ID: 967078031

View in Genome Browser
Species Human (GRCh38)
Location 3:186022280-186022302
Sequence TTGGGTTCGCTGACCTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967078031_967078033 -5 Left 967078031 3:186022280-186022302 CCTAGAGAGGTCAGCGAACCCAA No data
Right 967078033 3:186022298-186022320 CCCAAAATGTAATAACGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967078031 Original CRISPR TTGGGTTCGCTGACCTCTCT AGG (reversed) Intergenic
No off target data available for this crispr