ID: 967046343

View in Genome Browser
Species Human (GRCh38)
Location 3:185740717-185740739
Sequence TCTAACCTTTACTAGGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967046343_967046347 10 Left 967046343 3:185740717-185740739 CCATATACCTAGTAAAGGTTAGA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 967046347 3:185740750-185740772 AAGCTTGAGTCTGCCCAAACTGG 0: 1
1: 0
2: 1
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967046343 Original CRISPR TCTAACCTTTACTAGGTATA TGG (reversed) Intronic
903582921 1:24385641-24385663 TCTGACATTTACTAGTTATGTGG - Intronic
907642859 1:56208920-56208942 TTAAGCCTTTATTAGGTATATGG - Intergenic
909435517 1:75636440-75636462 TCTACCATTTGCTAGATATAGGG + Intergenic
909657571 1:78047625-78047647 TCTACCCTTTACTAGCTGTGTGG + Intronic
911430500 1:97779855-97779877 TCTAACTTTTACTAGCTGTAGGG + Intronic
911529958 1:99032487-99032509 TCTCCCCTTTACTAGCTATGTGG - Intergenic
912310407 1:108615188-108615210 TCTGCCCTTTACTAGTTATCTGG + Intronic
913114838 1:115686621-115686643 TCTACCCTCTATTAGATATATGG + Intronic
917007947 1:170436413-170436435 CCTAACCTTTAGTAGGCTTATGG - Intergenic
918821821 1:189266405-189266427 TCTATCTTTTCCTAGGTAAAAGG + Intergenic
922379078 1:225002911-225002933 ACTCACCTTTACAAGGCATATGG - Exonic
923661460 1:235960770-235960792 TCTTACCTTTATTAAGTCTATGG - Intergenic
1064056121 10:12098995-12099017 TTTAATCTTTACTAGCGATAAGG - Intronic
1064920711 10:20514732-20514754 TCTACCATTTACTAGTTGTATGG + Intergenic
1065299850 10:24311467-24311489 TCTAATATTTGCTAGGGATATGG + Intronic
1066125834 10:32341937-32341959 TCTAACATTTTATAGGCATATGG + Intronic
1066143420 10:32530666-32530688 TCTAGGTTTTTCTAGGTATAAGG + Intronic
1068110519 10:52674819-52674841 TCTAAAATTTACCAGTTATATGG - Intergenic
1074304811 10:112267422-112267444 TCTAAGTGTTACTAGTTATAGGG - Intergenic
1079889416 11:26031932-26031954 TCTAAACTTTACTGAGTATCTGG + Intergenic
1079927627 11:26514514-26514536 TCTACCATTTACTAGCTCTATGG - Intronic
1081056151 11:38413088-38413110 TCTAAGCTTTACCAAGTTTAAGG - Intergenic
1083049491 11:59764447-59764469 TCTACCATTTAATAGCTATATGG - Intronic
1083284406 11:61648911-61648933 TCTAGCCTTTACAAGGGTTATGG + Intergenic
1086239822 11:84676058-84676080 TCTGACCTTTACTAGTAACAAGG + Intronic
1091414259 12:267259-267281 TCTACCATTTACTAGTTATGTGG - Intergenic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1093431207 12:19087335-19087357 CCTAACCTTTTCTAAATATAGGG - Intergenic
1093965360 12:25318776-25318798 TCTAACTCTTACTAGCTGTATGG - Intergenic
1095181099 12:39147152-39147174 TTTAAGATTTACGAGGTATATGG + Intergenic
1095331691 12:40973199-40973221 TCTACCATTTAATAGGAATATGG - Intronic
1095504694 12:42882624-42882646 TCTCAGTTTTACCAGGTATAAGG - Intergenic
1097390898 12:59011551-59011573 TCTACCCTTTATTAGCTATGTGG - Intergenic
1100739001 12:97570672-97570694 TCTGACCTTTACCAAGAATATGG - Intergenic
1102611296 12:114114693-114114715 TGTGGCCTTTCCTAGGTATAGGG + Intergenic
1102711396 12:114930753-114930775 TCAATCCCTTACTAGATATATGG + Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1105589430 13:21777407-21777429 TCCACCCTTTACTAGCTATGTGG + Intergenic
1105890154 13:24676828-24676850 TTTAAGCTGTACTAGATATAGGG - Intergenic
1106595271 13:31130065-31130087 TCTAACCATGAGTAGGTAGAGGG - Intergenic
1108671911 13:52699067-52699089 TCTAAACTTTACTGGAAATAAGG - Intronic
1110270895 13:73589230-73589252 TCTAAGATTTTCTAGTTATAGGG - Intergenic
1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG + Intergenic
1116050653 14:39798875-39798897 TCTCACATTTGCTAGGTGTATGG + Intergenic
1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG + Intronic
1129151014 15:73687770-73687792 TCTGACCTTCTCTAGGCATAGGG + Intronic
1130043159 15:80422261-80422283 TCAAACCTTAACTAGATGTAGGG + Intronic
1131623737 15:94096084-94096106 TCTACCATTTACTAGCTACACGG + Intergenic
1135689803 16:24527111-24527133 TCTAATCTTAACTAGATTTAGGG + Intergenic
1138708747 16:58944859-58944881 TTTAACATTTTCTAGCTATATGG + Intergenic
1139619569 16:68126643-68126665 TCTAATCATCACTAGGTGTATGG - Intronic
1152213827 17:79020569-79020591 TCTACCCTTGACTAAGAATATGG + Intergenic
1161807405 19:6452637-6452659 TGTAACTATTTCTAGGTATAGGG - Intronic
931908165 2:66865330-66865352 TCTAAACTTCACTGGGCATAAGG + Intergenic
935627344 2:105182045-105182067 TCTAATCTTTACAAGGCAGATGG - Intergenic
944797494 2:203203001-203203023 TCTTACCTTTCCTAGGAAAACGG + Intronic
946910730 2:224457910-224457932 TCTAAGCTTAACTTGGTTTACGG - Intergenic
947205004 2:227652638-227652660 TCTAACCTTTGCAAGGAAGATGG + Intergenic
1174971811 20:55284634-55284656 TCTAAGCTTTAAATGGTATATGG + Intergenic
1177091386 21:16773288-16773310 TCTAACTATTATTAGGGATATGG - Intergenic
951618577 3:24576003-24576025 TTTAACATTTACTACCTATATGG - Intergenic
951852994 3:27163757-27163779 TCATACATGTACTAGGTATAAGG + Intronic
952383954 3:32825621-32825643 TTTAACCTTTATTAGTTTTATGG - Intronic
954043474 3:47908665-47908687 TTTAATCATTACTTGGTATAAGG - Intronic
955615948 3:60806686-60806708 TCTAACCTTAAGTAGTTAAAAGG - Intronic
957566075 3:81885790-81885812 TCTAACATTTTCTAGCTGTATGG + Intergenic
959289650 3:104457632-104457654 TCTGGGCTGTACTAGGTATAAGG + Intergenic
959369836 3:105509620-105509642 TCAACCCTTTATCAGGTATATGG + Intronic
961546297 3:127636275-127636297 TCTATCCCCTACTAGGTAGATGG - Intronic
964036996 3:152211183-152211205 TAAAACCTTGAATAGGTATATGG + Intergenic
967046343 3:185740717-185740739 TCTAACCTTTACTAGGTATATGG - Intronic
967236201 3:187385799-187385821 TCTCAACTTTACTAGCCATAAGG - Intergenic
968020883 3:195387985-195388007 TCTATCATTTACTAGCAATATGG - Intronic
970704607 4:18784848-18784870 TGTAACCTTTCCTAGGTGTGGGG - Intergenic
971650831 4:29271278-29271300 TCTAACCTTTACAAAGAAAAAGG + Intergenic
973290495 4:48465749-48465771 TCCATCCTGTACTAGGTAGAAGG + Intergenic
974208528 4:58739503-58739525 TCTTACATTTACTAGCTATAGGG - Intergenic
974268061 4:59611616-59611638 TTTAACCATTAATAGGTATGAGG + Intergenic
976452851 4:85211538-85211560 ATAAACCTTTATTAGGTATATGG + Intergenic
976814334 4:89129472-89129494 ACCAACATTTACTAGGTAGATGG - Intergenic
976953132 4:90858669-90858691 TCTTACCTTTACCACGTCTATGG + Intronic
978615436 4:110589052-110589074 TCTAATTTTTCTTAGGTATATGG + Intergenic
979219472 4:118205706-118205728 TCAACTCTTTACTAGTTATATGG + Intronic
979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG + Intergenic
979802183 4:124924141-124924163 TCTAACATTTACTATCTATTTGG - Intergenic
980097096 4:128502280-128502302 TTTAACATTTAATATGTATATGG + Intergenic
980375116 4:131936106-131936128 TCTAAACTTTACCAGGAAAAGGG + Intergenic
980730566 4:136818817-136818839 TCAAACCTTTATGAGATATATGG - Intergenic
981693022 4:147530331-147530353 TCTTAGCTTTACTGGGTATCAGG + Intronic
981873407 4:149513398-149513420 TTTAACATTTACTATTTATAAGG - Intergenic
