049089 CTCCCTTTGCTTCTATTCTCTGG + Intronic
1140300558 16:73753284-73753306 CACCCTTTGCTGGTTTCCTCTGG - Intergenic
1141262379 16:82465705-82465727 AACCCTATGCAGCTTTTCCCTGG + Intergenic
1203002772 16_KI270728v1_random:176290-176312 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1203007806 16_KI270728v1_random:214672-214694 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1203075705 16_KI270728v1_random:1120970-1120992 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1203123821 16_KI270728v1_random:1559627-1559649 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1203134378 16_KI270728v1_random:1712696-1712718 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1203147176 16_KI270728v1_random:1809642-1809664 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1203152157 16_KI270728v1_random:1847817-1847839 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1147274449 17:39303593-39303615 TACCCTGTGCCGCTGTGCTCAGG - Exonic
1147963816 17:44182427-44182449 CACCCCCTGGTGCTGTTCTGTGG + Intergenic
1149311547 17:55399097-55399119 CCACCCAGGCTGCTGTTCTCTGG + Intronic
1153497827 18:5718026-5718048 CACTTTATGATGCTGTTCTGGGG - Intergenic
1155336116 18:24767062-24767084 CTCCCAATGCTGCTGTTCACAGG + Intergenic
1156617441 18:38804137-38804159 CACCTTATTCTCCTGTTTTCTGG - Intergenic
1162867910 19:13562751-13562773 CACCATAGGTTGCTGTTTTCTGG - Intronic
1164828402 19:31301305-31301327 AAACCAATGCTGCTGTTCACTGG - Intronic
1168672835 19:58254491-58254513 CACCCTAGGCTGAGGTTCTGAGG - Intronic
1202692240 1_KI270712v1_random:100656-100678 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
925131761 2:1498649-1498671 CATCCTGGTCTGCTGTTCTCTGG - Intronic
925366407 2:3314968-3314990 CATCTTCTGCTGCTGCTCTCCGG + Intronic
928342374 2:30455947-30455969 CTCCCTACGCTTCTGTTTTCTGG + Intronic
928365265 2:30695708-30695730 CACCTTCTGCTGATGTTCTCTGG - Intergenic
928426062 2:31178785-31178807 CTCCCAGTGCTGCTGTGCTCTGG - Intronic
929086970 2:38177651-38177673 AAACCTATGGTGCTGGTCTCAGG - Intergenic
930053690 2:47236193-47236215 TACCCTATCCTGCTGTTCACAGG - Intergenic
930559959 2:52949215-52949237 ACCCCCATGCTGCTGTTCTCAGG - Intergenic
933491036 2:82985875-82985897 CACACTATGCTGGAATTCTCAGG - Intergenic
934460779 2:94212896-94212918 CACCCTGCCCTGCTGTGCTCCGG + Intergenic
934624282 2:95834495-95834517 CACCCGCCCCTGCTGTTCTCAGG - Intergenic
936015284 2:108954241-108954263 CACAATCTGCTGCTGGTCTCCGG - Intronic
941710201 2:168704288-168704310 CACGCGGTGCTGCTGGTCTCGGG + Intronic
942354782 2:175098686-175098708 CACCCCTTTCTGCTGTACTCAGG - Intronic
943131993 2:183865337-183865359 TACCAGCTGCTGCTGTTCTCTGG - Intergenic
943522920 2:188976078-188976100 CTCCCTATCCTGCTCTTCCCAGG + Intronic
944303802 2:198156594-198156616 TACCCCATGCTGCTGTTCTTGGG + Intronic
945222980 2:207503538-207503560 CACGCTCTGCTGCTGTTCTCTGG + Intergenic
946161985 2:217841037-217841059 CTCCCTCTTCTGTTGTTCTCTGG - Intronic
947717571 2:232349599-232349621 CACCCTGAGCTGCCTTTCTCAGG + Intergenic
947726863 2:232406666-232406688 CACCCTAAGCTGCCTTTCTCAGG + Intergenic
947815344 2:233032916-233032938 CACCCTTTGCTGCTGTGATCAGG + Intronic
948068182 2:235097762-235097784 CTCCCTAAGCTGTTGCTCTCTGG - Intergenic
948602870 2:239117191-239117213 CACCCTGTGTTCCTGTTCTCTGG - Intronic
1169319253 20:4617739-4617761 CAGCCTTTGCTGGTGCTCTCTGG - Intergenic
1171294770 20:24007946-24007968 CATCCTTTGCTGGTTTTCTCTGG + Intergenic
1171335923 20:24385374-24385396 CACTGTATGCTGTTGTGCTCTGG - Intergenic
1171465976 20:25328302-25328324 CACCCTGGGCTGCAGCTCTCAGG - Intronic
1174230298 20:49040829-49040851 CACCCGGTGCTGCTGCTTTCTGG - Intergenic
1174477461 20:50806303-50806325 CCGCCCAGGCTGCTGTTCTCAGG + Intronic
1175677336 20:60958076-60958098 CACCCTATTGTGCTGGTCCCTGG + Intergenic
1175720356 20:61281955-61281977 CCCAGTGTGCTGCTGTTCTCTGG - Intronic
1176307490 21:5131537-5131559 CAGCCCCTGCTGCTTTTCTCAGG - Intronic
1176591907 21:8655938-8655960 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1176908362 21:14532303-14532325 CACCCACTGCTGCTGGTCTTAGG + Intronic
1178000268 21:28154276-28154298 CTCCCTAAGCTGCTTTTCCCTGG + Intergenic
1179036629 21:37763590-37763612 CACCCTGTGCTTCTGGTATCTGG + Intronic
1179485372 21:41706559-41706581 TACACTGTGCTGCTTTTCTCTGG + Intergenic
1179822055 21:43942743-43942765 CACCCTGGGCTGCTGTGGTCAGG + Intronic
1179849570 21:44130493-44130515 CAGCCCCTGCTGCTTTTCTCAGG + Intronic
1180274748 22:10633039-10633061 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1181347235 22:22228799-22228821 CACACCATGCCTCTGTTCTCAGG - Intergenic
1184683215 22:46084149-46084171 CACTCTCTGCTGCTGTTCACAGG + Intronic
949924294 3:9028737-9028759 CACCCTAAGTTGCTTTTCTTGGG + Intronic
950785757 3:15433979-15434001 CACCTCATGATGCAGTTCTCAGG + Intronic
951576761 3:24122484-24122506 CACCCAATCCTGATGTTCGCAGG - Exonic
953789666 3:45937670-45937692 CAGCCTCCGCTGCTCTTCTCAGG + Intronic
953820090 3:46200595-46200617 TACCTCATGCTGCTGTTCTGAGG - Intronic
955133030 3:56189431-56189453 CAACAGATGCTGCTGTTGTCAGG - Intronic
958532929 3:95357396-95357418 CCCCCTATGCTGCCGTTCACTGG + Intergenic
960844782 3:121995408-121995430 CACCCTATGTGGCTGTGTTCAGG - Intronic
960912204 3:122660888-122660910 CACCCTACACTGCTTTTCTAGGG + Intergenic
961502413 3:127346175-127346197 CACCTTGTGCTTCCGTTCTCAGG - Intergenic
962538331 3:136351718-136351740 CACCCAAGGCTGCCTTTCTCAGG + Intronic
963824724 3:149939857-149939879 CATCCTGCGCGGCTGTTCTCTGG - Intronic
964366665 3:155957850-155957872 CACCATGGGCTCCTGTTCTCAGG + Intergenic
964819455 3:160754998-160755020 CCCCCCTTTCTGCTGTTCTCGGG + Intergenic
967038732 3:185669819-185669841 CACCCTATGCTGCTGTTCTCAGG + Intronic
967145148 3:186600082-186600104 CAAGCTGTGCTGCTGCTCTCTGG - Intergenic
967254016 3:187571441-187571463 CTCCCCATGCTGTTCTTCTCAGG - Intergenic
968032497 3:195512333-195512355 CACCCTCTGCAGCCATTCTCAGG - Intergenic
971633172 4:29021570-29021592 CTCCCCATGCTGCTGTTCTCAGG - Intergenic
972159379 4:36204415-36204437 CTCCCTATCCTCCTTTTCTCAGG + Intronic
972814460 4:42628845-42628867 CACTCTGAGCTGATGTTCTCAGG + Intronic
982252339 4:153419915-153419937 ACCCCCATGCTGCTGTTCTCGGG - Intergenic
985729892 5:1541195-1541217 CCCCCCAGGCTGCTGTGCTCTGG + Intergenic
987636171 5:20545197-20545219 CAGCCTCTGCTGCTGCTTTCAGG + Intronic
989444590 5:41512237-41512259 CACCTAATGCTGGTGGTCTCAGG + Intergenic
995271170 5:110220762-110220784 CACCCACTGCCGGTGTTCTCAGG - Intergenic
998659269 5:144218154-144218176 GACCATATGCTTCTGTTCACAGG - Intronic
999481848 5:151955975-151955997 CATCCTATGCTACTCTTCTCAGG + Intergenic
1000188139 5:158881096-158881118 CAACCTCTGCTTCTGTCCTCAGG - Intronic
1001180114 5:169512596-169512618 CACCCTCTGCTCCTGTTGCCAGG + Intergenic
1012586927 6:100934661-100934683 CAACCTATTCTACTGTTTTCTGG - Intergenic
1012816331 6:104026823-104026845 CATCCTATGTGGCTATTCTCTGG - Intergenic
1014677668 6:124387509-124387531 CACCTAATGCTGTTGTTTTCTGG - Intronic
1014977637 6:127908503-127908525 CAACCTGTGCTCCTGTTCTGTGG - Intronic
1015111348 6:129595503-129595525 TGCCACATGCTGCTGTTCTCTGG + Intronic
1018065332 6:160121755-160121777 TACCCTATGGTGCTGGTTTCAGG - Intergenic
1018394806 6:163370053-163370075 CACCCCATCCTGCTGCTCTGTGG + Intergenic
1018446530 6:163863725-163863747 CCCACTGTGCTGCTGTTGTCTGG + Intergenic
1018980318 6:168596571-168596593 CATCCTCAGCTGCTGCTCTCCGG + Intronic
1020769835 7:12376259-12376281 CAGACTATGCTGCTATTCACAGG - Intronic
1021615068 7:22494652-22494674 CACCCTAGTCTGCTGATATCTGG - Intronic
1022053441 7:26703065-26703087 CAGCCCATGCTGCTGGTCCCAGG + Intronic
1022230137 7:28406448-28406470 CAGCCTATACTCCTGTTCTGTGG + Intronic
1022648515 7:32253930-32253952 CTCCCTAGGATGGTGTTCTCAGG - Intronic
1026889941 7:73975976-73975998 CAGCCTGGGCTGCAGTTCTCAGG - Intergenic
1028377428 7:90159971-90159993 CACCCTAGTCTGCTGATATCTGG + Intronic
1030007775 7:105135432-105135454 TTCCCTCTGCTGCTGCTCTCTGG - Intronic
1030722247 7:112884123-112884145 ACCCCCATGCTGCTGTTCTCAGG - Intronic
1033412343 7:141129715-141129737 CACCCTGGGCACCTGTTCTCAGG - Intronic
1034116998 7:148592209-148592231 CAGTTCATGCTGCTGTTCTCAGG - Intronic
1034844416 7:154431158-154431180 CATCCTTGGCAGCTGTTCTCAGG - Intronic
1035134551 7:156688608-156688630 CCTCCTCTGCTGCTGCTCTCTGG + Intronic
1035716386 8:1758413-1758435 CACCTTATGCAGCAGTTCTTAGG - Intronic
1035746459 8:1964934-1964956 CACTCAATGCTGCTGTCCTGGGG + Intergenic
1036617039 8:10396236-10396258 CAGCCACTGCTGCCGTTCTCAGG + Intronic
1037994155 8:23340678-23340700 CACCCTGAGCTGGGGTTCTCTGG + Intronic
1038254995 8:25942847-25942869 CACGCTCTTCTGCTGTTCACAGG + Intronic
1038432630 8:27512275-27512297 CTCCCTAGCCTGCTGTTCTATGG - Intronic
1041745315 8:61202269-61202291 CATCCTGTGTGGCTGTTCTCTGG + Intronic
1042175457 8:66033614-66033636 CACCCTCTGCTCCTGTGATCTGG - Intronic
1044414741 8:91924865-91924887 CAGCCCATGCTGCTGCTCTATGG + Intergenic
1046211489 8:111081724-111081746 CACACCATGCTGCTGTTGCCAGG + Intergenic
1048223195 8:132562147-132562169 CAGTCTCTGCTGCTGTTCTTTGG - Intergenic
1049763921 8:144344078-144344100 CACCCTCAGCTGCTCTACTCTGG + Intergenic
1053490774 9:38499963-38499985 CACTGTATTCTGCTGCTCTCTGG - Intergenic
1053691277 9:40588594-40588616 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1054273525 9:63048891-63048913 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1054302537 9:63389565-63389587 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1054401309 9:64716065-64716087 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1054434917 9:65200385-65200407 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1054495472 9:65821296-65821318 CACCCTGCCCTGCTGTGCTCTGG - Intergenic
1056310185 9:85332927-85332949 CTCTCTATGCCTCTGTTCTCTGG - Intergenic
1056310379 9:85334817-85334839 CTCTCTATGCCTCTGTTCTCTGG + Intergenic
1057037827 9:91824670-91824692 CACCCGAGGCAGCTGTCCTCTGG + Intronic
1057539837 9:95956725-95956747 ATACCCATGCTGCTGTTCTCAGG - Intronic
1060121861 9:120999029-120999051 CACCCTCCCCTGCTGTTCTAAGG - Intronic
1060793488 9:126500516-126500538 AACCCCATGCTGCTGGTCTGGGG - Intronic
1062033684 9:134373236-134373258 CAGCCTTTGGTGCTGTTCTTGGG + Intronic
1203621947 Un_KI270749v1:134757-134779 CACCCTGCCCTGCTGTGCTCTGG + Intergenic
1190492352 X:50994605-50994627 AACTCTATGTTGCTGTTCTGTGG - Intergenic
1191904683 X:66076054-66076076 CACCCTACACTGCTTTTCTAGGG - Intergenic
1192132496 X:68565662-68565684 CACCCTAAGCACATGTTCTCAGG + Intergenic
1195104832 X:101593798-101593820 CAACCCCTGCTGGTGTTCTCTGG - Intergenic
1198434871 X:136607430-136607452 CACCCTGGGCAGATGTTCTCAGG - Intergenic
1201189956 Y:11437237-11437259 CACCCTGCCCTGCTGTGCTCTGG + Intergenic