ID: 967075129

View in Genome Browser
Species Human (GRCh38)
Location 3:185994925-185994947
Sequence AAACCTACCCTGTTGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967075129_967075133 21 Left 967075129 3:185994925-185994947 CCTGGGAGCAACAGGGTAGGTTT No data
Right 967075133 3:185994969-185994991 ACTGAATATTAAAGTTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967075129 Original CRISPR AAACCTACCCTGTTGCTCCC AGG (reversed) Intergenic
No off target data available for this crispr