982805548 4:159758465-159758487 TCTGATCTTTACTAGACATATGG + Intergenic
982973890 4:162027249-162027271 AATAACTTTTTCTAGGTATAAGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
987410143 5:17606686-17606708 TCTAAACTTTACCAAGTATGGGG + Intergenic
987410800 5:17612892-17612914 TCTAAACTTTACCAAGTATGGGG + Intergenic
987413356 5:17636363-17636385 TCTAAACTTTACCAAGTATGGGG + Intergenic
987553521 5:19414879-19414901 TGTAACCAATACTAGGCATAGGG - Intergenic
989209124 5:38842777-38842799 TTTAACCTTTACTAAGTTAATGG - Intergenic
990032935 5:51283643-51283665 TCCCACCTTTCATAGGTATATGG - Intergenic
992471647 5:77062448-77062470 TCTATCATTTACTAGCTATGTGG + Intronic
992538532 5:77738342-77738364 TCTGACCTTTGCTATATATATGG + Intronic
993395211 5:87377813-87377835 TCTAAACTTTACTATTTATTTGG - Intronic
994042083 5:95270426-95270448 TGTAACATTTATTATGTATAAGG - Intronic
995686148 5:114774313-114774335 TATAACCTTTTCTAAGTTTAGGG - Intergenic
998594779 5:143517129-143517151 TCTATCACTTACTAGTTATATGG + Intergenic
1001881377 5:175247326-175247348 TCTTGCCTTTACTAGGTTTATGG - Intergenic
1008073938 6:47126563-47126585 TCAAAAATTTACAAGGTATACGG - Intergenic
1009626147 6:66140713-66140735 TCTAACATGTAGTAGGGATATGG + Intergenic
1009682196 6:66910303-66910325 TCCAACTTTTATTAGGTTTAAGG + Intergenic
1009950708 6:70392378-70392400 TCTAACCTCTACCAGGGAAATGG - Intergenic
1011647168 6:89470936-89470958 CCTAATCTTTACTAGTTTTATGG + Intronic
1014245447 6:119063100-119063122 TCTCCTATTTACTAGGTATATGG - Intronic
1016108984 6:140197778-140197800 ATTAACCTTTATTAGATATATGG - Intergenic
1017210331 6:151848616-151848638 TCTAACCTTTTCCAGACATAGGG - Intronic
1022130349 7:27399389-27399411 TCTAACCTTTACTTGTGTTATGG - Intergenic
1022816095 7:33915867-33915889 TCTACCCTTTAATAGTTGTATGG + Intronic
1026424385 7:70275514-70275536 TCTAACCATTTTTAAGTATATGG - Intronic
1028081157 7:86578593-86578615 TCAAACATTTACCAGCTATATGG + Intergenic
1028501579 7:91524904-91524926 ATTAACCTTTACTAGATATATGG - Intergenic
1030502169 7:110373198-110373220 TCTGCCCTTTACCTGGTATATGG + Intergenic
1031833760 7:126657498-126657520 TCTAACGTTTACTAATTATTAGG + Intronic
1031920552 7:127597457-127597479 TCTAAACCTTACTAATTATAAGG - Intronic
1032507510 7:132446794-132446816 TCTACCGCTTACTAGTTATATGG - Intronic
1048436347 8:134422108-134422130 TCTGAGCATTACTAGGTCTAGGG - Intergenic
1048489411 8:134878683-134878705 TCTAACCTTGACCAGCTATGTGG + Intergenic
1055162645 9:73149360-73149382 TCTAAGCATTACTTGTTATATGG - Intergenic
1056034212 9:82586310-82586332 TTTAACTTTTACTAGGACTAGGG + Intergenic
1058044822 9:100346308-100346330 TCTTACCCTTATTAGGTATCTGG - Exonic
1058347868 9:103985897-103985919 TTTAAGGTTTTCTAGGTATAAGG - Intergenic
1059301759 9:113319378-113319400 TCTACCATTTACTAGGGATGTGG + Intronic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1060451370 9:123743873-123743895 TCTACCCCTTACTAGATCTAAGG - Intronic
1187047823 X:15665312-15665334 TCTAACCTTAAGTAGGTAAGAGG - Intergenic
1190588448 X:51971828-51971850 TCAACCCTTTATCAGGTATATGG - Intergenic
1193842579 X:86425686-86425708 TCTAACCTTTATTATATTTAAGG + Intronic
1195343728 X:103928225-103928247 TCTGACCTTTCCTATCTATAAGG + Intronic
1195363259 X:104105107-104105129 TCTGACCTTTCCTATCTATAAGG - Exonic
1199349628 X:146785872-146785894 TATAACCTTGACTAAGCATAAGG + Intergenic
1200303866 X:155005805-155005827 TCCCACCTTTACCAGGAATAAGG - Intronic