ID: 967081588

View in Genome Browser
Species Human (GRCh38)
Location 3:186054695-186054717
Sequence CTTGAAGGGTGAAGCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967081588_967081597 18 Left 967081588 3:186054695-186054717 CCTCCTCCGCTTCACCCTTCAAG 0: 1
1: 0
2: 0
3: 25
4: 273
Right 967081597 3:186054736-186054758 TTACAGCTTTTTCCAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967081588 Original CRISPR CTTGAAGGGTGAAGCGGAGG AGG (reversed) Intronic
900171996 1:1273809-1273831 CTTGGAGGCTGAGGCGGCGGCGG - Exonic
901082728 1:6592749-6592771 CTTGGAGGGTGAAGAGGATGTGG - Exonic
901174145 1:7286213-7286235 CCTGAAGGGTGAGGAGGAGCAGG + Intronic
904432902 1:30476651-30476673 CCTGAAGGGTGAAGGGGCTGCGG + Intergenic
904900052 1:33849984-33850006 CATAAAGGGTAAAGAGGAGGAGG - Intronic
905402252 1:37712287-37712309 TATGAAGAGTGAAGAGGAGGAGG - Intergenic
905441010 1:37996625-37996647 CTTGCAGGGTGGGGTGGAGGGGG - Intergenic
906309928 1:44746551-44746573 CTTGATGGCTGACACGGAGGAGG - Intronic
906542921 1:46602033-46602055 CTTGAAAGATGAGGAGGAGGAGG + Intronic
906662004 1:47589674-47589696 CTTCCAGGGTGAAAAGGAGGTGG + Intergenic
908466829 1:64404459-64404481 CATGAAGGTTGAAGCCAAGGGGG - Intergenic
910354879 1:86342465-86342487 CTTTAAAGGTAATGCGGAGGGGG - Intergenic
913050917 1:115115922-115115944 CTTGGGTGGTGAAGCCGAGGAGG + Intergenic
913329323 1:117654139-117654161 ATTGAAGGGGGAGGGGGAGGAGG + Intergenic
914345412 1:146794550-146794572 CTGGGAGGGGGAAGGGGAGGAGG + Intergenic
915765123 1:158354804-158354826 GGTGAAGGGTGAAGCAGAGGAGG - Intronic
916079753 1:161225126-161225148 CTTGGAGGGTGAAGGGTGGGAGG - Intergenic
916820057 1:168389406-168389428 CTGGAAGAGGGAGGCGGAGGAGG + Intergenic
916881243 1:169021496-169021518 TTTGGAGGGTGAAGGGTAGGAGG - Intergenic
919880049 1:201895190-201895212 CATGCAGGGTGAAGGGTAGGGGG + Intergenic
920284745 1:204871285-204871307 CTTGAAGGGGAAAGAGGTGGTGG + Intronic
920596015 1:207270946-207270968 CATGAAGGGTGATGCTGAGTTGG + Intergenic
920765702 1:208831705-208831727 CTGGAAGGGTGTAGCAGAGAGGG + Intergenic
921046968 1:211484765-211484787 CATGTGGGATGAAGCGGAGGTGG - Intronic
921986004 1:221313030-221313052 CTTGAAGAGTGGAGTGTAGGAGG - Intergenic
922093396 1:222419580-222419602 TTTGTGGGGTGAAGCGGGGGTGG + Intergenic
923475437 1:234327075-234327097 CTTGAAGGCTCAAGAGGAGCAGG - Intergenic
924795443 1:247289201-247289223 CTTTAAGGGTAATGCGGACGGGG - Intergenic
1063246625 10:4227007-4227029 ATGGATGGGTGAAGAGGAGGTGG - Intergenic
1065214886 10:23439534-23439556 CTTGAAGGGGGTAGCGGCGGCGG - Exonic
1068529141 10:58164972-58164994 CTTGAAGGGTGAACAGGAATTGG + Intergenic
