ID: 967073278

View in Genome Browser
Species Human (GRCh38)
Location 3:185980657-185980679
Sequence CTGGAGGGAAGGCCTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967073267_967073278 12 Left 967073267 3:185980622-185980644 CCAGGGGATCTGCAGTGGGGAGC 0: 1
1: 0
2: 0
3: 24
4: 238
Right 967073278 3:185980657-185980679 CTGGAGGGAAGGCCTGTGAAGGG 0: 1
1: 0
2: 2
3: 35
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967073278 Original CRISPR CTGGAGGGAAGGCCTGTGAA GGG Intergenic
900601590 1:3505123-3505145 CTGGAGGGTAGGCTTCAGAAGGG - Intronic
901234185 1:7658803-7658825 CTGGAGGGAAGGCCCGGGTCAGG - Intronic
901533422 1:9867475-9867497 CTGGAGGGGAAGCATGTGCAGGG + Intronic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902661544 1:17907635-17907657 TTCCAGGGAAGGCCTGTGATTGG + Intergenic
902799091 1:18818401-18818423 CTGGAGGGAAGGCAGGTGGAGGG + Intergenic
902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG + Intronic
903687012 1:25139266-25139288 CTGGAGAGATGGCCTTTGCAGGG - Intergenic
903848266 1:26291132-26291154 CTGGGGTGGAGGCCTGTGGAGGG - Intronic
904593300 1:31627313-31627335 CTCCAGGGAAGGCCTGTAATTGG - Exonic
904833201 1:33318790-33318812 CTGGAGGAGAGGTCTGGGAAAGG - Intronic
904985523 1:34545153-34545175 TTGGAGGTGAGGCCTTTGAAAGG + Intergenic
905177611 1:36147699-36147721 CAGGAGGGAAGGCCTCTCAAAGG + Intronic
905178854 1:36154903-36154925 CTCTTGGGAAGGCCTGGGAAGGG - Intronic
905863472 1:41364892-41364914 CTGGAGGAAACGACTGGGAATGG - Intronic
906652232 1:47521014-47521036 CTGGAGTGAAGGCAGGAGAAAGG + Intergenic
908130511 1:61070552-61070574 CTGTGTGGAAGGCCTGTGAAAGG + Intronic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
910104859 1:83620950-83620972 ACAGAGTGAAGGCCTGTGAATGG + Intergenic
910447701 1:87315540-87315562 CTGAATGGGAGGCCTGGGAAAGG - Intergenic
910561558 1:88597414-88597436 CTGGAGAGCAGGCATGGGAATGG + Intergenic
911587128 1:99704416-99704438 CGGGAGGGAAGTGCTGGGAAGGG + Intergenic
912540523 1:110411445-110411467 CTATAAGGAAGGCCTTTGAAGGG + Intergenic
913107895 1:115631709-115631731 CTGGTTGGGAGACCTGTGAAAGG + Intergenic
914860699 1:151383502-151383524 TTGGGAAGAAGGCCTGTGAATGG + Intergenic
914873484 1:151494768-151494790 TTGGAGGGCAGGCCTGTTAGGGG + Intergenic
915518884 1:156429964-156429986 GTTGAGGGGAGGCCTGGGAAGGG - Intronic
917725205 1:177821315-177821337 CTGAAGAGAATGCCTGGGAAGGG + Intergenic
917747168 1:178021484-178021506 CTGGAGGGATGAGCTGTGACTGG + Intergenic
918379197 1:183937600-183937622 CTTGTGGGGAGGCCTGTGGATGG - Exonic
919122027 1:193353406-193353428 CTGAATGAGAGGCCTGTGAAGGG + Intergenic
919539200 1:198827921-198827943 CTGAAGGGAAGTGCTGGGAAGGG - Intergenic
920674526 1:208029930-208029952 CTGGAGGACAAGCCTGTGACAGG - Intronic
921627390 1:217392064-217392086 CTGGAGGTGAGGACAGTGAAGGG - Intergenic
922022192 1:221716489-221716511 CTGGGAGGAAGGTCTGTGGATGG - Intronic
922361157 1:224822696-224822718 CAGGAGGGAAGGCCCATGAAAGG + Intergenic
922794861 1:228334995-228335017 CCCGAGGGAAGGCCTGTGGCAGG + Intronic
922862431 1:228830699-228830721 CTGTAGGGGAAGCCTGTGAGTGG + Intergenic
923049186 1:230378794-230378816 AAGGACTGAAGGCCTGTGAAAGG - Intronic
923369710 1:233297653-233297675 CTGGAAGGTAGGGCTGGGAATGG + Intergenic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924584330 1:245348629-245348651 CTGGAGGTAAAGCCTTTGGAAGG - Intronic
924632998 1:245760027-245760049 CAGGAGGGAAGCACTGGGAAGGG + Intronic
1063602918 10:7498257-7498279 CTGGAAGCAAGGCCTGGTAATGG + Intergenic
1064003276 10:11681072-11681094 CTGGAGGGAAAGCCTCAGATGGG - Intergenic
1065928331 10:30456354-30456376 CTGCAGGGAAAGCTTGAGAACGG + Intronic
1066494850 10:35932830-35932852 CTGGAGGGAAGGTATTGGAACGG - Intergenic
1066647545 10:37625010-37625032 CTGGAGGGAAGGTATTGGAACGG + Intergenic
1067740419 10:48891190-48891212 TTGGAGGGATGGCCTGGGACTGG + Intronic
1067753474 10:48986647-48986669 CGGGACAGATGGCCTGTGAAGGG + Intergenic
1070532143 10:77346375-77346397 AGGGAGGGAAGGCCAGTGAGAGG - Intronic
1070610178 10:77927122-77927144 CCGGAGGGACGGCCTGGGGAGGG - Intergenic
1071588811 10:86851726-86851748 CTGGAAGGAGTGCCTGTGAAGGG + Intronic
1072143622 10:92613614-92613636 CTTGAGGTAAGCCCTTTGAAAGG + Exonic
1072204715 10:93193082-93193104 CCAGAGAGAAGTCCTGTGAAAGG + Intergenic
1073213764 10:101825287-101825309 CTAAAGGGAAGGTCTGTGCATGG + Intergenic
1074585220 10:114761810-114761832 ATGGAGGGAAGGCCTTTCCAAGG - Intergenic
1074968666 10:118517000-118517022 CTGTAGGGAAGGCAACTGAATGG + Intergenic
1075209152 10:120476214-120476236 CTGGAGGCAAGGCCTGCACAGGG - Intronic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1076375192 10:129979031-129979053 CTGGATTGAAGGTATGTGAATGG - Intergenic
1076704649 10:132294417-132294439 CTGGAGGGGAGGCCTGCAGACGG + Intronic
1079042077 11:17068232-17068254 CAGGAGGGCAGGCCTGAGAGGGG + Intergenic
1079045935 11:17103229-17103251 CTGCAGGGAAGACATGTGTAAGG + Intronic
1079456876 11:20643921-20643943 CAGGAGTGGAGGGCTGTGAAGGG + Intronic
1080230863 11:30016862-30016884 CAGGAGGGATTGCCTGGGAAAGG + Exonic
1080976551 11:37349564-37349586 CTGGAGAGCAGGCATGGGAATGG + Intergenic
1081072492 11:38628821-38628843 CTGGAGAGCAGGCATGAGAATGG + Intergenic
1081528943 11:43944840-43944862 CTGGAGGGAGGGTCTGGGAGAGG - Intergenic
1083093886 11:60229575-60229597 CTGTCAGGAAGGCCTGTGGAGGG + Intronic
1083492380 11:63022441-63022463 CTGCAGAGCAGGCCTGTGCAAGG - Intergenic
1083685160 11:64371192-64371214 CTGGAGGCAAGGTCTGGGAATGG + Intronic
1083989994 11:66241012-66241034 CTGGAGAGAAGGCCTGAGCCCGG - Intronic
1084029103 11:66470599-66470621 CTGGAGGGCATGGCTGTGAGAGG - Intronic
1084218494 11:67664311-67664333 TTGCTGGGAAGGGCTGTGAAAGG + Intronic
1084462010 11:69301545-69301567 AGTGAGGGAAGGCCTGTGAGCGG - Intronic
1084534420 11:69748282-69748304 CTGCAGGGAAGGCCAGGGAGGGG - Intergenic
1085276107 11:75301410-75301432 TAGGAGGGTAGGGCTGTGAAGGG + Intronic
1085346441 11:75771101-75771123 GTGAAGGGAAGTCCTGTGACGGG + Intronic
1088318463 11:108530923-108530945 CTTGTGGGAAGGCCTGGGAGTGG - Intronic
1088393253 11:109339377-109339399 CTGGAGGTGAGGCTTTTGAAAGG + Intergenic
1089908832 11:122074983-122075005 CTGGAGGGAAGTCCTATGGGAGG + Intergenic
1090362327 11:126182240-126182262 CTGGAGGGACAGCCTGGGAGGGG - Intergenic
1090865828 11:130699638-130699660 ATGCAACGAAGGCCTGTGAATGG - Intronic
1091106321 11:132922752-132922774 CAGGAACGAAGTCCTGTGAAGGG + Intronic
1091888055 12:4031197-4031219 CTGGAGGGAAAGCCAAGGAAAGG - Intergenic
1091986633 12:4915029-4915051 CAGGAGGGAAGGCCTAGGAAAGG - Exonic
1092161208 12:6316399-6316421 CTGACGGTGAGGCCTGTGAAGGG + Exonic
1092255803 12:6926339-6926361 CTAGATGGAAGGCCTGAGGATGG + Intronic
1094643140 12:32295998-32296020 CTGGGGGGAAGGCATGTAAGGGG + Intronic
1097191761 12:57222724-57222746 CTGGAGGGTGGGCCTGAGAGAGG - Intronic
1098454050 12:70652446-70652468 CTGGAGGAAAGACCTTTCAAAGG + Intronic
1098897844 12:76084051-76084073 CGGGAGGGAGGGGCTGTGGAGGG - Intronic
1100282223 12:93128658-93128680 CTGGAGAGGAGGCCTGTGTTAGG - Intergenic
1100315143 12:93438419-93438441 CTGGAGGAAAGTCCTGTGACTGG + Intronic
1101782446 12:107847831-107847853 CTGGAGGTAAAGCCTCAGAAAGG + Intergenic
1103016641 12:117499913-117499935 CTGGGAGGAGGGCCTGTGTAAGG + Intronic
1103730931 12:123027310-123027332 CTGGAAGGCAGAGCTGTGAAAGG + Intronic
1103828808 12:123762571-123762593 CAGGAGGGAAGCCCGGGGAAGGG - Intronic
1104109266 12:125689929-125689951 CTGAGGGGAAAGCCTGTGAAGGG - Intergenic
1104611841 12:130235174-130235196 TTGGAGGGAAGGGCAGTGAAGGG + Intergenic
1104965295 12:132506212-132506234 CTGGAGGGTGGGTCTGTGGATGG + Intronic
1105654653 13:22423117-22423139 TTGGAGGGAACATCTGTGAAAGG - Intergenic
1106542917 13:30705864-30705886 CTGGAGGAGAGGGCTGGGAAGGG + Intergenic
1108460591 13:50663273-50663295 CTGGATGGAAGGACTGACAAAGG + Intronic
1110121031 13:71882035-71882057 ATGAAGGGAAGGACTGGGAAAGG - Intergenic
1110407307 13:75165237-75165259 ATGGAAGGAAGGCCAGCGAACGG + Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1110929987 13:81204045-81204067 ATGGTGGGATGGCCTATGAAAGG + Intergenic
1111462646 13:88566921-88566943 CTGGAGGGAAGGGGAGGGAAGGG + Intergenic
1113074532 13:106454885-106454907 CAGGAGGTGAGGCCTCTGAAAGG - Intergenic
1113501079 13:110774729-110774751 CTGGAGGTAGGGCCTTTGGAAGG - Intergenic
1113853769 13:113432981-113433003 GTGGAGGGCAGGCCTCTGAGAGG - Intronic
1115772633 14:36682312-36682334 GTGGAGGGCAGGTCTGTGAGTGG + Intronic
1117467459 14:56007634-56007656 CTGAAGGGGGGGCCTGTGAAAGG - Intergenic
1117652345 14:57919968-57919990 GAGGAGGCAAGGCATGTGAAAGG - Intronic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1118956681 14:70489158-70489180 CTGGAGGGGAGCCCACTGAAGGG + Intergenic
1119380403 14:74224652-74224674 CTGGAGGGAAGGACTGTGGTAGG - Intergenic
1120973353 14:90228171-90228193 CTGGAGGACAGGCATGGGAATGG + Intergenic
1121333845 14:93064706-93064728 CTGGAAAACAGGCCTGTGAAAGG + Intronic
1121824468 14:96999355-96999377 GGGTGGGGAAGGCCTGTGAAGGG - Intergenic
1121972127 14:98367867-98367889 CTAAAGGGAAGGTCTGTAAACGG + Intergenic
1122345802 14:101059402-101059424 CTGGACACAAGGCCTGTGTAAGG + Intergenic
1122594157 14:102877717-102877739 GTTGAGGGAGGGCCTGTGGAAGG - Intronic
1122602479 14:102928568-102928590 CTGGAGGGAAGGCGCGTCGAGGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123582008 15:21724192-21724214 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1123618655 15:22166788-22166810 CTGGAGGGGTGGACTGGGAAAGG - Intergenic
1124579593 15:30941749-30941771 CAGGAGGGAGAGCTTGTGAAAGG + Exonic
1124612312 15:31216501-31216523 CTGGCAGGAAGGGCTGGGAAGGG - Intergenic
1125567145 15:40685391-40685413 CAGGAGGCAAGGCCTGGAAATGG + Intergenic
1125604340 15:40931495-40931517 CTGGTGGCAAGGCCTCTGAGGGG - Exonic
1125677078 15:41507894-41507916 CTGGACGACAGGCCTCTGAAAGG + Intronic
1126584046 15:50265784-50265806 CTGGAGGAAGGGACTTTGAAGGG - Exonic
1128338491 15:66803474-66803496 CTGCAGGAGAGGCCTGTGGAGGG + Intergenic
1128613398 15:69091222-69091244 CTGAAGGTAAGCCCTGTGGAAGG - Intergenic
1128743840 15:70100288-70100310 GAGGAGGGGTGGCCTGTGAAAGG + Intergenic
1128764627 15:70243606-70243628 CTGGGAGGGAGGCCTGGGAAGGG + Intergenic
1129652232 15:77499230-77499252 CAGGAGGGAAGGCCTGGCACTGG - Intergenic
1129890966 15:79071728-79071750 GGGGAGGGAAGACCTGGGAAGGG - Intronic
1130995911 15:88904016-88904038 CTGTCGGGAAGGCCTTTGACTGG - Intronic
1131066609 15:89438796-89438818 GTGCAGGGAAGCCATGTGAACGG - Intergenic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1131225862 15:90624017-90624039 CTGGAGGGAGGCCATGTGGAGGG - Intronic
1131889429 15:96956442-96956464 CTAGAGGGGAGGCCTGGCAAGGG + Intergenic
