ID: 967050398

View in Genome Browser
Species Human (GRCh38)
Location 3:185778146-185778168
Sequence TTGTATTGGAATAAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967050398_967050402 5 Left 967050398 3:185778146-185778168 CCAACCTGCTTATTCCAATACAA 0: 1
1: 0
2: 3
3: 39
4: 238
Right 967050402 3:185778174-185778196 AGAGTAGCTGGAGCACGTCTTGG 0: 1
1: 0
2: 0
3: 17
4: 98
967050398_967050404 15 Left 967050398 3:185778146-185778168 CCAACCTGCTTATTCCAATACAA 0: 1
1: 0
2: 3
3: 39
4: 238
Right 967050404 3:185778184-185778206 GAGCACGTCTTGGCAGCTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 144
967050398_967050401 -7 Left 967050398 3:185778146-185778168 CCAACCTGCTTATTCCAATACAA 0: 1
1: 0
2: 3
3: 39
4: 238
Right 967050401 3:185778162-185778184 AATACAAAGTTGAGAGTAGCTGG 0: 1
1: 0
2: 1
3: 29
4: 206
967050398_967050403 14 Left 967050398 3:185778146-185778168 CCAACCTGCTTATTCCAATACAA 0: 1
1: 0
2: 3
3: 39
4: 238
Right 967050403 3:185778183-185778205 GGAGCACGTCTTGGCAGCTCAGG 0: 1
1: 0
2: 1
3: 19
4: 120
967050398_967050405 22 Left 967050398 3:185778146-185778168 CCAACCTGCTTATTCCAATACAA 0: 1
1: 0
2: 3
3: 39
4: 238
Right 967050405 3:185778191-185778213 TCTTGGCAGCTCAGGGCACAAGG 0: 2
1: 15
2: 26
3: 99
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967050398 Original CRISPR TTGTATTGGAATAAGCAGGT TGG (reversed) Intronic
901110834 1:6793094-6793116 TTGTTTTGGGATTTGCAGGTAGG - Intronic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
903115027 1:21172188-21172210 TGGAATTGGAAAAAGCAGGCCGG + Intronic
903316968 1:22515664-22515686 TTGTCTTGGATTATCCAGGTGGG - Intronic
906577770 1:46906068-46906090 CTGTATGGGAATAATCAGGTTGG - Intergenic
907069853 1:51524460-51524482 TTGTAATAGCATGAGCAGGTAGG - Intergenic
907563113 1:55409493-55409515 ATGTAATGGTATTAGCAGGTGGG - Intergenic
907945205 1:59129585-59129607 TAGTATTGGTATTAGGAGGTGGG + Intergenic
909229491 1:73067746-73067768 TTGTGATAGAATTAGCAGGTAGG + Intergenic
909467430 1:75988488-75988510 CTGAACTGGAATAAGCAGGTTGG + Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910697981 1:90041823-90041845 CTGAATTGGAATAAGTGGGTTGG + Intergenic
911419859 1:97627141-97627163 TTGTAATGGTATTAGGAGGTGGG - Intronic
911869979 1:103085263-103085285 CTGAACTGGGATAAGCAGGTTGG - Intronic
912185657 1:107272807-107272829 TAGTGTTGTATTAAGCAGGTAGG + Intronic
912442285 1:109708340-109708362 CTGTATAGGAATAGTCAGGTTGG - Intronic
913199133 1:116482148-116482170 GTGTAGGTGAATAAGCAGGTTGG + Intergenic
914341895 1:146766844-146766866 GTGTATTGGATAGAGCAGGTGGG + Intergenic
915154903 1:153867284-153867306 TTGTAGTATAATAAGCAGTTTGG - Intronic
916009098 1:160688538-160688560 CTGTATGGGAATAGTCAGGTTGG + Intronic
916884297 1:169052199-169052221 TTCTATTGGAATGAACAGGTTGG - Intergenic
917436091 1:175023108-175023130 TTGTAAGGGAGTAAGCAGATAGG - Intronic
918095163 1:181328344-181328366 TTGTAATGGTATTAGAAGGTGGG - Intergenic
918494240 1:185115404-185115426 CTGAACTGGAATAAGCAGGTTGG + Intergenic
