ID: 967051773

View in Genome Browser
Species Human (GRCh38)
Location 3:185791589-185791611
Sequence TGTGATGCACACCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967051773_967051776 -4 Left 967051773 3:185791589-185791611 CCTTCCTCCAGGTGTGCATCACA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 967051776 3:185791608-185791630 CACAGTGAGCTGACATCACCTGG 0: 1
1: 0
2: 1
3: 25
4: 255
967051773_967051777 -1 Left 967051773 3:185791589-185791611 CCTTCCTCCAGGTGTGCATCACA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 967051777 3:185791611-185791633 AGTGAGCTGACATCACCTGGAGG 0: 1
1: 1
2: 6
3: 50
4: 293
967051773_967051780 14 Left 967051773 3:185791589-185791611 CCTTCCTCCAGGTGTGCATCACA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 967051780 3:185791626-185791648 CCTGGAGGCCATCTTTCACAGGG 0: 1
1: 0
2: 0
3: 26
4: 189
967051773_967051778 13 Left 967051773 3:185791589-185791611 CCTTCCTCCAGGTGTGCATCACA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 967051778 3:185791625-185791647 ACCTGGAGGCCATCTTTCACAGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967051773 Original CRISPR TGTGATGCACACCTGGAGGA AGG (reversed) Intronic
900106090 1:981742-981764 CGTGGTGCAGACCTCGAGGACGG - Intronic
900119948 1:1044323-1044345 TGAGCCGCACACCTGGAGGGTGG - Exonic
900782922 1:4629526-4629548 TGTGCGGCACACCTGTGGGATGG - Intergenic
900822277 1:4898862-4898884 TGTAATGCACACCTGCAGGATGG - Intergenic
903586032 1:24415911-24415933 AGTGATTAACACCGGGAGGAAGG + Intronic
908228584 1:62081440-62081462 GGTGAGGCAAACGTGGAGGAGGG + Intronic
908320758 1:62976147-62976169 TCTGATGCACATCTGGAGATGGG - Intergenic
908436203 1:64109124-64109146 TGTAAGACACACCTAGAGGATGG - Intronic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
915270942 1:154752937-154752959 CGTGATGCAGAACTGGAGGCAGG - Intronic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
915978109 1:160403679-160403701 TGTGATGAACACTTGAGGGAAGG - Intronic
916721461 1:167487447-167487469 AGGGATGCCCACCTGGAGGAAGG - Intronic
917567773 1:176230251-176230273 TGTGGTGATCACCTGCAGGAAGG + Intergenic
923200340 1:231704941-231704963 TGAGATGCAGATCTTGAGGACGG - Intronic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
923520444 1:234731305-234731327 TGATTTGCAAACCTGGAGGATGG - Intergenic
923573718 1:235140034-235140056 GGTGCTGCAGGCCTGGAGGACGG + Intronic
923779202 1:237007253-237007275 GGTGATGCAGACGTGGAGTAAGG - Intergenic
1063789496 10:9425705-9425727 TGTAAAGCACACCTGGGAGAAGG + Intergenic
1064404989 10:15053663-15053685 TGTGAAGTACACTTGGAAGAGGG - Intronic
1065299742 10:24310648-24310670 TTAGAGGCACACCTGGAGCAAGG - Intronic
1065374231 10:25020630-25020652 GGTGATGCACACCTGGTGGGAGG + Intronic
1067235150 10:44440516-44440538 GGCGATCCACACCTGCAGGATGG - Intergenic
1068779084 10:60900043-60900065 TGTGGTGCCCTCCTGGAGGAAGG + Intronic
1071366990 10:84909482-84909504 TGTGCTGCCAACCTTGAGGAAGG - Intergenic
1074853208 10:117455223-117455245 TGGGATGCCCAGCTTGAGGAAGG + Intergenic
1075748643 10:124744947-124744969 TGTGCTGCTCACCTGGGGGAGGG + Intronic
1076048585 10:127314412-127314434 TGGGATGCTCATCTGGAGGCCGG - Intronic
1077435271 11:2535922-2535944 TGGGATGCACAGCTGGGGGCAGG + Intronic
1077881340 11:6353063-6353085 TGTGAGGCACACATGAGGGAAGG - Intergenic
1078197618 11:9149498-9149520 TGTTATGCATGCCTGGAAGAGGG + Intronic
1081621016 11:44619193-44619215 TGGGAGGCAGGCCTGGAGGAGGG - Exonic
1081730778 11:45370351-45370373 AATGAAGCACACCTAGAGGATGG - Intergenic
1083571996 11:63765923-63765945 TGGGATGCACACCTGGGGCTGGG - Exonic
1084936337 11:72588964-72588986 TGTGATGGAGGGCTGGAGGAGGG - Intronic
1085049723 11:73374047-73374069 TGTGATGGGGACCTGGAGGCAGG - Intergenic
1085051862 11:73384084-73384106 GCTGGTGCCCACCTGGAGGAGGG - Intronic
1088920212 11:114254994-114255016 TATGATACACACCAGGAGGCTGG - Intergenic
1091041517 11:132285380-132285402 TGTCATGCACATCTTGAAGAAGG + Intronic
1092226625 12:6752488-6752510 TGTGTGGAACACCTGGAGTAGGG - Intronic
1092279200 12:7086858-7086880 AGTGATGCACGCCTGGAGGCAGG - Intronic
1094467249 12:30766517-30766539 TGGGATGAATACCTGGAGGTGGG - Intergenic
1095334112 12:41006348-41006370 TGTGGTGAACACCTGCAGGGAGG - Intronic
1097263186 12:57731072-57731094 TGTGATGAACATCTAGGGGATGG + Intronic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1100963894 12:99991692-99991714 GGTGATGCACCCCGGGAGGGAGG - Intergenic
1102941532 12:116946778-116946800 TGTGATGCACACAGGCAGAAAGG + Intronic
1104606365 12:130192542-130192564 TCTGCTGCACTCCTGGAAGAAGG + Intergenic
1104716775 12:131020772-131020794 TGAGAGCCACACCTAGAGGAGGG - Intronic
1105033387 12:132900891-132900913 GGTGATGCACACCTGTACTAGGG + Intronic
1105631713 13:22175997-22176019 GGTGCTCCACACCGGGAGGAGGG + Intergenic
1106823097 13:33488303-33488325 GGAGAAGCACACCTGGATGAGGG - Intergenic
1108325127 13:49323103-49323125 TGAGGTGCTTACCTGGAGGAGGG - Intronic
1110321271 13:74162478-74162500 TGGGATTTACTCCTGGAGGAAGG - Intergenic
1113196418 13:107812888-107812910 GGTGATGCATGCCTGTAGGAAGG - Intronic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1114827288 14:26096428-26096450 TGTGATGCATTCCAGGAGGGAGG - Intergenic
1118613699 14:67561065-67561087 AGTGGTTCACACCTGCAGGAGGG + Intronic
1121731807 14:96192650-96192672 GCTGAGGGACACCTGGAGGAGGG + Intergenic
1122534013 14:102449618-102449640 CGTGATGCTCACCTGGAAGGAGG - Exonic
1123582110 15:21725113-21725135 TGTGGTGAACACCTGCAGGGAGG - Intergenic
1123618760 15:22167709-22167731 TGTGGTGAACACCTGCAGGGAGG - Intergenic
1126025380 15:44441370-44441392 TGTGGTGCAGTGCTGGAGGAAGG - Intronic
1127385626 15:58464283-58464305 TGCGATGGACACCTGTAGGTGGG + Intronic
1129035774 15:72647588-72647610 TGTGATCCAAACCTGGAAGGTGG - Intergenic
1129214110 15:74089628-74089650 TGTGATCCAAACCTGGAAGGTGG + Intergenic
1129391310 15:75222303-75222325 TGTGATCCAAACCTGGAAGGTGG - Intergenic
1129399900 15:75275741-75275763 TGTGATCCAAACCTGGAAGGTGG - Intronic
1129472994 15:75765563-75765585 TGTGATCCAAACCTGGAAGGTGG + Intergenic
1129987501 15:79931344-79931366 AGGGAGGCACATCTGGAGGAAGG - Intergenic
1129994007 15:79989331-79989353 GGTGATGCAGAGCTGGGGGAGGG - Intergenic
1130866887 15:87940742-87940764 TGTGCTGCACATCTGTAGGATGG + Exonic
1133099009 16:3467752-3467774 TATGATGCCAAACTGGAGGAAGG - Intronic
1133539684 16:6737397-6737419 TGTGATGCACACTTACATGAAGG - Intronic
1134188920 16:12106394-12106416 TGTGATGGACACGTGGACAAGGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135784242 16:25334235-25334257 GGTCATTCACACCTGGAGCAGGG + Intergenic
1137444856 16:48525523-48525545 CCTGTGGCACACCTGGAGGATGG + Intergenic
1137553449 16:49455755-49455777 TGTGATGCAAGCTGGGAGGACGG - Intergenic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1139329987 16:66180319-66180341 GGTGATGCCAACCAGGAGGATGG - Intergenic
1140105343 16:71954833-71954855 TGAGCTCCAGACCTGGAGGAAGG + Intronic
1140323634 16:73978372-73978394 AGTAATGTACACTTGGAGGAGGG - Intergenic
1141507670 16:84489477-84489499 TGTCATGCCCACATGGAGAAGGG + Intronic
1142007620 16:87697209-87697231 TGTGCTGCACACCTGAGGGAGGG + Exonic
1142887011 17:2919232-2919254 TCTGAGCCAGACCTGGAGGAAGG + Intronic
1147742870 17:42678659-42678681 TGGGATCCAGACCTGGAAGATGG - Intergenic
1149011568 17:51862460-51862482 TATAATGCACACCTTGAGGTGGG - Intronic
1149397259 17:56257667-56257689 TGTGCTAAACACCTGGATGAAGG - Intronic
1150760861 17:67959678-67959700 TGTGTTGCACAGCAGGTGGAGGG - Exonic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1151342200 17:73478882-73478904 GGTGATGCTCCCATGGAGGAAGG + Intronic
1151680015 17:75618115-75618137 TGGGTAGAACACCTGGAGGAGGG - Intergenic
1152034351 17:77862870-77862892 TGAGCTTCACACCTGGAGAAAGG - Intergenic
1153019140 18:611074-611096 TGTGAGGGAGACCAGGAGGAAGG - Intronic
1156196733 18:34782606-34782628 TGTAGGGCACACCTGGTGGAGGG + Intronic
1157144050 18:45143055-45143077 CGTGCTGCATGCCTGGAGGAGGG - Intergenic
1157286520 18:46380825-46380847 TGTGATGGGGACCTGCAGGAAGG - Intronic
1157561227 18:48647927-48647949 TGTGAGGCAACCTTGGAGGATGG + Intronic
1157602296 18:48901764-48901786 TGAGATGCAGACCTGGAGCCTGG + Intergenic
1158390525 18:57041203-57041225 TGTGATGGACACCAAAAGGAAGG + Intergenic
1159251084 18:65877644-65877666 TGGGATGCACAGATGGAGGCAGG - Intronic
1159375988 18:67593895-67593917 TCTGATGCTCAAATGGAGGAAGG - Intergenic
1162955235 19:14093781-14093803 AGGGAAGCGCACCTGGAGGAAGG + Exonic
1164127131 19:22328770-22328792 TGTCAGTCACACCTGCAGGAAGG - Intergenic
1164963908 19:32462592-32462614 TGTGAGCCACACCTGGGAGACGG + Intronic
1165974072 19:39658782-39658804 TGTGATGAAAACCTGGGGCAGGG - Intronic
925144578 2:1572240-1572262 TGTAAAGCACACCTGGGGGAAGG - Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
927040115 2:19220786-19220808 TGTGATGGCCACCTGTAGCAGGG + Intergenic
928210900 2:29322897-29322919 GGTGATGGATTCCTGGAGGAAGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929463949 2:42128159-42128181 AGTGATGAGAACCTGGAGGAGGG - Intergenic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
930046990 2:47181128-47181150 TGTGGAGTACACCTGGAGGAAGG + Intergenic
930351344 2:50259437-50259459 TGGTATGCTTACCTGGAGGAAGG - Intronic
930552807 2:52856693-52856715 TGGGAAGGACACATGGAGGAGGG + Intergenic
932399332 2:71468932-71468954 TCCCAGGCACACCTGGAGGATGG - Intronic
933136557 2:78742886-78742908 TGTGAAGTACACTTGGAAGAGGG + Intergenic
933607885 2:84403285-84403307 TGTGATGGAAACCTCAAGGAAGG + Intergenic
937306599 2:120875394-120875416 AGTGCTGCTCACTTGGAGGAGGG + Intronic
937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG + Intronic
939723174 2:145680442-145680464 TGGGGTGGACACCTGGTGGAAGG + Intergenic
942115077 2:172720882-172720904 GGTGGTGCAGGCCTGGAGGAGGG - Intergenic
948271102 2:236673929-236673951 TGTCATGCACACCTGCACCAGGG + Intergenic
948675641 2:239594999-239595021 TCTGATGCACAGCAGGAGGGCGG + Intergenic
1171486921 20:25491823-25491845 TGCCATGCACACCGGGTGGAGGG - Intronic
1172242141 20:33420244-33420266 TGGGATCCACACATTGAGGATGG + Intronic
1173354437 20:42273896-42273918 TGGGTTGCAGACCTAGAGGATGG - Intronic
1173977579 20:47198574-47198596 TGTGATTCACAGCTGGAGGCGGG + Intergenic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1174236654 20:49099205-49099227 TGTGCTGCATACCTGGAAGGCGG + Intergenic
1174676328 20:52360456-52360478 GGTAGTGCACACGTGGAGGACGG - Intergenic
1175657728 20:60786677-60786699 TGTGAGGCAGCCCTGGAAGAGGG - Intergenic
1176668904 21:9713585-9713607 TGTGAGGCATCCCTAGAGGAGGG + Intergenic
1178086455 21:29117010-29117032 TGTCATGCTCACCTTGAGTAAGG + Intronic
1178686867 21:34718797-34718819 TGTGATTCACAACTGAAGTATGG - Intergenic
1178960260 21:37058627-37058649 TGTGCAGCACCCATGGAGGAGGG + Intergenic
1179146599 21:38773931-38773953 TGAGCTGCACACATGCAGGATGG + Intergenic
1179814602 21:43897480-43897502 TGTTAGGCACACCTGCAGAAGGG + Intronic
1180050628 21:45329508-45329530 TGAGCAGCGCACCTGGAGGAGGG - Intergenic
1181579689 22:23821139-23821161 TGTGATTCCCACCTGGGGGATGG + Intronic
1182850015 22:33465783-33465805 TGTGAGCCACACTAGGAGGATGG - Intronic
1183587193 22:38759724-38759746 TGTGCTGCCCACATGGAGGAAGG + Intronic
1185263692 22:49886058-49886080 GGTGATGCCCACCTGAAGGCCGG - Exonic
1185347274 22:50316076-50316098 TGGGATGCGCACCTGGGAGAAGG + Exonic
949981979 3:9507881-9507903 GGTGATGCAGAGCTGGTGGAGGG - Intronic
957082709 3:75650135-75650157 TCTGAATCACACCTGCAGGAAGG - Intergenic
960991577 3:123314978-123315000 TGTGATCTGCACCTGAAGGAGGG - Intronic
961815605 3:129548610-129548632 TGTGGTACACGGCTGGAGGAGGG + Intronic
962490476 3:135888919-135888941 TGTCTTGCACACCTGGTAGAAGG - Intergenic
963299721 3:143584948-143584970 GGTGATGGAAGCCTGGAGGAGGG + Intronic
966925581 3:184642681-184642703 TGTGCTGCAGACCTGGGGGAGGG - Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
969839450 4:9870004-9870026 TGGGATGCACACATAGGGGAAGG + Intronic
970368931 4:15388892-15388914 TGAGATTCACCTCTGGAGGATGG + Intronic
972675922 4:41258917-41258939 TGTGATGCTCAACTGGAGACAGG - Intronic
973278763 4:48337394-48337416 AGGGAGGCACATCTGGAGGAGGG + Intergenic
973807480 4:54540016-54540038 TGAGGTGCACAGCTGCAGGATGG + Intergenic
973910225 4:55572558-55572580 TATGCTCCACACCTGGATGAGGG + Intronic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
975904774 4:79196322-79196344 TGTTATGGAAACATGGAGGAGGG - Intergenic
976829739 4:89301815-89301837 AGTAATGGACAGCTGGAGGACGG - Intronic
978633668 4:110778059-110778081 TGTGATAACCACCTGGATGATGG - Intergenic
978829696 4:113069362-113069384 TGTGCTGGAGACCTGGAAGATGG - Intronic
983038922 4:162901425-162901447 TGGGATGAACACCTGCAGAAGGG + Intergenic
985405879 4:189637928-189637950 TGTGAGGCATCCCTAGAGGAGGG - Intergenic
985991629 5:3566490-3566512 AGTGATGCACACCTCGTCGATGG + Intergenic
992127075 5:73653153-73653175 AGTCATGCACACTTGGAGCAGGG - Intronic
992286046 5:75236676-75236698 TGTGAGGCAAAGATGGAGGAAGG - Exonic
993997373 5:94738758-94738780 TGTGAAAAACACCTTGAGGACGG + Intronic
995014385 5:107293238-107293260 TGTGAGGCTCACCTGGCTGAGGG - Intergenic
997367587 5:133335769-133335791 TGTGATGCCCACCAAGAAGATGG + Intronic
998007959 5:138669890-138669912 TGTGAAGCACATCTGCAGGTGGG - Intronic
998402007 5:141853024-141853046 TGTGATGCTCATCTGGATGTGGG + Intergenic
999109914 5:149110196-149110218 TGTGATGCGCAGATGGTGGAAGG - Intergenic
999603165 5:153289349-153289371 AGTGAGGGACACCTGGAGGCTGG - Intergenic
1002273731 5:178090103-178090125 TGGGAGGCTGACCTGGAGGATGG - Intergenic
1005986663 6:30880244-30880266 GGTGATGCGCACCAGGAGGCTGG - Intronic
1007115585 6:39340946-39340968 TGTGGGGCACAAGTGGAGGAAGG - Intronic
1007178603 6:39912852-39912874 TGTGGGGCAGGCCTGGAGGAAGG - Intronic
1008087608 6:47261037-47261059 TGAGATGTACACATGGAAGACGG + Intronic
1015800128 6:137052217-137052239 TGTGATAAACACCTGCTGGAGGG - Intergenic
1017110005 6:150923400-150923422 TATTATGCACACCTGGATAATGG - Intronic
1017590675 6:155975269-155975291 TGGGATTCCCACCTGGAGAAGGG + Intergenic
1019515605 7:1438559-1438581 GGTGTTGCTGACCTGGAGGAGGG - Intronic
1019765867 7:2849727-2849749 TGTGATGAGCACCAGGAGGAAGG - Intergenic
1022135452 7:27443361-27443383 TGTGATACACCCCAGTAGGATGG - Intergenic
1022504587 7:30902430-30902452 TGTGGTGCACTCCTGGTGAATGG + Intergenic
1024245096 7:47463491-47463513 TGTAACTCACACCTGAAGGAAGG + Intronic
1026537484 7:71251991-71252013 TGTGATCCAACCCTGGAAGAAGG + Intronic
1029154178 7:98503235-98503257 AGTGATTGACACCTGGAGGCAGG + Intergenic
1030228540 7:107180041-107180063 TGTGATGAACACATGGAGCTTGG + Exonic
1030379320 7:108794547-108794569 AGTGATGCACATCTGGACTAAGG - Intergenic
1030594817 7:111525278-111525300 TGTGATGGACAACTGAAGGGAGG + Intronic
1030809217 7:113955242-113955264 TGTGGTGAACACCTGCAGGGAGG - Intronic
1031177746 7:118374082-118374104 TATGTTGCACACCTGGTGGGGGG - Intergenic
1032106697 7:129037613-129037635 GGTGGTGCAGTCCTGGAGGAGGG + Intronic
1033142596 7:138840793-138840815 TGTGGTGCTCACAGGGAGGAGGG - Intronic
1034501808 7:151455497-151455519 TGAGATGGCCACCTGGGGGAAGG - Intergenic
1035025598 7:155823181-155823203 TGTGATGCACAGCTAGAGCCTGG + Intergenic
1042855327 8:73261338-73261360 TGTGCTGCACACCAGCAGGGAGG + Intergenic
1043564962 8:81537746-81537768 TCAAATGCACACCTGGAGGTGGG + Intergenic
1047965025 8:130040103-130040125 TGTAATGCAGCCCTGCAGGAAGG - Intergenic
1048336186 8:133504148-133504170 TATGATGCAGGACTGGAGGAGGG - Intronic
1053493074 9:38526005-38526027 TGTTATGCTCCTCTGGAGGATGG + Intergenic
1055168328 9:73223701-73223723 TGTGGTGAACACCTGCAGGAAGG + Intergenic
1056014091 9:82364122-82364144 TGTGATGTACACATTGAGAAAGG - Intergenic
1056752657 9:89363435-89363457 GATGATGCAGAGCTGGAGGAAGG - Intronic
1058847460 9:108975273-108975295 TTTGAGGCATGCCTGGAGGAGGG - Intronic
1058980401 9:110164129-110164151 TGTGGTTCTCATCTGGAGGATGG + Intronic
1060494919 9:124111544-124111566 TGGGCTGCTCCCCTGGAGGAGGG - Intergenic
1061432334 9:130539006-130539028 TGTGATCCTCACCTTGACGACGG + Intergenic
1062368939 9:136226706-136226728 CGTGATGCTCACCTGGAAGGTGG + Intronic
1062644711 9:137541644-137541666 TGTGTTGCTCTCCTGGAGGGTGG - Intronic
1203656962 Un_KI270753v1:7350-7372 TGTGAGGCATCCCTAGAGGAGGG - Intergenic
1186456555 X:9714423-9714445 TGTGATGGAAACAGGGAGGAAGG + Intronic
1187343487 X:18442157-18442179 TGTGATGCAAACCTGGGGGTGGG - Intronic
1188980603 X:36723716-36723738 GGAGATGCACATTTGGAGGAAGG + Intergenic
1190340174 X:49290208-49290230 TGTGGTTCACACCAGGAGGCTGG - Intronic
1192034546 X:67547560-67547582 TCTGATGCAAACCTGAAGTAGGG - Intronic
1194567961 X:95517237-95517259 TGTGATTCTCACATGGAGGAGGG + Intergenic
1201509685 Y:14745336-14745358 TGTGATGCAGAAGTGTAGGATGG - Intronic