1132581531 16:686892-686914 CTGGAGGCGAGGCCTGCGAAGGG + Exonic
1134332794 16:13265537-13265559 GTGGAGGGAAGGGCGGGGAAGGG - Intergenic
1134416900 16:14051928-14051950 CGAGAGGGAAGGCATGTAAAGGG - Intergenic
1135117428 16:19735560-19735582 CGGGAGGGAAAGCCTGTGTTTGG + Intronic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136136617 16:28260233-28260255 GTGGAGGGAAGGGCTGTGCCTGG + Intergenic
1137589877 16:49686992-49687014 CTGGAGGGAAGCCCCAGGAAGGG + Intronic
1138063974 16:53921225-53921247 AGGGAGGGATGGCCTTTGAAAGG - Intronic
1138380861 16:56601417-56601439 CTGGAAGGAGGCTCTGTGAAGGG - Intergenic
1139354604 16:66360114-66360136 CTGGAGGGCAGGCCTGAGTCTGG - Intergenic
1141469088 16:84226353-84226375 GTGTAGGGATGGCCTGTGAAGGG + Intronic
1141492945 16:84387184-84387206 CTGGAGGGCTTGCATGTGAATGG + Intronic
1141623589 16:85249838-85249860 CTGGAGCGATGGGCTGTGGAGGG - Intergenic
1141786044 16:86201498-86201520 CTGGAGGCCAGGCTTGAGAAGGG + Intergenic
1143347640 17:6261701-6261723 CTGAAGGGAAGGACAGTGGAGGG + Intergenic
1144160355 17:12551843-12551865 CTGGAGGGTAGGCAGGTGCAGGG - Intergenic
1146446502 17:32936773-32936795 CTGGGAGGAAGGCGTGTCAAGGG - Intronic
1147164467 17:38586061-38586083 CTGGACAGAAGGCCTGAGACAGG + Intronic
1148068867 17:44894626-44894648 CTGGAGAGGAGGCATGTGAAAGG - Intronic
1148209271 17:45798547-45798569 CTGCAGGCAAGGCCTGTGTTTGG - Intronic
1149641561 17:58206156-58206178 CTCGACGGAAGGCCTCTGTAAGG + Exonic
1149645651 17:58239637-58239659 ATAGGGGGAAGGCCTGAGAAGGG - Intronic
1150361822 17:64541938-64541960 CTGTAGGGCAGGCCTATGACAGG - Intronic
1150930680 17:69581481-69581503 CTGGAGGGAAGGCGTGGGGAGGG - Intergenic
1151351484 17:73534593-73534615 CAGCAGGGAAGGCCGGTGGAGGG + Intronic
1151377079 17:73697249-73697271 CTTGAGGGAAGGCCAGTGGTTGG - Intergenic
1152117898 17:78399940-78399962 CCGAGGGGAGGGCCTGTGAAAGG - Intronic
1152662571 17:81549610-81549632 CAGGAGAGAAGGGCTTTGAAGGG - Intronic
1152735233 17:81993971-81993993 CTGCAAGGAAGGCCTGAGAAGGG + Intronic
1153074233 18:1144343-1144365 CTGGAGGGGAGGTCTATAAATGG - Intergenic
1153715951 18:7848131-7848153 CTGGTGGGGAGGACAGTGAAGGG - Intronic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1154293266 18:13129198-13129220 CTGGAGGGAAGGACTGCACAAGG - Intergenic
1154358462 18:13640633-13640655 CTGGTGGGCTGGCCTGGGAAAGG + Intronic
1155254814 18:23985837-23985859 CAGGAGAGAAAGACTGTGAAGGG - Intergenic
1155989484 18:32265022-32265044 TCGCAGGGAAGGGCTGTGAAAGG + Intronic
1158949050 18:62475006-62475028 TGGGAGCGAAGGCCTGGGAAGGG + Intergenic
1160348085 18:78151463-78151485 CTGGAGGGAAGGGCCCTGAAAGG + Intergenic
1160742741 19:694971-694993 CTGGAGGGACGGCCTGAGTCAGG + Intronic
1160868956 19:1268378-1268400 CAGTAGGGGAGGCCTGTGGAAGG + Intronic
1161045170 19:2130718-2130740 CTGGAGGGCAGGCCTGAGTCAGG - Intronic
1161056636 19:2193967-2193989 CTGGAGGGCCGGCCTGTAATGGG - Intronic
1161342019 19:3748093-3748115 ATGGGGGGCAGGCCTGGGAAGGG + Intronic
1162437169 19:10668224-10668246 CAGGAGGGAAGGAGTGTGAGGGG - Intronic
1163201156 19:15770134-15770156 CTGGGGGGAAGACCTTGGAATGG - Intergenic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1165015781 19:32879092-32879114 CTGCAGGGAAGGCCTGTGTGAGG + Exonic
1165061374 19:33206815-33206837 CAGGAGGCAAGGCCTGCGCAGGG + Intronic
1165203656 19:34165681-34165703 TTGGAGGTAATGCCTGAGAAAGG - Intergenic
1165217636 19:34287854-34287876 CTGGAGGTAGGGCCTTTGGAAGG - Intronic
1165378121 19:35458049-35458071 CCAGAGAGAAGGCCAGTGAAGGG + Intergenic
1165841915 19:38793032-38793054 CTGGTGAGGAGGCCTGTGAGAGG + Intergenic
1167345375 19:48942417-48942439 CTGGAGGGAAGTCCTGGGTCAGG - Intronic
1168342496 19:55633337-55633359 CTTGAGGGCAGACCTGGGAAAGG + Intergenic
1168699453 19:58427995-58428017 CAGGAAGGAAGGCCTGAGTAGGG + Intergenic
925096062 2:1204127-1204149 CTGGAGGGATTGCCTGCAAACGG + Intronic
925454483 2:4003435-4003457 CTTGAGGGAAGGCTTGTGGATGG - Intergenic
925911002 2:8573636-8573658 TGGGAGTGAAGGCCTGTGCAAGG + Intergenic
926122841 2:10254211-10254233 TTGGAGGCAAGGCCTTTGAGAGG - Intergenic
926219448 2:10925298-10925320 ATGGAGAGAAGCCCTGTGCATGG - Intergenic
926834195 2:16999329-16999351 CAGGAGCTAGGGCCTGTGAAGGG + Intergenic
927633552 2:24794285-24794307 CTTGAGGGAGGGCCAGTGTAGGG + Intronic
927678056 2:25121444-25121466 CAGCAGGGGAGGCCTGAGAAGGG + Intronic
928184780 2:29100730-29100752 CAGAAGGAAAGGCCTGTGCAAGG + Intronic
932127528 2:69157379-69157401 CTGGAGCCAAGGCCAGTGATGGG - Intronic
933013490 2:77093476-77093498 CTGAAGGGAAGTCTTGTGTAAGG - Intronic
933408769 2:81897898-81897920 CTGGAGAGTAGGCCTTTGATAGG - Intergenic
933729925 2:85448822-85448844 CTGGAGCGGGGGCCTGTGATGGG - Intergenic
934058149 2:88269802-88269824 CTGGAGGCAGTGCCTGTGGAGGG + Intergenic
934082871 2:88484264-88484286 CAGGAGAGAAGCCCAGTGAATGG - Intergenic
935674525 2:105583005-105583027 CTGGAGGGATGGCAGGGGAATGG - Intergenic
935842719 2:107130986-107131008 CTGTAGGGAAGGGATGAGAAAGG - Intergenic
937390791 2:121484552-121484574 CTGGATGGAAGCCCTGTGATGGG - Intronic
937820269 2:126302652-126302674 TTGGAGGTAAGGCCTAAGAAAGG + Intergenic
937873259 2:126801644-126801666 CTGGGGGGGAGTCCTGTGGAGGG - Intergenic
937978440 2:127596334-127596356 CAGGAGGGCAGGCCAGAGAAGGG - Intronic
938178058 2:129154336-129154358 CTGGAGGAAAGACCTGGAAATGG - Intergenic
938543160 2:132303371-132303393 CTGGAGGAAAGCCCTGATAATGG - Intergenic
939487028 2:142827267-142827289 CTTGGGGGAAGGCCTGTGCTGGG - Intergenic
940451622 2:153844508-153844530 CTGCAGTGAAGGTCTCTGAAAGG + Intergenic
940897214 2:159092258-159092280 AGGAAGGGAAGGCCTGAGAAAGG - Intronic
941350637 2:164429795-164429817 CTGCAGGGAAGGTCTAAGAAAGG + Intergenic
941976399 2:171409734-171409756 ATGGAAGGAAGTCCTCTGAATGG + Intronic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
946109196 2:217399197-217399219 CTGGGTGGAAGGGCTGTAAAAGG - Intronic
948307150 2:236956782-236956804 CTGGAGATAATGGCTGTGAAAGG - Intergenic
948944188 2:241211174-241211196 CTGGAGGGGGGCCCTGTGGAGGG - Intronic
1168799593 20:635587-635609 CAGGAGGGCAGGCCTGGGGAAGG - Intergenic
1168957755 20:1846472-1846494 CTGCAGGGGAGCCCTGGGAATGG + Intergenic
1170293339 20:14795657-14795679 CAGGAGGCAAGGCCAGTGATAGG + Intronic
1170554078 20:17501829-17501851 CAGGAGAGAAGGCATGTGACAGG - Intronic
1170737884 20:19026827-19026849 CTGGAAGGGAGGACTGTGGAGGG - Intergenic
1171872044 20:30536205-30536227 CTGGAGGAAAGCCCTGATAATGG - Intergenic
1173373614 20:42462140-42462162 CTGGAGGGAATTTCTTTGAATGG + Intronic
1173785273 20:45788657-45788679 CTGGAGGGAAGAGTTGTAAAGGG - Intronic
1174130980 20:48343159-48343181 CTGGAGTGAGGGCCTGTCAGGGG + Intergenic
1175221198 20:57417482-57417504 ATAGAGGGAAGGAGTGTGAATGG + Intergenic
1175596633 20:60239766-60239788 CTGGAGGGAAAGCCTGAGGGTGG + Intergenic
1175668058 20:60877242-60877264 CCCGAGGGAAGGCATGTGACAGG - Intergenic
1175676299 20:60949357-60949379 ATGGTGGTCAGGCCTGTGAAAGG - Intergenic
1175892421 20:62321562-62321584 GTGGAGGCAGGGCCTGTGGAGGG + Intronic
1175965193 20:62656797-62656819 CTGCAGGGGATGACTGTGAATGG + Exonic
1176030455 20:63008848-63008870 CTGGTGGGGAGGCCTCTGAGGGG + Intergenic