1071120033 10:82266310-82266332 TTTGAAAGGTAAAGCGGAGTTGG + Intronic
1071959090 10:90791558-90791580 ATTGAAGGGGGAAGAGGAGCGGG + Intronic
1074036314 10:109742377-109742399 GTTGCAGTGGGAAGCGGAGGCGG + Intergenic
1074151647 10:110764636-110764658 CTGGAAAGGGGCAGCGGAGGGGG - Intronic
1074645664 10:115449380-115449402 CTTGCAGTGGGAAGGGGAGGTGG - Intronic
1074772182 10:116741806-116741828 GGGGAAGGGTGAAGCGGCGGGGG - Intronic
1075666614 10:124235402-124235424 CTTGAAGGATGAATAGGAGTTGG - Intergenic
1076650104 10:131981746-131981768 CCTGCAGGGTGAGGCGGAGGAGG - Exonic
1077297308 11:1832219-1832241 CTTGGAGGGTGAGTCGGATGGGG + Intronic
1078812019 11:14777654-14777676 CTTTAAGAATGAAGGGGAGGAGG + Intronic
1079085103 11:17439713-17439735 CTGGAAGAGAGCAGCGGAGGAGG - Intronic
1082790466 11:57343246-57343268 CTTGAAGGAGGAGGAGGAGGAGG + Intronic
1083662414 11:64257783-64257805 TTTGGAGGGTGAAGCAGAAGAGG + Intronic
1084043335 11:66555263-66555285 CTAGAAGGGTGTAAGGGAGGAGG - Intronic
1086314703 11:85579228-85579250 TTCGAAGGGTGAAGGGTAGGAGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1086438739 11:86807244-86807266 CATGAAGGTAGAAGAGGAGGAGG + Intronic
1087728130 11:101746451-101746473 CTTAAAGGGTGAAAAGGAGGAGG - Intronic
1087804643 11:102542756-102542778 CTTCAAGGGTGAATGGGAGGTGG - Intergenic
1088817927 11:113434040-113434062 CCTGAAGGGTGAGAAGGAGGAGG - Intronic
1089565458 11:119368898-119368920 CTGGAGGGGTGGAGCTGAGGGGG + Intronic
1089625036 11:119745807-119745829 CTGCAAGGATGAAGGGGAGGTGG + Intergenic
1090505391 11:127306934-127306956 TTTGAAGGGGGAAGGGGAAGGGG - Intergenic
1091228887 11:133974988-133975010 CTTGCAGGGAGATGCTGAGGAGG - Intergenic
1091798609 12:3310929-3310951 CTGGAGGGGTGAGGAGGAGGGGG + Intergenic
1092335978 12:7634167-7634189 GTTGGAGGGTGAAGGGTAGGAGG + Intergenic
1092582077 12:9852729-9852751 CTTTAAGAGTGAAGGTGAGGAGG - Intergenic
1093575446 12:20722528-20722550 CTTGAAGGGACAAGAAGAGGGGG - Intronic
1096014925 12:48261956-48261978 CTTGAAGGGTGAAGGGTGGGAGG - Intergenic
1096582940 12:52600167-52600189 ACTGAAGGGTGAGGCTGAGGAGG - Intronic
1096634551 12:52949905-52949927 ATTGGAGGGTTAAGCGGATGTGG + Intronic
1096883263 12:54690125-54690147 CTTGAGGAGTGAAGCAAAGGTGG + Intergenic
1097250146 12:57627959-57627981 CTGCAGGGGTGAAGCGGAAGAGG - Intronic
1102482821 12:113235735-113235757 CTAGAAGGGTTTAGGGGAGGTGG + Intronic
1103793145 12:123485715-123485737 CCTGCAGGGTGAACCGGGGGCGG + Exonic
1103954660 12:124569236-124569258 CTTGGAGAGGGAAGCGGGGGCGG + Intergenic
1104377985 12:128281843-128281865 CCTGAAGGGGGAAGTGGAGAAGG - Intronic
1104665406 12:130643948-130643970 CTAGAGCAGTGAAGCGGAGGTGG + Intronic
