ID: 967059626

View in Genome Browser
Species Human (GRCh38)
Location 3:185860678-185860700
Sequence TCTGATATGCAGAATCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967059625_967059626 24 Left 967059625 3:185860631-185860653 CCTACAAAATGGGAGGGAATATT No data
Right 967059626 3:185860678-185860700 TCTGATATGCAGAATCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967059626 Original CRISPR TCTGATATGCAGAATCTATA AGG Intergenic
No off target data available for this crispr