1176194069 20:63829105-63829127 CAGGAGGTAAACCCTGTGAACGG - Intronic
1177497698 21:21910683-21910705 CTTGAAGGATGGCCTATGAAAGG + Intergenic
1178903052 21:36613119-36613141 CAGGAGGGAAGACCTGGGACAGG - Intergenic
1179128270 21:38611573-38611595 CTGGAGTGAGGGCCTGTGGGAGG - Intronic
1179437981 21:41375113-41375135 CTGGAGGGTGTGCCTGGGAATGG - Intronic
1179596312 21:42445260-42445282 CTGCAGGGAAGGGCTGGGACTGG - Intronic
1180067171 21:45418298-45418320 CTGGCGGGCAGGCGTGGGAAGGG - Intronic
1180672809 22:17566375-17566397 CAGGAGGGAAGAGATGTGAATGG - Intronic
1180696473 22:17754324-17754346 TTGGAGGGGAGGCCTGCGGAGGG - Intronic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1182158360 22:28097210-28097232 CTTGAGACAAGGCCAGTGAAAGG - Intronic
1182461326 22:30485929-30485951 CTGCAGGGAAGGCCAGTGTGGGG - Intergenic
1182886424 22:33777717-33777739 GTGAAGGGAAGGCAGGTGAAGGG + Intronic
1183597726 22:38822507-38822529 CAGGAGGGAAGGCCAGTGCGTGG + Exonic
1184279030 22:43426685-43426707 CTGCAGGGAAGGGCTCTGCAGGG + Intronic
1184762099 22:46550544-46550566 CTGGAGGTGAGGCTTGTGGAGGG + Intergenic
1184877620 22:47285491-47285513 CTGGAGGGACATTCTGTGAAGGG + Intergenic
950362889 3:12462344-12462366 CTGGAGGCAAGGCCTGAGCAGGG + Intergenic
951046589 3:18046469-18046491 TTGCAGAGAAGGCATGTGAAAGG - Intronic
952220206 3:31316804-31316826 CAGGAGAGAAGGCAAGTGAAGGG - Intergenic
953243454 3:41169624-41169646 CTGGAAGGAAGGTCAGTGGAAGG + Intergenic
954434110 3:50486903-50486925 CTGGAGGACAGGGCTGGGAAAGG + Intronic
956043896 3:65174874-65174896 CTGCAGGGAAGGACTCTGATTGG + Intergenic
959625182 3:108441907-108441929 CTGGAGGCAGTGCCTGTGAAAGG - Intronic
960009091 3:112813671-112813693 CAGGAGGGAAAGCTTGTGAAGGG + Intronic
960039325 3:113133653-113133675 CTGGATGGAAAGCTTCTGAAGGG - Intergenic
960815148 3:121664366-121664388 TTGGAGAGAAGACCTGTAAATGG + Exonic
961505710 3:127369484-127369506 CTGGTGGGGAGGCCTTGGAAAGG - Intergenic
964525933 3:157615355-157615377 CAGGAAAGCAGGCCTGTGAAGGG - Intronic
964708488 3:159646564-159646586 CTGAAGGTAAGGCCTGTGAAAGG - Intronic
966445378 3:179996266-179996288 CTGGAGAGCAGGCATGGGAATGG + Intronic
966715683 3:183011113-183011135 CTGGAGGGGAAGCCTGTGTCCGG - Intergenic
967073278 3:185980657-185980679 CTGGAGGGAAGGCCTGTGAAGGG + Intergenic
968047294 3:195631453-195631475 CTGGAGGACAGGCCTGTGCCAGG + Intergenic
968108895 3:196026189-196026211 CTGGAGTGGTGGCCGGTGAAGGG - Intergenic
968307319 3:197658471-197658493 CTGGAGGACAGGCCTGTGCCAGG - Intergenic
968568695 4:1328231-1328253 CTGGTGGTCAGGCCTGAGAAGGG + Intronic
969622194 4:8284220-8284242 CTCGAGGGAAGGGCAGTGAGGGG - Intronic
970417779 4:15876114-15876136 TTGAAGGGAGGACCTGTGAAGGG - Intergenic
973121307 4:46523535-46523557 CTGGAGGGCAGGCATTGGAATGG - Intergenic
975832389 4:78383309-78383331 CTGGAAGCAAGGACTGGGAAGGG + Intronic
979071532 4:116213808-116213830 CTGGAGGAAAGGCCGGTAGATGG - Intergenic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
980278316 4:130684343-130684365 CTTGAGGGTAGGCCTCTAAAAGG - Intergenic
980646650 4:135651829-135651851 CTGGAGAGAGGGCCTGTAATGGG - Intergenic
980970251 4:139560575-139560597 CTGGAGGGAGGGGCTGGGAGAGG + Intronic
982027169 4:151262506-151262528 GGGAAGGCAAGGCCTGTGAAAGG - Intronic
982256353 4:153455107-153455129 ATGGAGGTAAGGCCTTTGCAAGG + Intergenic
984362986 4:178761395-178761417 CTGGAGGAAAAGTCTGTGAGAGG - Intergenic
984586543 4:181570811-181570833 CTGGAGGCAACACCTGTGAAGGG + Intergenic
985711646 5:1432847-1432869 ATGCAGGGAAGGCCCGTGAAAGG + Intronic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
990236950 5:53778747-53778769 CTGCAGGGAGGGCTAGTGAAGGG + Intergenic
990302389 5:54461693-54461715 CCTGAGGGTAGGCCTATGAATGG - Intergenic
990716168 5:58639611-58639633 TTGGAGGCGAGGCCTGTGGAAGG - Intronic
996458785 5:123716855-123716877 CTGCAGGGATAGCCAGTGAATGG + Intergenic
997366032 5:133325662-133325684 CTGCAGGGATGGCCTGTGTCTGG - Intronic
998463580 5:142326034-142326056 CCGGAGGGGAGGCCGGTGAGAGG - Intronic
999253410 5:150196058-150196080 TTGCAGGGAAGGCCTCTGATAGG + Intronic
999856486 5:155600283-155600305 CTTGAGGGAAGGGTTGTGAGAGG + Intergenic
1001025932 5:168224597-168224619 CTGTGGGGAGGGCCTGTGAGCGG - Intronic
1001118515 5:168959564-168959586 CTGGAGGCGGGGCCTGTGACAGG - Intronic
1001411232 5:171513621-171513643 AGGGAGGGATGGACTGTGAAAGG - Intergenic
1001577951 5:172776993-172777015 CTGGAGGAAATGCCTTTGAGAGG + Intergenic
1001753155 5:174146787-174146809 ATAGAGGAAAGCCCTGTGAATGG - Intronic
1002198718 5:177514878-177514900 CTGGAGGGCAGGCCAGAGATTGG - Intronic
1002687861 5:181028352-181028374 CTGAAGGGAAGTGCTGGGAAGGG - Intergenic
1003105293 6:3210658-3210680 CAGGAGGGGAAGCCTGTGACAGG + Intergenic
1005354592 6:24970076-24970098 CTGGATGGGAAGCCTGGGAAAGG + Intronic
1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG + Intronic
1005942300 6:30569621-30569643 CTGGAGTAAAGCCCTGTGACAGG - Intergenic
1006148236 6:31971846-31971868 CTGGAGGGAGGGTGGGTGAAGGG - Intronic
1006457746 6:34141753-34141775 CTGGAAGGGAGGCATGTCAATGG - Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1007323715 6:41044486-41044508 CAGGTGGGGAGGCATGTGAATGG - Intronic
1007385215 6:41516049-41516071 CTGGGGGCAAGGGCTGGGAAAGG + Intergenic
1007391459 6:41551860-41551882 CTGGAGGCCAGGCTGGTGAAGGG + Intronic
1010813692 6:80329639-80329661 ATTGAGAGAAGGCCTATGAAAGG - Intronic
1011357812 6:86490456-86490478 CTGGGAGTAATGCCTGTGAAAGG - Intergenic
1011491018 6:87892531-87892553 CTGTGGGGAAGTTCTGTGAATGG - Intergenic
1012423909 6:99093969-99093991 CTTGTGGGAAGGACTGTCAAAGG - Intergenic
1013232309 6:108169350-108169372 GTGGAGGGAAGACCAGTGCAGGG - Intronic
1014492125 6:122075530-122075552 CTGGAGGGAAGGACTGGGGGTGG + Intergenic
1014561633 6:122898337-122898359 CTGGAGGTAAAGCATGAGAAAGG - Intergenic
1016797436 6:148132968-148132990 TTGGAGGTGAGGCCTTTGAAAGG - Intergenic
1016888883 6:148985904-148985926 TTGGGGGAAATGCCTGTGAAGGG + Intronic
1018048050 6:159981871-159981893 CTGGAAGGAAGCCCGGTGTATGG - Intronic
1018111449 6:160540440-160540462 ATGGAGCTATGGCCTGTGAAAGG + Intronic
1019261569 7:84686-84708 CTGGAGCCAAGGCCTGGGCAGGG + Intergenic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1020118332 7:5488677-5488699 CTGGCTGGAGGGCCTGTGAGTGG + Intronic
1021176813 7:17459101-17459123 CTGGGGGGAAGGTCTATAAATGG - Intergenic
1021852297 7:24820440-24820462 CTGAGGGGAAGGCCCTTGAACGG + Intronic
1022374671 7:29802432-29802454 ATGGAGGGGAGGACTGAGAAAGG + Intergenic
1022998862 7:35786868-35786890 GTAGAGGTAAGGCCTTTGAAAGG + Intergenic
1023133737 7:37030014-37030036 CTGGAGGCAATGTCTGTGATTGG - Intronic
1024255696 7:47538402-47538424 CTGGAGTGAAGGCCAGTGGTAGG - Intronic
1024610495 7:51059990-51060012 ATGAAGGGAGGGCCTGTGGAGGG - Intronic
1026866013 7:73824454-73824476 GTGGGGGAATGGCCTGTGAAGGG + Intronic
1029361166 7:100089394-100089416 CAGGAGGGGCGGCCTGTGCAGGG + Exonic
1032527665 7:132591991-132592013 CTGGTGGGAACTTCTGTGAAGGG + Intronic
1032535447 7:132659488-132659510 CTTGAGGGTAGGTCTGTGAAAGG - Intronic
1033877718 7:145842807-145842829 CTTGAGGGAAGGACAGAGAAGGG - Intergenic
1034285871 7:149882608-149882630 CTGGAGGGAAAGCCTCTGGGAGG - Intergenic
1034562920 7:151893447-151893469 ATGGAAGGAATGCCTGTGAAGGG + Intergenic
1034726385 7:153340072-153340094 TTGGAGACAAGGCCTTTGAAAGG - Intergenic
1038321954 8:26535284-26535306 CTGGAGGTAGGGCCTTTGAGAGG - Intronic
1039595902 8:38789512-38789534 GTGGAGGGAGAACCTGTGAAGGG + Intronic
1043269817 8:78318266-78318288 CTGTAGAGAGGTCCTGTGAAGGG + Intergenic
1044265109 8:90172849-90172871 CTGTAAGGATGGACTGTGAAAGG - Intergenic
1044289248 8:90448221-90448243 CTGAAGGGAAGGGATGTGAATGG + Intergenic
1047180249 8:122580802-122580824 CTGAAGGGAAAGCCTTGGAAGGG + Intergenic
1047212109 8:122848568-122848590 CTGCAAACAAGGCCTGTGAATGG - Intronic
1048500251 8:134968852-134968874 CTGAGAGGAAGGCCTGGGAAAGG - Intergenic
1048670329 8:136712173-136712195 CTTGGGGGAAGGTCTATGAACGG + Intergenic
1049235053 8:141508178-141508200 CTGGACGGGGGGCCTGTGAGAGG + Intergenic
1049578734 8:143401288-143401310 GTGGAGGGAAGGCCGGGGAGGGG - Intergenic
1050447350 9:5739431-5739453 CTGGAGAGTAGGCATGGGAATGG - Intronic
1050528673 9:6568476-6568498 CTGCAGGGCTGGCCAGTGAACGG + Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1052075346 9:24134762-24134784 TTGGAGGTAAGGCCTTTAAAAGG + Intergenic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053163642 9:35829717-35829739 ATGGAAGGAAGGGCTGTGATGGG - Exonic
1053352775 9:37424518-37424540 CTGCAGGGAAGGCCCGTGGGGGG - Intronic
1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG + Intronic
1053617917 9:39788580-39788602 CAGGTGTGAAGGCCTGAGAAGGG - Intergenic
1054163504 9:61697853-61697875 ATGGAGGAAAGGACGGTGAATGG - Intergenic
1054266242 9:62918849-62918871 CAGGTGTGAAGGCCTGAGAAGGG + Intergenic
1054944680 9:70783452-70783474 TTGGAGGGGAGTGCTGTGAAGGG + Intronic
1056737229 9:89220192-89220214 CTGTGGAGCAGGCCTGTGAAGGG - Intergenic
1056822742 9:89854906-89854928 GTGGAGGGAAGGGCTGTAAGAGG + Intergenic
1057612282 9:96555823-96555845 GTGGTGGGAAGTCCTGGGAATGG - Intronic
1057819596 9:98321077-98321099 CTACAGGAAAGGCCTGGGAAAGG + Intronic
1057874416 9:98743114-98743136 CTGGAGGCAGGGCCAGTGAGAGG - Intronic
1057876279 9:98756877-98756899 CTGGAGGGCAGGACTGGGATTGG - Intronic
1057899455 9:98936829-98936851 ATGGTGGGAAGGCCTGTTAAAGG - Intergenic
1059700659 9:116772689-116772711 GAGGAGGGAAGTCCTGGGAATGG - Intronic
1059751478 9:117251753-117251775 CTGGAGGCCAGGACAGTGAAAGG + Intronic
1059816197 9:117918452-117918474 CTGGAGGCATGGACTGTGATAGG + Intergenic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061766324 9:132883831-132883853 CCGGAGGGAAGGACTGTCAGGGG - Intronic
1061788110 9:133042951-133042973 CGGGAGGCAATGCTTGTGAATGG + Intronic
1062088569 9:134661857-134661879 CTGGAGGGAAGGGCTGGAAAGGG - Intronic
1062325208 9:136009551-136009573 CTGGAGGGCAGGCATGTGCTGGG + Exonic
1187245782 X:17551780-17551802 CTGCAGGGAACATCTGTGAAAGG - Intronic
1190005852 X:46737273-46737295 CTGGAGGAAAAGCCTGTAAGAGG + Intronic
1190133392 X:47771893-47771915 CTGGAGGAAAAGCCTGCAAAAGG + Intergenic
1190953867 X:55172132-55172154 TGGGTGGGAAGGGCTGTGAAGGG + Intronic
1191710495 X:64145347-64145369 CTGGAGTGAAATCTTGTGAATGG - Intergenic
1192661857 X:73050059-73050081 CTGGAGAAAAGGCATGGGAATGG - Intergenic
1194476435 X:94365106-94365128 CTGTAGGGAATGTCTGTGAGGGG - Intergenic
1197006606 X:121509925-121509947 CTGGAGTGAAGAGCTGTGAGGGG - Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1201235168 Y:11902300-11902322 ATGGATGGATTGCCTGTGAAGGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic