ID: 967074738

View in Genome Browser
Species Human (GRCh38)
Location 3:185991807-185991829
Sequence AAGGGCATTCTCAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967074738_967074745 4 Left 967074738 3:185991807-185991829 CCCTCTCCCCTGAGAATGCCCTT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967074738 Original CRISPR AAGGGCATTCTCAGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr