ID: 967046427

View in Genome Browser
Species Human (GRCh38)
Location 3:185741518-185741540
Sequence TAGCAGTTATTCATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967046427_967046433 29 Left 967046427 3:185741518-185741540 CCCTGTCCCATGAATAACTGCTA 0: 1
1: 0
2: 0
3: 14
4: 132
Right 967046433 3:185741570-185741592 TCTGAACAGAGAAAAATTCCAGG 0: 1
1: 0
2: 2
3: 39
4: 390
967046427_967046431 -1 Left 967046427 3:185741518-185741540 CCCTGTCCCATGAATAACTGCTA 0: 1
1: 0
2: 0
3: 14
4: 132
Right 967046431 3:185741540-185741562 ATTTGTCATTGTCAAAAACCTGG 0: 1
1: 0
2: 0
3: 24
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967046427 Original CRISPR TAGCAGTTATTCATGGGACA GGG (reversed) Intronic
910119126 1:83765304-83765326 TAGCATTTATTTATGGGGCAGGG + Intergenic
910723136 1:90309701-90309723 TGGCGGTTATACATGGGAAAGGG - Intergenic
912686977 1:111775587-111775609 TAATATTTATTCATGGGAAAAGG - Intronic
918098779 1:181355662-181355684 GAGCACTTAATCATGGGACCTGG - Intergenic
919495767 1:198266001-198266023 TAGAGGTTATTTCTGGGACATGG - Intronic
1063743582 10:8854117-8854139 TATCAAGTATTTATGGGACATGG - Intergenic
1063960071 10:11299569-11299591 TAGCATTTAATGATGGGACCGGG - Intronic
1065544539 10:26806174-26806196 AAGCAGATATTCTTGGGGCAAGG - Intronic
1069478087 10:68754114-68754136 TAGCAGTTATTCATAATAAAAGG + Intronic
1070869436 10:79737353-79737375 CAGAAGTTATTCATGGGACTGGG - Intergenic
1071636354 10:87259559-87259581 CAGAAGTTATTCATGGGACTGGG - Intergenic
1071658887 10:87478392-87478414 CAGAAGTTATTCATGGGACTGGG + Intergenic
1071917603 10:90312815-90312837 TAGTAGTTTTTTATGGGACTTGG + Intergenic
1072010200 10:91296581-91296603 TAGCTGGCAGTCATGGGACAGGG - Intergenic
1080963941 11:37193191-37193213 TAGAAGTTACTCATGGAAGAAGG + Intergenic
1095751805 12:45720622-45720644 TAGCAGTTATAAATTGTACAAGG + Intergenic
1099136936 12:78917279-78917301 TGGCAGTTTTTCATGAGTCATGG + Intronic
1100032634 12:90211274-90211296 TTACAGTTAGTCATGGGAGATGG + Intergenic
1101242461 12:102851875-102851897 TATCACTTATTCCTGGGAGAGGG - Intronic
1102585291 12:113918696-113918718 TAGATGTCATTCAAGGGACACGG + Intronic
1102805520 12:115776471-115776493 TAGCAGGAATACATGGGAAAGGG + Intergenic
1103713490 12:122929770-122929792 AAGCGGTGATCCATGGGACATGG + Exonic
1105315518 13:19257505-19257527 TAGCAGTAATTCAAGAGTCAAGG + Intergenic
1114522722 14:23349002-23349024 TAGCAGTAAGTCCAGGGACAAGG - Intronic
1116385912 14:44329684-44329706 TAAGAGTTATTAATGGGACAAGG + Intergenic
1116441426 14:44958750-44958772 TTGCAGTTTTTCAGTGGACAGGG - Intronic
1122128927 14:99593945-99593967 TAGTAATTATTCAGGGGAAATGG + Intronic
1129592266 15:76927619-76927641 TAGCAGTTATTTATGAGAATGGG + Intergenic
1130239469 15:82173392-82173414 TGGGAGTTATTGATGGGATAAGG + Intronic
1133663852 16:7945971-7945993 AAGCAATTAATCCTGGGACAGGG + Intergenic
1135579310 16:23611758-23611780 TATTAGTTATTTTTGGGACAGGG + Intronic
1137809696 16:51341008-51341030 TAAAAGTTATTCATTGGAAAGGG - Intergenic
1139310072 16:66020908-66020930 TAGCAGTCATTCAGGGGGAAGGG - Intergenic
1146987321 17:37232612-37232634 TAGCAGTGACTTATGGAACATGG - Intronic
1147595728 17:41715923-41715945 GATCAGTTTTTCAGGGGACAGGG - Exonic
1148085978 17:44994120-44994142 TAGAAGTGCTGCATGGGACATGG - Intergenic
1152454631 17:80406647-80406669 TCGCTGCTATTCATGGGGCAGGG - Intergenic
1153962677 18:10152842-10152864 TTCCAGTTTTTGATGGGACATGG + Intergenic
1154946492 18:21166746-21166768 GAGCTTTTACTCATGGGACAAGG - Intergenic
1155016570 18:21846938-21846960 TTGCAGTTAATAATGGGACTTGG + Exonic
1156689519 18:39691023-39691045 TAGCAGTTTCTCATGTGTCATGG - Intergenic
1166090894 19:40508206-40508228 TACCAGATATGGATGGGACATGG + Intronic
925499204 2:4485497-4485519 TAGCAAGTATTCATGGGTCCAGG - Intergenic
926965849 2:18409898-18409920 TAGCAGTAATGCATGAGAAAAGG + Intergenic
927378998 2:22455485-22455507 TGGCATTTATTCATATGACAAGG + Intergenic
932928257 2:76002498-76002520 TATCAGGTAGTCATCGGACAAGG + Intergenic
934662889 2:96152646-96152668 ATGCAGTGATTCAGGGGACAGGG + Intergenic
936473691 2:112821513-112821535 TAAAAGGTATTCATGGGACGTGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937509176 2:122574246-122574268 TAGCAAATATGCATGGAACAAGG - Intergenic
937915636 2:127097471-127097493 AAGCAGGCATGCATGGGACAGGG + Intronic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
939198534 2:139004031-139004053 TAGTAATTATTCAGTGGACATGG + Intergenic
940215358 2:151297902-151297924 TAGGAGGCATTCATGGGACTGGG + Intergenic
940569568 2:155413754-155413776 TATCAGTTATTCATGGTAGAGGG - Intergenic
941182634 2:162278849-162278871 TAGTAGTGATTCCTGGGGCATGG + Intronic
941585989 2:167360004-167360026 AAGCAGATATACATGGTACATGG - Intergenic
942274843 2:174313358-174313380 TAGCAGTGAATAATGGGACATGG + Intergenic
942506062 2:176642803-176642825 TGGCTGTTATTGCTGGGACAGGG + Intergenic
943999353 2:194812662-194812684 TAGCACTGATTTATGCGACAAGG + Intergenic
946811260 2:223528579-223528601 TTGCAGTCCTTGATGGGACATGG - Intergenic
947057406 2:226122111-226122133 TAGCAGTGTGACATGGGACAAGG - Intergenic
948230516 2:236345672-236345694 CAGCAATTATTCATGGGCCCAGG - Intronic
948555214 2:238805015-238805037 TAGCAGTTATTTCTGGGAGGGGG - Intergenic
1170529217 20:17273271-17273293 TAACACTTATTCATGTGACATGG + Intronic
1174946599 20:54993260-54993282 TACCAGTTATTCATGGGGGGAGG + Intergenic
1175003121 20:55651807-55651829 TAGCTGGTCTTTATGGGACATGG - Intergenic
1176346458 21:5752770-5752792 TAGCAGTTTTTCACAGGGCATGG + Intergenic
1176353272 21:5873354-5873376 TAGCAGTTTTTCACAGGGCATGG + Intergenic
1176498369 21:7571685-7571707 TAGCAGTTTTTCACAGGGCATGG - Intergenic
1176540779 21:8150840-8150862 TAGCAGTTTTTCACAGGGCATGG + Intergenic
1176559730 21:8333885-8333907 TAGCAGTTTTTCACAGGGCATGG + Intergenic
1179391707 21:40998528-40998550 TAGAAGTTATACATTGGAGAAGG - Intergenic
1182949637 22:34361001-34361023 TAGTAGGTATACATGGGCCATGG - Intergenic
1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG + Intronic
952401755 3:32969800-32969822 TAGCAGTGAGTCATGGCACATGG - Intergenic
955523100 3:59793973-59793995 GAGCATTTTTCCATGGGACACGG + Intronic
956906400 3:73770454-73770476 CAGCAATTATTCATGAGACAAGG - Intergenic
957168595 3:76708403-76708425 TAGCTGTTATTTCTGGGAAATGG + Intronic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
958140282 3:89553657-89553679 TACTAGTTATTCAAGGGAAATGG + Intergenic
958575781 3:95948865-95948887 TAGCAGTGAGTCAGGTGACACGG + Intergenic
958739950 3:98057000-98057022 TAGCTGGAATTCCTGGGACAGGG + Intergenic
959189879 3:103097546-103097568 TATCAGTTATTCGGGGCACAAGG + Intergenic
959545732 3:107594075-107594097 TAGCAGTTATTTAGTAGACAAGG + Intronic
959746563 3:109782081-109782103 GAGCTGTTATTCATGGCAGAAGG + Intergenic
962494723 3:135927525-135927547 TAGCAGTTTGTCATGTGACTTGG + Intergenic
964050971 3:152393167-152393189 AAGCAGGTATTCATGGAAAAGGG - Intronic
967010271 3:185426409-185426431 TACAAGCTATTCATGGGATATGG + Intronic
967046427 3:185741518-185741540 TAGCAGTTATTCATGGGACAGGG - Intronic
974325522 4:60409263-60409285 TAGCTGTTACTCATGGCAGAAGG - Intergenic
975673990 4:76808868-76808890 GAGCATTTACTCATGGGAGAAGG + Intergenic
975993125 4:80281318-80281340 TAGAAGTGATGCATGTGACAAGG + Intronic
977148764 4:93481705-93481727 TAGCACATATTGATGGGAAATGG - Intronic
979523996 4:121698116-121698138 CAGGAGGTATTCATGGGACTGGG + Intergenic
981036112 4:140170303-140170325 TAGCAGTTATGCATGGTGCCTGG - Intergenic
982904536 4:161050805-161050827 TAACACATTTTCATGGGACATGG + Intergenic
985654219 5:1121672-1121694 TTCCAGTCATCCATGGGACAAGG - Intergenic
986724563 5:10584652-10584674 TAGCAAATATTTATTGGACAGGG + Intronic
988195129 5:27995265-27995287 TGGCTTTTATTCATGGGAGAGGG + Intergenic
995066553 5:107869293-107869315 TAGCAGATATCCATGGAACCTGG + Intronic
996429113 5:123351210-123351232 TAGTAGTTATTGTTGGGAAAAGG - Intronic
997819758 5:137054525-137054547 TAGCTGCTGCTCATGGGACAAGG + Intronic
999236807 5:150103459-150103481 TAGTAGTCTTTCCTGGGACATGG + Intronic
999529168 5:152443254-152443276 TGGCAGATAATCATGAGACAGGG - Intergenic
999864343 5:155684431-155684453 TCACAGTCATTCATGGGCCAAGG + Intergenic
1000562858 5:162812197-162812219 TAACAGTTAGTCATGGGACTGGG - Intergenic
1002001468 5:176198752-176198774 TAACAGGTATACATGGGCCATGG - Intergenic
1002252872 5:177940227-177940249 TAACAGGTATACATGGGCCACGG + Intergenic
1003009437 6:2412844-2412866 TAGCCGTTATTCTTGGCACATGG - Intergenic
1003633336 6:7808509-7808531 TTGCATTTATTCTTAGGACATGG + Intronic
1007356635 6:41323447-41323469 TAGCAGTGTTTCAGGGTACAAGG - Intergenic
1009380093 6:63016943-63016965 TATTAGTGATTCATGGGAGAAGG + Intergenic
1009557453 6:65191861-65191883 TAGCAGTTGTAAATGGCACAAGG - Intronic
1012307741 6:97680028-97680050 TTGCCGTTTTTCATGGGGCAAGG + Intergenic
1012988344 6:105898835-105898857 TAGCAGTTCATCAAGGGAAAAGG - Intergenic
1015794737 6:136999748-136999770 TGGCAGTTAGTAATGGGACCTGG + Intergenic
1016438767 6:144063609-144063631 TGGCAGTTATTCAAGGGTCGTGG - Intronic
1016936999 6:149454964-149454986 TAGCAGCTATTCCCAGGACATGG - Intronic
1023845685 7:44118956-44118978 TGGCAGTTATTTGTGGGACAGGG - Intronic
1027925853 7:84462844-84462866 TAGCAGTTGTTCATCTCACAAGG + Intronic
1030485177 7:110156502-110156524 GAGCAGTAATTCATGGAACTGGG + Intergenic
1031228660 7:119075287-119075309 TAGCACATATTAATGGGAAAGGG - Intergenic
1033843640 7:145404680-145404702 GAGCTTTTATTCATGGGAGAAGG - Intergenic
1035578080 8:721019-721041 TATGAGTAATTCATGGGTCATGG - Intronic
1039602523 8:38852487-38852509 TAGCAGTTAATGATGTGACCAGG - Exonic
1041945383 8:63434828-63434850 TAATAGTTATTGATGGGAGAAGG + Intergenic
1042446634 8:68892273-68892295 TAGCAGATATTAATTGGATATGG + Intergenic
1044098105 8:88094781-88094803 TAACAGTTTTTCATGAGACCTGG - Intronic
1044141002 8:88652495-88652517 TATCAGTTCTTCCTGGGACACGG + Intergenic
1046170420 8:110498157-110498179 TAGCAGTTTTTCAAGGTGCATGG - Intergenic
1046808713 8:118508597-118508619 CAGCAGTTATGCAAGTGACATGG - Intronic
1047566569 8:126050289-126050311 TTGCTGTAAATCATGGGACATGG + Intergenic
1048588303 8:135796637-135796659 TAGCATTTATTCATAGAACTTGG - Intergenic
1050262256 9:3852870-3852892 TAGCAGTTTCTCATTGGCCATGG + Intronic
1057786449 9:98091660-98091682 TAGCAGTTATTCACAGAAGAGGG + Intronic
1058251500 9:102702509-102702531 TACCAGTTATTTCTGAGACACGG - Intergenic
1060762317 9:126265996-126266018 TAGCATTTATTGCTGGGAGAAGG - Intergenic
1060792383 9:126495237-126495259 TAGCATTTATTCAGTGGCCAGGG + Intronic
1061577341 9:131515280-131515302 TAGCAGCAACTCATGGGACTGGG + Intronic
1193256659 X:79356391-79356413 TAGCAGTTTTTCATTGAAAATGG - Intergenic
1194922370 X:99781660-99781682 GAGCATTTATTCATGGCATAAGG + Intergenic
1196535446 X:116838372-116838394 TGCCAGTTATTCAGGGCACAAGG + Intergenic
1197775761 X:130117807-130117829 CAGCAGTTATTCATGGCTGAGGG - Intergenic
1199247476 X:145623578-145623600 TTGTAGTTATTCATGGACCATGG + Intergenic