ID: 967054192

View in Genome Browser
Species Human (GRCh38)
Location 3:185813888-185813910
Sequence AAGGAGAAGGAGAATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3540
Summary {0: 1, 1: 3, 2: 61, 3: 459, 4: 3016}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967054179_967054192 25 Left 967054179 3:185813840-185813862 CCAGGCACCACACTGCCAGCCCT 0: 1
1: 0
2: 0
3: 40
4: 339
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054189_967054192 -9 Left 967054189 3:185813874-185813896 CCCAAGGAAATGCAAAGGAGAAG 0: 1
1: 0
2: 3
3: 43
4: 481
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054190_967054192 -10 Left 967054190 3:185813875-185813897 CCAAGGAAATGCAAAGGAGAAGG 0: 1
1: 0
2: 2
3: 49
4: 582
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054184_967054192 5 Left 967054184 3:185813860-185813882 CCTTTCCAGCCATCCCCAAGGAA 0: 1
1: 0
2: 2
3: 23
4: 248
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054183_967054192 6 Left 967054183 3:185813859-185813881 CCCTTTCCAGCCATCCCCAAGGA 0: 1
1: 1
2: 3
3: 41
4: 313
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054180_967054192 18 Left 967054180 3:185813847-185813869 CCACACTGCCAGCCCTTTCCAGC 0: 1
1: 0
2: 5
3: 41
4: 458
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054188_967054192 -8 Left 967054188 3:185813873-185813895 CCCCAAGGAAATGCAAAGGAGAA 0: 1
1: 1
2: 5
3: 69
4: 518
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054186_967054192 -4 Left 967054186 3:185813869-185813891 CCATCCCCAAGGAAATGCAAAGG 0: 1
1: 0
2: 3
3: 27
4: 287
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054181_967054192 10 Left 967054181 3:185813855-185813877 CCAGCCCTTTCCAGCCATCCCCA 0: 1
1: 0
2: 7
3: 68
4: 605
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016
967054185_967054192 0 Left 967054185 3:185813865-185813887 CCAGCCATCCCCAAGGAAATGCA 0: 1
1: 0
2: 5
3: 18
4: 193
Right 967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG 0: 1
1: 3
2: 61
3: 459
4: 3016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967054192 Original CRISPR AAGGAGAAGGAGAATGAGAG AGG Intronic
Too many off-targets to display for this crispr