ID: 967074745

View in Genome Browser
Species Human (GRCh38)
Location 3:185991834-185991856
Sequence TTCTTATCAAACGCTATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967074734_967074745 28 Left 967074734 3:185991783-185991805 CCAAAGACCTTTTTACTCCTGAT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074741_967074745 -3 Left 967074741 3:185991814-185991836 CCCTGAGAATGCCCTTCTCTTTC No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074736_967074745 11 Left 967074736 3:185991800-185991822 CCTGATCCCCTCTCCCCTGAGAA No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074740_967074745 -2 Left 967074740 3:185991813-185991835 CCCCTGAGAATGCCCTTCTCTTT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074742_967074745 -4 Left 967074742 3:185991815-185991837 CCTGAGAATGCCCTTCTCTTTCT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074739_967074745 3 Left 967074739 3:185991808-185991830 CCTCTCCCCTGAGAATGCCCTTC No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074737_967074745 5 Left 967074737 3:185991806-185991828 CCCCTCTCCCCTGAGAATGCCCT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074733_967074745 29 Left 967074733 3:185991782-185991804 CCCAAAGACCTTTTTACTCCTGA No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074735_967074745 21 Left 967074735 3:185991790-185991812 CCTTTTTACTCCTGATCCCCTCT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074738_967074745 4 Left 967074738 3:185991807-185991829 CCCTCTCCCCTGAGAATGCCCTT No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data
967074732_967074745 30 Left 967074732 3:185991781-185991803 CCCCAAAGACCTTTTTACTCCTG No data
Right 967074745 3:185991834-185991856 TTCTTATCAAACGCTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967074745 Original CRISPR TTCTTATCAAACGCTATAGA AGG Intergenic
No off target data available for this crispr