ID: 967067716

View in Genome Browser
Species Human (GRCh38)
Location 3:185935370-185935392
Sequence GTGTGTCCCTCATCCCTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967067716 Original CRISPR GTGTGTCCCTCATCCCTCGT TGG (reversed) Intronic
900176407 1:1293319-1293341 GGGTGTCCCTCACCCCACCTGGG - Exonic
900549147 1:3245342-3245364 GTGGGTCCCCTGTCCCTCGTAGG - Intronic
901152402 1:7112634-7112656 GTGTGTCCCTCTCCCTTTGTAGG + Intronic
915485590 1:156218100-156218122 GTGTGTCCCTGATTCCTGGCAGG + Intronic
916683001 1:167121392-167121414 GTGTGTCCCACCTCGCTCGCAGG + Intronic
917052621 1:170941022-170941044 GTGTGTCCCCAATCCATCCTGGG - Intronic
920100374 1:203513665-203513687 ACTTGTCCCTCATCCCTTGTGGG - Intergenic
921648077 1:217643354-217643376 ATGTTTCCCTCATCACTCTTGGG + Intronic
1064926619 10:20576404-20576426 ATGTGTCTCTCATTCCTCCTGGG - Intergenic
1065475524 10:26133450-26133472 CTGTGTTCCTCATCCCTGCTAGG + Intronic
1067525074 10:47033655-47033677 GTGCATCCCTGATGCCTCGTGGG + Intergenic
1067740963 10:48895907-48895929 GTGGGTCCCTCATCACACGTGGG + Intronic
1067849563 10:49746085-49746107 TTGTGTCCCACATTCCTCCTGGG - Intronic
1070298242 10:75183593-75183615 GTGTGTCCTTCATCCTTGGCTGG - Intergenic
1075171578 10:120120707-120120729 CTGTGCCCCACATCCCTCTTGGG - Intergenic
1079064495 11:17277163-17277185 GGGTGTCCCTCCTCACTAGTGGG - Intronic
1084274682 11:68045205-68045227 GTGTGCCCCTCATCCCAGGAGGG - Intronic
1084436966 11:69148621-69148643 GTGTGTACCTCAGCCCTCAGCGG + Intergenic
1087215451 11:95488350-95488372 GTATGTCTCTCATCCATCGCTGG + Intergenic
1091364013 11:135001811-135001833 GTGTGTCCCTCCTTCCTCTGAGG - Intergenic
1094818746 12:34209148-34209170 GTGTCACCCTCCTTCCTCGTCGG - Intergenic
1095953035 12:47791771-47791793 ATGTGCCCCTCATCTCTCATGGG + Intronic
1105291953 13:19058890-19058912 CTGTGTTCCTCTTCTCTCGTGGG + Intergenic
1106188857 13:27432736-27432758 GTGTTTCCCACATCCTTCCTGGG - Exonic
1121987155 14:98518177-98518199 GTGTGTCCTTCGTCCCTTGATGG - Intergenic
1202848448 14_GL000225v1_random:1104-1126 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202856170 14_GL000225v1_random:53334-53356 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202857131 14_GL000225v1_random:58602-58624 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202859540 14_GL000225v1_random:72698-72720 GTGTCACCCTCCTCCCTCGTGGG - Intergenic
1202860717 14_GL000225v1_random:79529-79551 GTGTCACCCTGCTCCCTCGTGGG - Intergenic
1202862215 14_GL000225v1_random:89987-90009 GTGTCTCCCTTTTCCCTCGTGGG - Intergenic
1202864294 14_GL000225v1_random:105044-105066 GTGTCACCCTGCTCCCTCGTGGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1128785765 15:70395710-70395732 TTGTGTCCCTCAAACCTCGCAGG - Intergenic
1129960837 15:79682407-79682429 GAGTGTCCCCCACCCCTCCTGGG - Intergenic
1130661117 15:85832069-85832091 CTTTGTCCCTCCTCCCTCCTGGG + Intergenic
1131063372 15:89417931-89417953 GTGTGCCTCTCCTCCCTCCTGGG - Intergenic
1132050512 15:98604385-98604407 GTGTGTCCCAGATGCTTCGTGGG - Intergenic
1132949195 16:2551074-2551096 GTGGGTCCCGCAGCCCTTGTGGG + Intronic
1132965393 16:2651054-2651076 GTGGGTCCCGCAGCCCTTGTGGG - Intergenic
1142434103 16:90046422-90046444 GTGTGTCCCTCAGCCTCCATGGG - Intergenic
1143370105 17:6434259-6434281 GTGGGTCCCTCCTCCCTGGGGGG - Intronic
1152254736 17:79231305-79231327 CTGTGTCCTTCATCCCTCCAGGG - Intronic
1154289674 18:13096524-13096546 GTGTGTCCCTTTACCCTCCTGGG - Intronic
1157663321 18:49464756-49464778 GTTTGACCTTCATCCCTCCTTGG - Intergenic
1160212506 18:76894273-76894295 GTGTCTCCCTCACCCCTCTCAGG - Intronic
1161644221 19:5443414-5443436 CTGTGTCCTTCTTCCCTCGCTGG - Intergenic
1166099086 19:40560402-40560424 AGGTGCCCCTCATCCCTCCTCGG + Exonic
926631119 2:15137047-15137069 GAGTGTCCCTCAGGCCTCTTTGG - Intergenic
929901252 2:46005600-46005622 GTGTGTCCCTCAGCCAGCATGGG - Intronic
934541360 2:95177880-95177902 CTCTGTCCCTCAGCCCTCGCTGG - Intronic
938833240 2:135073930-135073952 GTGGATCCCTCATCCCTTGGTGG - Intronic
943910002 2:193551694-193551716 GTGTGTCTTCCATCCTTCGTAGG - Intergenic
944293932 2:198040647-198040669 GTGTGTTCCTCATTCCTCCTGGG - Intronic
945794065 2:214340144-214340166 ATGTGTCCCTCATCTCTCATGGG + Intronic
947316738 2:228866849-228866871 GTGTGTACCTCATCCTTCCTGGG + Intronic
947453068 2:230225926-230225948 GTCTGTCCTTCATCTCTGGTAGG + Intronic
947612825 2:231534146-231534168 GTGTGTCCCTCATGCCACCCTGG + Intergenic
948079537 2:235194258-235194280 GTGTGGTTCTCATCCCTCATTGG - Intergenic
1173024850 20:39298445-39298467 GTGGTTCCCTCATCCCGAGTGGG - Intergenic
1175264472 20:57694221-57694243 CTGTGTCCCAAGTCCCTCGTGGG - Intronic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1183419006 22:37699362-37699384 GTGTGTCCCTGCTCTCTCGGAGG - Intronic
1185093041 22:48786535-48786557 GTGAGCCCCTCCTCCCTCCTGGG - Intronic
1185219823 22:49623733-49623755 CTGTGTCCCTCACCCAACGTGGG - Intronic
957084818 3:75669440-75669462 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
961269424 3:125677887-125677909 GTGTCACCCTCCTCCCTCGTCGG + Intergenic
961478082 3:127161050-127161072 ATGTGTCCCTAACCCCTCTTGGG + Intergenic
966643301 3:182214770-182214792 GTGTGTCTCTCATCCTTTATCGG - Intergenic
967067716 3:185935370-185935392 GTGTGTCCCTCATCCCTCGTTGG - Intronic
968120145 3:196120326-196120348 GCGTGTGCCCCATCCCTCCTAGG - Intergenic
971479857 4:27104701-27104723 GTGTGTCCATTATCCTTCGTGGG + Intergenic
971737425 4:30473909-30473931 GGGTCTCCTTCATCCCTCATAGG + Intergenic
978144987 4:105362204-105362226 GTGTTTCCCTGCTCCCTCTTGGG + Intergenic
984713028 4:182901992-182902014 GTGTGTACCCCATCCCTCAGCGG - Intronic
994197526 5:96936287-96936309 CTGCCTCCCTCAGCCCTCGTGGG - Intronic
1001296448 5:170502539-170502561 GTGTGTCTCTCCACCTTCGTGGG + Intronic
1007735161 6:43977802-43977824 TTGAGTCCCTGATCCCTCTTGGG + Intergenic
1010590456 6:77706303-77706325 GTGTGGCACTCATTCCTTGTGGG - Intronic
1011585583 6:88921663-88921685 ATGTATCCATCATCCCTCTTTGG + Intronic
1013059825 6:106622742-106622764 GTGCGTCTCTCATCCGTCGCTGG + Intronic
1016437425 6:144051404-144051426 GTGTGTGCCTCATGCATGGTGGG - Intronic
1017666807 6:156727246-156727268 TTGTGTGCCTCATCACTCTTTGG - Intergenic
1018910768 6:168100014-168100036 GTGTCTCCTTTATCCCCCGTGGG - Intergenic
1026688604 7:72533593-72533615 GTGTGTGCCCCCTGCCTCGTGGG + Intergenic
1026723836 7:72855490-72855512 GTGTGTGCCCCCTGCCTCGTGGG + Intergenic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1033647679 7:143317739-143317761 GTATGTCCCTCTTCCCTACTGGG - Intronic
1046817346 8:118599097-118599119 GTGTATACCTCATTCCTCCTGGG - Intronic
1047493087 8:125390261-125390283 CTGTCTCCCTCAGCCCTAGTGGG - Intergenic
1056680528 9:88713822-88713844 GTTTCTCCCTCCTCCCTCCTTGG - Intergenic
1203740029 Un_GL000216v2:170972-170994 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1191684744 X:63878714-63878736 GAGAGTCCCTCGACCCTCGTGGG + Intergenic
1201176971 Y:11315430-11315452 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1201179673 Y:11332840-11332862 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1201753629 Y:17462339-17462361 GTTTGTCCCTCAGCCTTCATGGG - Intergenic
1201847924 Y:18443644-18443666 GTTTGTCCCTCAGCCTTCATGGG + Intergenic