919412394 1:197261776-197261798 GAGCATTGGAATAAGCAAGTTGG + Intergenic
920168522 1:204054082-204054104 CTGAACTGGAATAAGCAGATTGG - Intergenic
921335287 1:214079497-214079519 CTGAAGTGGAATAAGCAGGTTGG + Intergenic
921468036 1:215514917-215514939 TAGTATTGCAATAAACAGGAGGG - Intergenic
921617911 1:217293043-217293065 CTGAACTGGAATAAGCAGGTTGG + Intergenic
922592575 1:226788678-226788700 TTGAAGTGGAATAAGCAGGCTGG + Intergenic
924014939 1:239711165-239711187 GTGTAGTGGAAGAAGCAGATGGG - Intronic
924209719 1:241752216-241752238 TTATATTGGAATTGGCTGGTAGG - Intronic
1063272331 10:4524479-4524501 TATTTTTGGAAGAAGCAGGTTGG + Intergenic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1064361568 10:14670266-14670288 TAGTATTGGCATAAGCAATTTGG + Intronic
1066610589 10:37244094-37244116 CTGAACTGCAATAAGCAGGTTGG - Intronic
1066790766 10:39060575-39060597 TTTCATTTGAATCAGCAGGTTGG - Intergenic
1066798527 10:39155251-39155273 TTTTATTGGATTAAGTAGTTTGG + Intergenic
1067668816 10:48301431-48301453 TTGTAATGGCATTAGGAGGTGGG + Intergenic
1067859159 10:49826914-49826936 TTATATTGAAAGAAGCAGGCAGG + Intronic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1070774095 10:79099817-79099839 GTGCATTTGAAAAAGCAGGTAGG + Intronic
1073368619 10:102966766-102966788 TTGTCATGGAATTAGGAGGTGGG + Intronic
1076660183 10:132050673-132050695 TTGTATGGGAATGATCAGGGTGG - Intergenic
1077684281 11:4276577-4276599 CTGAACTGGAATCAGCAGGTTGG - Intergenic
1077685759 11:4290191-4290213 CTGAACTGGAATCAGCAGGTTGG + Intergenic
1077690909 11:4341351-4341373 CTGAACTGGAATCAGCAGGTTGG + Intergenic
1078640005 11:13085556-13085578 TTGTATTGGAATTAGCAAATTGG - Intergenic
1079083791 11:17431215-17431237 TTGGCTGGGAATAAGCAGGGAGG + Intronic
1080957346 11:37114762-37114784 TTGTCTTGGAACAAGCAACTTGG - Intergenic
1081477240 11:43446730-43446752 TTATAATGGAATAGGCAGGAAGG - Intronic
1081886486 11:46501456-46501478 CAGAATGGGAATAAGCAGGTTGG + Intronic
1081909389 11:46691043-46691065 TTGTTTTTAATTAAGCAGGTGGG - Intronic
1082145237 11:48658670-48658692 TTGCATTGGATTCAGCAGTTTGG + Intergenic
1082298939 11:50481176-50481198 TTGCTTTGGAATCAGCAGTTTGG - Intergenic
1082572908 11:54764200-54764222 TTGTATGGGAACAGTCAGGTTGG - Intergenic
1082573760 11:54776918-54776940 TTTTATTGGATTCAGCAGTTTGG + Intergenic
1088129237 11:106467030-106467052 TTGTATTGCAATCAGCAGTGTGG + Intergenic
1088598995 11:111459412-111459434 CTGTTTTGGAAGAAGCAAGTGGG - Intergenic
1089409050 11:118223186-118223208 TTCTGTGGGTATAAGCAGGTTGG + Intronic
1090386762 11:126361768-126361790 TTGTATTCCTAGAAGCAGGTTGG + Intronic
1094018611 12:25890576-25890598 CTGAACTGAAATAAGCAGGTTGG - Intergenic
1094383634 12:29870093-29870115 TTGTTTTGGCTTAAGAAGGTGGG - Intergenic
1094423740 12:30298254-30298276 ATGTAATGGCATAAGGAGGTCGG + Intergenic
1094864509 12:34514445-34514467 TTGCTTTGGAATCAGCAGTTTGG - Intergenic
1095029730 12:37254996-37255018 TTTTAGTGGAATTTGCAGGTGGG - Intergenic
