ID: 967065462

View in Genome Browser
Species Human (GRCh38)
Location 3:185911325-185911347
Sequence AAGGGCATTCTCAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967065462_967065469 4 Left 967065462 3:185911325-185911347 CCCTCTCCCCTGAGAATGCCCTT No data
Right 967065469 3:185911352-185911374 TTCTTATCAAACCCTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967065462 Original CRISPR AAGGGCATTCTCAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr