ID: 967072042

View in Genome Browser
Species Human (GRCh38)
Location 3:185970963-185970985
Sequence TTTGAAGCCAAGAAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967072042_967072046 -10 Left 967072042 3:185970963-185970985 CCAGGTTGCTTCTTGGCTTCAAA No data
Right 967072046 3:185970976-185970998 TGGCTTCAAACAGGTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967072042 Original CRISPR TTTGAAGCCAAGAAGCAACC TGG (reversed) Intergenic
No off target data available for this crispr