1095080039 12:37988854-37988876 TTGTTTTTGATTCAGCAGGTTGG + Intergenic
1095345373 12:41143300-41143322 CTGTATTGGAATGAGAAGGATGG + Intergenic
1097260904 12:57719781-57719803 TTCTGTTTGAAGAAGCAGGTTGG - Intronic
1098200981 12:68055380-68055402 TTATTTTGGAATACTCAGGTGGG - Intergenic
1098623118 12:72629516-72629538 TTGTACTGTAATAAACAGTTGGG - Intronic
1105705349 13:22964752-22964774 TTGTGCTGGAAGATGCAGGTAGG + Intergenic
1105803651 13:23935715-23935737 CTGAACTGGAATAAGCATGTTGG - Intergenic
1106774558 13:32996386-32996408 CTGAAATGGAATAAGCAGGGTGG - Intergenic
1107847953 13:44538098-44538120 TAGTATTAGAATAAGCCTGTAGG - Intronic
1109886154 13:68547715-68547737 CTTAACTGGAATAAGCAGGTTGG + Intergenic
1110603821 13:77408270-77408292 CTGAACTGGAATAAGCAGGTTGG - Intergenic
1110630416 13:77699206-77699228 TTGGAGTGGAATGAACAGGTGGG + Intronic
1110660878 13:78058552-78058574 CTGTATAGGAATAGTCAGGTTGG + Intergenic
1112838532 13:103546914-103546936 TTATCTTGGATTATGCAGGTGGG + Intergenic
1112937205 13:104815795-104815817 ATGAATTGGAATAACCAGGTTGG + Intergenic
1115405514 14:33011264-33011286 CTGAATTTGAATAAGCGGGTTGG - Intronic
1115657071 14:35453495-35453517 CTGAACTAGAATAAGCAGGTTGG + Intergenic
1116053237 14:39831298-39831320 CTGAATTGGAATAAGTAGGTTGG - Intergenic
1116655695 14:47650669-47650691 TTGAACTGGAATAAGCAGGTTGG + Intronic
1117288877 14:54313228-54313250 TTGTACTGGAAAAAACAGCTGGG - Intergenic
1120152185 14:81048593-81048615 CTGAGCTGGAATAAGCAGGTTGG + Intronic
1120355379 14:83426932-83426954 TTGTATTGAAAGAAGAAGGTGGG - Intergenic
1120364334 14:83546305-83546327 TTGTACTGGAATATGGGGGTAGG - Intergenic
1122654338 14:103247385-103247407 TTGTGTTGGGACAAGCAGGATGG + Intergenic
1124858087 15:33410353-33410375 TTGAATTGGAATGAACAGGCAGG + Intronic
1125343962 15:38700278-38700300 TTGTATTAGAATGAGCTGCTCGG - Intergenic
1126923063 15:53549294-53549316 TTCTTTTGGAACAAGCAGCTAGG + Intronic
1127590011 15:60413241-60413263 TTTTGTTGGAAGAAGCAGTTAGG - Intergenic
1129800979 15:78414099-78414121 CTGAACTGGAATAAGCAGGTTGG - Intergenic
1131911887 15:97214609-97214631 TTGTGTTAGAATAAGTATGTTGG + Intergenic
1133574381 16:7074035-7074057 TTGTTTTGTAACAAGAAGGTTGG + Intronic
1133708782 16:8381082-8381104 TTGTAATGGAAACAGCAAGTGGG + Intergenic
1137058394 16:35758123-35758145 TTAGATTGGATTCAGCAGGTTGG - Intergenic
1137073126 16:35925758-35925780 TTGTTTTTGATTTAGCAGGTTGG - Intergenic
1137075001 16:35951100-35951122 TTGCTTTGGAATCAGCAGTTTGG - Intergenic
1137235266 16:46611249-46611271 CTGAACTGGAATAAGCAGGTTGG + Intronic
1138228434 16:55319960-55319982 TGGTTTTGGCATCAGCAGGTGGG - Intergenic
1139992380 16:70950581-70950603 GTGTATTGGATAGAGCAGGTGGG - Intronic
1140589959 16:76340143-76340165 TTGTTTTGGTAAAAGCAGGTTGG - Intronic
1140600757 16:76472152-76472174 TTGTATTGGAGTGAGTAGGGAGG + Intronic
1140719721 16:77760446-77760468 TTATCTTGGAATATGCAGGTGGG - Intergenic
1143489727 17:7279066-7279088 ATGCATTGGAATAAGCATTTGGG + Intergenic
1144658667 17:17054418-17054440 TTGAACTGGAATAAGCAAGCTGG - Intronic
1146016963 17:29241465-29241487 TTGTGTGGGAATAAGCAGGATGG - Intergenic
1148211911 17:45813728-45813750 TTGTCTTGGAATAAGCCATTTGG + Intronic
1149878168 17:60259540-60259562 CTGAACTGGAATAAGCGGGTTGG + Intronic
1152370872 17:79887865-79887887 CTGTATTGGAAGGAGCAGGATGG - Intergenic
1152550566 17:81027948-81027970 ATGTATTCTAATAAGCAAGTGGG + Intergenic
1153107002 18:1539137-1539159 TTGTGTTAGAACAAGAAGGTAGG + Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1157995638 18:52551923-52551945 TTGTATTGGAATATGTATATTGG + Intronic
1158090087 18:53700846-53700868 TCCTGTTTGAATAAGCAGGTTGG - Intergenic
1158346850 18:56524598-56524620 GTGGATAGGAATGAGCAGGTGGG - Intergenic
1159302218 18:66588303-66588325 CTGAACTGGAATAACCAGGTTGG + Intronic
1159475402 18:68914426-68914448 CTGAACTGGAATAAACAGGTTGG + Intronic
1160626574 18:80212314-80212336 ATGAACTGGAATAAACAGGTTGG + Intronic
1163941753 19:20501763-20501785 TTGTATAGGAATAGTCAGGCTGG + Intergenic
1164331499 19:24262803-24262825 TTGTTTTTGATTAAGTAGGTTGG - Intergenic
1164377886 19:27705438-27705460 CTGTATGGGAATAGTCAGGTTGG + Intergenic
1164490837 19:28712789-28712811 CTGAACTGGAATAAGCAGGTTGG + Intergenic
1167475671 19:49699630-49699652 TTGTATTGGAATCACCTGGATGG + Intronic
1168381062 19:55923761-55923783 TTGTACTGGAAGAACCAGTTGGG + Intronic
925221039 2:2141401-2141423 CTGTATTGGTTTAAACAGGTGGG - Intronic
926802292 2:16669229-16669251 TTGAATTGGACTGAGCATGTAGG + Intergenic
928918955 2:36506021-36506043 CTGGACTGGAATAAGCAAGTTGG - Intronic
929883148 2:45854499-45854521 TTGTATTAAAATAAGAAGCTTGG + Intronic
930865689 2:56120208-56120230 TTGAATTCTAATAAGCAGCTGGG + Intergenic
931288769 2:60854295-60854317 TTGGATTGGAAAATGCAGCTGGG - Intergenic
931618218 2:64183264-64183286 CTGAACTGGAATATGCAGGTTGG - Intergenic
932556676 2:72830875-72830897 CTGAATTGGAATAAGCAAGTTGG - Intergenic
935871556 2:107456035-107456057 ATGAATTTGAATAAGAAGGTGGG - Intergenic
936098595 2:109554408-109554430 CTGAACTGGAGTAAGCAGGTTGG - Intronic
937769863 2:125707805-125707827 TCATATTGAAATAAGCATGTTGG - Intergenic
939148026 2:138440102-138440124 CTGAACTGGAATAATCAGGTTGG - Intergenic
940306129 2:152228673-152228695 TTGTATTTGAATTAGTAGTTTGG + Intergenic
941155079 2:161967363-161967385 TTGAACTGGAATAAGTGGGTTGG + Intronic
944461036 2:199950766-199950788 CTGAACTGAAATAAGCAGGTTGG + Intronic
944559107 2:200917289-200917311 TAATATTGGAATATGCAGGCTGG - Intronic
945368392 2:208985248-208985270 TTCTTTTGAAATAAGGAGGTTGG + Intergenic
947677673 2:231998396-231998418 TTGTAATGGTATTAACAGGTGGG - Intronic
1169830185 20:9816444-9816466 TTGTATTTGAATCAGCAGCCTGG + Intronic
1171063572 20:21990770-21990792 CGGTGTTGGAATAAGTAGGTTGG + Intergenic
1171864840 20:30479145-30479167 TTTTGTTGGATTGAGCAGGTTGG - Intergenic
1173490529 20:43476451-43476473 CTGAATTGGAATAAGCAGCTTGG - Intergenic
1173739770 20:45390844-45390866 CTGAAATGGAATAAGCAGGTTGG + Intronic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1176727582 21:10453224-10453246 ATGTAATGGCATAAGCAAGTAGG + Intergenic
1178065123 21:28896052-28896074 CTGTCTTGGATTAACCAGGTGGG + Intergenic
1178189253 21:30261930-30261952 TTGATTTGGAAGAAGTAGGTGGG - Intergenic
1178246731 21:30960358-30960380 TTGTCCTGGATTATGCAGGTGGG + Intergenic
1180286812 22:10753807-10753829 ATGTAATGGCATAAGCAAGTAGG - Intergenic
950184943 3:10939171-10939193 TTGATTTTAAATAAGCAGGTGGG - Exonic
950954257 3:17034345-17034367 GTGGATTGGAATAAGTGGGTTGG + Intronic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
952358202 3:32604300-32604322 CTGTACTTGAATAAGCAGGTTGG - Intergenic
956358034 3:68415478-68415500 TTGTGTTGGAGTGAGGAGGTTGG + Intronic
959488875 3:106962880-106962902 CTGAACTGGAATAAGCAAGTTGG - Intergenic
959888507 3:111528513-111528535 CTGTATAGGAATAGTCAGGTTGG - Intronic
963273874 3:143311417-143311439 TTGAATTGGAATAAGAATGCTGG - Intronic
963367271 3:144352209-144352231 TTGCATTGCAATCAGCAGGGAGG - Intergenic
963446752 3:145421023-145421045 TTATATTTTAATAAGCATGTTGG + Intergenic
964753288 3:160071708-160071730 CTGAAGTGCAATAAGCAGGTTGG + Intergenic
964851462 3:161100755-161100777 TCTTATTGGAATATGCAGATAGG - Intronic
966893193 3:184423099-184423121 TTGTATGGAAAGAAGCAGATGGG + Intronic
967050398 3:185778146-185778168 TTGTATTGGAATAAGCAGGTTGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967452088 3:189636984-189637006 CTGAACTGGAATAAGCAGGTTGG - Intronic
968779536 4:2569798-2569820 TTTTAATGGAATTAGCAGCTGGG - Intronic
974605230 4:64143174-64143196 CTGTATAGGAATAATTAGGTTGG + Intergenic
975404393 4:73972809-73972831 ATCTATTGGAATAATCATGTGGG - Intergenic
975954974 4:79826372-79826394 CTGTATGGGAATAGTCAGGTTGG + Intergenic
976467680 4:85389236-85389258 CTGCACTGGAATAAGCGGGTTGG + Intergenic
976736560 4:88315910-88315932 CTGAACTGGAATAAGCAGGTTGG + Intergenic
977172100 4:93775621-93775643 TTGTAGTGAAATAGCCAGGTTGG - Intergenic
977367937 4:96096093-96096115 TTGACTTAGAATAAGCATGTAGG + Intergenic
978983253 4:114978329-114978351 TTGTAAAGGAATAAACAGTTAGG - Intronic
979149934 4:117298653-117298675 TTCTATCAGAATAAGCAGGTGGG - Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
981305144 4:143239514-143239536 CTGAACTGGAATAAGCAGGTTGG - Intergenic
981706076 4:147660331-147660353 CTGTATTTAAATAAGCAGGCTGG + Intronic
982803877 4:159738743-159738765 TTGAACTGGAATAAGCAGGTTGG - Intergenic
982850224 4:160305558-160305580 TTGAAATGGAATAATCAGGGTGG - Intergenic
983125597 4:163947443-163947465 TTATTTTGGATTATGCAGGTGGG + Intronic
983190790 4:164751309-164751331 CTGTATAGGAATAGTCAGGTTGG - Intergenic
983990716 4:174116311-174116333 TTGAGTTGGACTAAGCAGGATGG - Intergenic
986290099 5:6392930-6392952 TTATTTTGGATTATGCAGGTGGG - Intergenic
986981860 5:13457342-13457364 TGGTATAGGAAAAAGCAGATTGG - Intergenic
987257251 5:16168700-16168722 TTGTGTGGGAATGAGTAGGTGGG - Intronic
987883637 5:23783128-23783150 TTGTCTTGGATTAACTAGGTGGG + Intergenic
988176620 5:27734850-27734872 TTGAATTGGAATCACCAGCTAGG + Intergenic
989842759 5:46100890-46100912 CTGGATTAGAATAAGCAGATGGG + Intergenic
990660159 5:58004698-58004720 TTGTTTTGAAATAATCAGGAAGG - Intergenic
991175697 5:63685486-63685508 TTGTTTTGGAATAAACTGGGAGG - Intergenic
992048047 5:72917113-72917135 TTCAAATGGAGTAAGCAGGTAGG + Intergenic
992209497 5:74463743-74463765 CTGAACTGAAATAAGCAGGTTGG + Intergenic
992943887 5:81790369-81790391 TTGTTTTGAAATAAGCTGTTTGG - Intergenic
994301710 5:98155750-98155772 TTGTGATGGAGTAAGCAGGCAGG + Intergenic
995602256 5:113810377-113810399 TTATCTTGGATTAACCAGGTGGG + Intergenic
996327239 5:122288627-122288649 CTGAACTGGAATAAGCAGGTTGG + Intergenic
1002827086 6:783609-783631 CTGAACTGGAATAAGCGGGTTGG + Intergenic
1003311801 6:4975268-4975290 TGGTCTTGGAAGGAGCAGGTGGG + Intergenic
1003803374 6:9697259-9697281 AAGTGTTGGAAGAAGCAGGTTGG + Intronic
1003978100 6:11363284-11363306 TTGCATTGGGAGAAGTAGGTGGG + Intronic
1005969252 6:30748625-30748647 TTGCCTTGGAATAAGGATGTTGG - Intergenic
1006214600 6:32429668-32429690 TTGAACTGGAATAAGCAGGTTGG - Intergenic
1008389822 6:50937040-50937062 TTGACTTGGAAAAAGAAGGTAGG + Intergenic
1008922341 6:56855683-56855705 CTGAACTGTAATAAGCAGGTTGG - Intronic
1012393939 6:98774323-98774345 TAGCATTGGAGTAAGTAGGTAGG - Intergenic
1013657190 6:112258335-112258357 CTGAGTTGGAAAAAGCAGGTTGG - Intergenic
1015807444 6:137125354-137125376 TTGTGATGGTATAAGGAGGTGGG - Intergenic
1015925912 6:138310269-138310291 TCATGTTGAAATAAGCAGGTGGG - Intronic
1016839773 6:148514495-148514517 TTCTTTTGGAATAACCAGGGTGG - Intronic
1018936148 6:168275221-168275243 TTGCATTAGAATTAGCAGCTGGG + Intergenic
1019117613 6:169777925-169777947 CTGAACTGGAATAAGCAGGTTGG - Intronic
1020434518 7:8148118-8148140 CTGAACTGGAATAAGCAGTTTGG + Intronic
1021747172 7:23753469-23753491 CTGGATTGGAATAAGCGGGTTGG + Intronic
1021816596 7:24453062-24453084 CTGAACTGGAATAAGCAGGTTGG + Intergenic
1023340573 7:39215039-39215061 TTGTAATGTAAGAAGCAGGAAGG + Intronic
1023384252 7:39639715-39639737 CTGAACTGGAAAAAGCAGGTTGG - Intronic
1024982558 7:55169935-55169957 TTGTATTGCATTCAGCAGGCAGG + Intronic
1025583495 7:62750547-62750569 TTTCTTTGGATTAAGCAGGTTGG + Intergenic
1025583601 7:62752095-62752117 TTTATTTGGAATAAGCAGCTTGG + Intergenic
1026965756 7:74438912-74438934 TTGTAGTGGTATTAGGAGGTGGG - Intergenic
1028655441 7:93200823-93200845 CTGAACTAGAATAAGCAGGTTGG - Intronic
1028840551 7:95425241-95425263 ATGTATTGGAATAGGAAGGTTGG + Intronic
1030474842 7:110018271-110018293 TTGTATTGGAAGGAAGAGGTAGG - Intergenic
1031341470 7:120607797-120607819 TGGTATTAGAATATGCAGGATGG + Intronic
1031940059 7:127779071-127779093 TTGTATTCAAGTATGCAGGTAGG - Intronic
1033475588 7:141688972-141688994 AAGTATTAGAAGAAGCAGGTTGG - Intronic
1034948454 7:155279833-155279855 CTGAACTGGAATAAGCAGGTTGG + Intergenic
1035129975 7:156642606-156642628 CTGAACTGGAATAAGCAGGTTGG - Intronic
1037235350 8:16713942-16713964 CTGAACTGGAATAAGCAGGCTGG - Intergenic
1037684591 8:21128043-21128065 CTGAACTGGAATAAGCAGTTTGG + Intergenic
1039250738 8:35661349-35661371 ATGTCTTGGAGTAGGCAGGTTGG + Intronic
1040112764 8:43577579-43577601 TTTTTTTTGACTAAGCAGGTTGG + Intergenic
1040130112 8:43785650-43785672 TTCTATTTGATTCAGCAGGTTGG + Intergenic
1040348006 8:46529131-46529153 TTGTATTAGCTTCAGCAGGTTGG + Intergenic
1040348156 8:46531750-46531772 TTTAATTTGAATCAGCAGGTTGG + Intergenic
1041182383 8:55262429-55262451 TTGTGATGGAATTAGGAGGTGGG + Intronic
1041236021 8:55803492-55803514 GTGTATTGGAAAAAGTACGTAGG + Intronic
1041632824 8:60107043-60107065 CTGAACTGGAATAAGCATGTTGG + Intergenic
1044173189 8:89082333-89082355 TTTTTTTGGCATAAGCAGGTGGG - Intergenic
1045120698 8:99030575-99030597 CTGAACTGGAATAAGCAGGTTGG + Intronic
1045309114 8:100985182-100985204 TTGTATAGGAATAAAAAGCTAGG + Intergenic
1047708350 8:127524992-127525014 TTGTAATGCAAAAAGCGGGTGGG + Intergenic
1048927034 8:139280663-139280685 ATGTATTGGTATTAGAAGGTGGG - Intergenic
1050445450 9:5717074-5717096 TGATATTGGAATTAGCAGATAGG - Intronic
1051860014 9:21613870-21613892 TTGTAATGGAAAAAGGAGATAGG + Intergenic
1052233103 9:26178541-26178563 TTGTATTGGATTAAGTAAGAAGG + Intergenic
1052688058 9:31778652-31778674 TTGTATAGGACTAATCAGGTTGG - Intergenic
1055577147 9:77671610-77671632 CTGGAGTGGAATGAGCAGGTGGG - Intergenic
1056019220 9:82424016-82424038 TTATACTGGGAGAAGCAGGTTGG + Intergenic
1057342552 9:94215680-94215702 CTGAACTGGAATAAGCAGGTTGG + Intergenic
1203400457 Un_KI270519v1:86992-87014 TTTTTTTGGAATCTGCAGGTGGG + Intergenic
1187587765 X:20682966-20682988 TTGAGTTGGCATAAGCAGGAAGG + Intergenic
1188159401 X:26782195-26782217 TTGGTGTGTAATAAGCAGGTAGG - Intergenic
1189509384 X:41646691-41646713 CTGTATGGGAATAGTCAGGTTGG - Intronic
1189748138 X:44190958-44190980 TTGAACTGGAATAAGCACATTGG + Intronic
1190364478 X:49678659-49678681 CTGAACTGCAATAAGCAGGTTGG - Intergenic
1191263098 X:58350341-58350363 TTTCATTGGAATCAGCAGTTTGG + Intergenic
1191575658 X:62702331-62702353 TTTTATTTGATTCAGCAGGTTGG - Intergenic
1191575706 X:62702839-62702861 TTTCATTTGAATCAGCAGGTTGG - Intergenic
1191582237 X:62776585-62776607 TTGTTTTTTATTAAGCAGGTTGG - Intergenic
1194622650 X:96192174-96192196 TGCTATTGGAATTAGGAGGTGGG - Intergenic
1196516006 X:116612432-116612454 TTGTATTGGAATAACAAGCCAGG + Intergenic
1196804715 X:119574299-119574321 TTGCCTTAGAATTAGCAGGTGGG + Intergenic
1197576799 X:128222979-128223001 TTGAATTAGAAGAATCAGGTAGG + Intergenic
1199408855 X:147495638-147495660 TAGTGTTGTAATAATCAGGTAGG + Intergenic
1200630354 Y:5575528-5575550 TTGTAATGGAGCAAACAGGTTGG + Intronic
1201475343 Y:14375690-14375712 CTGTATAGGAATATACAGGTTGG + Intergenic
1201607553 Y:15803689-15803711 TTGTCCTGGATTATGCAGGTGGG + Intergenic
1201777059 Y:17677417-17677439 TTGTTTTTGATTAAGCAGGTTGG - Intergenic
1201824498 Y:18228575-18228597 TTGTTTTTGATTAAGCAGGTTGG + Intergenic
1202087240 Y:21151845-21151867 TTGTAAGAGAAGAAGCAGGTAGG + Intergenic