ID: 967061880

View in Genome Browser
Species Human (GRCh38)
Location 3:185879962-185879984
Sequence CTGTGTGTCCAGATAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967061877_967061880 -5 Left 967061877 3:185879944-185879966 CCACTTAGGAGATTGTTGCTGTG No data
Right 967061880 3:185879962-185879984 CTGTGTGTCCAGATAAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967061880 Original CRISPR CTGTGTGTCCAGATAAGAAG GGG Intergenic
No off target data available for this crispr