1105789860 13:23787896-23787918 CCTGAAGAGTGCAGCTGAGGTGG - Intronic
1106996656 13:35492001-35492023 ATTGAAGAGTAAATCGGAGGTGG + Intronic
1107045822 13:35991098-35991120 CTTCATGGGAGAAGGGGAGGTGG - Intronic
1108091952 13:46858341-46858363 CTTGAAGGATGAAGAGTAGTGGG + Intronic
1109738774 13:66523199-66523221 AATGAAGGGTGAGGAGGAGGAGG - Intronic
1112552278 13:100432689-100432711 ATTGAAGGGTGAAGTGGAGATGG + Intronic
1112730304 13:102353268-102353290 CTTGGATGGTGAAGGGGAGATGG - Intronic
1115281651 14:31669608-31669630 CTTGACGGGAAAATCGGAGGAGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1116575372 14:46567802-46567824 ATTGAAGGGTGGAGAGTAGGAGG - Intergenic
1116985374 14:51213767-51213789 GTTGTAGGGTGGAGGGGAGGGGG - Intergenic
1117106095 14:52398389-52398411 GTTGAGGGGTGAAGGTGAGGAGG - Intergenic
1118265817 14:64294241-64294263 CTTGCAGGGCGAAGAGCAGGCGG - Exonic
1118440645 14:65808583-65808605 ATTGAAGGGTGAGGAGGATGGGG + Intergenic
1118456322 14:65948310-65948332 CTGGGAGGGTGAAGAGGAGCTGG + Intergenic
1118489922 14:66249035-66249057 CCTGGAGGGTGAGGGGGAGGTGG + Intergenic
1118583171 14:67325246-67325268 TTTGGAGGGTGAAGAGGAAGAGG - Intronic
1118942011 14:70347074-70347096 CTTTAAGGGTAATGCGGACGGGG - Intronic
1119404562 14:74389640-74389662 TCTGAATGGTGAAGAGGAGGAGG + Intergenic
1119439720 14:74620033-74620055 CATGGGGGGTGAAGAGGAGGAGG - Intergenic
1119581185 14:75782802-75782824 CTAGAAGGGTGAAAAGAAGGGGG + Intronic
1120242563 14:81966372-81966394 CTTGAAGGGTCTAGTGGAGGGGG + Intergenic
1121321918 14:92996674-92996696 CTGGCGGGGTGAAGCGGAGAAGG - Intronic
1121584884 14:95056586-95056608 CCTGATGGGTGGGGCGGAGGGGG - Intergenic
1122027004 14:98885524-98885546 CTTCAAGGGTGAAGAGGATTAGG - Intergenic
1122655004 14:103252465-103252487 GTGGGAGGGTGAAGGGGAGGTGG + Intergenic
1123036056 14:105472426-105472448 CTAGCAGGGTGGAGCGGAGCTGG - Intergenic
1126337860 15:47606223-47606245 CTCCAAGGGGGAAGGGGAGGAGG - Intronic
1128245443 15:66129334-66129356 CTTGAGGGGTGCAGAGGAGCTGG + Intronic
1128314213 15:66650118-66650140 CTTGAAAGGTGAGGAGGAGTGGG - Intronic
1128880170 15:71235666-71235688 CTTGAACTGGGAGGCGGAGGTGG - Intronic
1128942877 15:71802731-71802753 CTTGAAGTGTGAGGAGGAGTCGG + Intronic
1132374757 15:101321675-101321697 TTTGCAGGGTGAGGCGGTGGAGG - Intronic
1133702956 16:8326135-8326157 CTTGTAGGGTGGAGGGGAGAGGG + Intergenic
1134235308 16:12460490-12460512 CTTGAAGGATGAAGAGGAGCTGG - Intronic
1135526622 16:23217954-23217976 CTGGAAGGGTGAAGTGGAGAAGG - Intergenic
1135673760 16:24396658-24396680 CTTGAACAGAGAAGCTGAGGGGG + Intergenic
1135707624 16:24688402-24688424 CCAGAAGGGTGGAGAGGAGGTGG - Intergenic
1136047025 16:27623068-27623090 CTTGAAGGGTGAAGACAGGGAGG - Intronic
1136595597 16:31247370-31247392 CTTGGAGGGTCAAGGGCAGGAGG - Intergenic
1137373354 16:47929412-47929434 CTTGGAGAGTGAATTGGAGGGGG + Intergenic
1139988575 16:70920713-70920735 CTGGGAGGGGGAAGGGGAGGAGG - Exonic
1140741501 16:77945881-77945903 CTTGAACCGGGAAGCAGAGGGGG - Intronic
1140983340 16:80132877-80132899 CCTGAAGGGTGAGGTGGAGGTGG - Intergenic
1141810126 16:86370581-86370603 CTCCAAGGGTGAAGAGGATGGGG - Intergenic
1142878046 17:2864175-2864197 CTTGCAGTCTGAGGCGGAGGTGG + Intronic
1143599097 17:7932320-7932342 CTGGAAGGGTGGAGAGTAGGCGG + Exonic
1144176709 17:12714696-12714718 TATGAAGGGTGATGAGGAGGAGG + Intronic
1144292116 17:13836987-13837009 TTTGAAAGGTGAAGAGAAGGAGG + Intergenic
1144563842 17:16343881-16343903 ATTGAAGGGGAAAGCAGAGGTGG - Intronic
1145864147 17:28229206-28229228 CTGAAAGGGTGAAGCTGAAGAGG + Intergenic
1146655527 17:34632581-34632603 CTAGGAGGCTGAAGGGGAGGAGG - Intronic
1147153879 17:38533586-38533608 CTTGAATGGTGGAGGGGTGGGGG + Intronic
1147662077 17:42122167-42122189 CGTGGAGGGTGAGGCGGAGGAGG + Exonic
1148522942 17:48299447-48299469 ATTGAAGGGGGAAGAGGGGGAGG + Intronic
1148894930 17:50834083-50834105 CTTGAAGGGGAAAGTGGACGTGG + Intergenic
1149696903 17:58623226-58623248 CTTGAAGGGTTGAGTGAAGGAGG - Intronic
1150550889 17:66208848-66208870 TCTGAAGGGTCAAGTGGAGGAGG - Intergenic
1150734560 17:67725422-67725444 CATGAAGGGTGGAGGGGAGAGGG - Intronic
1151359335 17:73579165-73579187 CTTGAAGGGGCAGGCAGAGGTGG - Intronic
1151475121 17:74340834-74340856 CTGGAGGGGTGAGGCGGAGCAGG + Intronic
1151541033 17:74764625-74764647 CCTGCAGGGTGAAGGGGTGGGGG - Intronic
1152028494 17:77826928-77826950 CTTGACGTGGGAAGCGGCGGGGG - Intergenic
1156934485 18:42686720-42686742 ATTGAAGGGTGAAGGGTGGGAGG + Intergenic
1156980201 18:43277576-43277598 CTTGAAGGGAGGAGGGGAGGGGG - Exonic
1157877664 18:51288659-51288681 GTTGAAGAGTGGAGAGGAGGTGG - Intergenic
1158883077 18:61799616-61799638 CTTGAAGAGTAAAGTGGAGATGG + Intergenic
1159903677 18:74071663-74071685 GGGGAAGGGTGAGGCGGAGGAGG - Intergenic
1160965309 19:1744723-1744745 CTGGAGGGGGGAAGAGGAGGAGG - Intergenic
1160983301 19:1826539-1826561 CTAGAAGGGTGTGCCGGAGGTGG + Intronic
1161788922 19:6346886-6346908 CTTGAAGGCTGAGACCGAGGAGG + Intergenic
1162214249 19:9119403-9119425 ATTGAAGGGTGAAGGGCTGGAGG - Intergenic
1163102751 19:15107815-15107837 CCTGGAGGGTGGAGGGGAGGAGG + Intronic
1163458153 19:17420672-17420694 CTTGCAGGGAGGAGCGGGGGAGG + Intronic
1163648613 19:18504200-18504222 CTGGAGGGGTGAGGCTGAGGAGG + Intronic
1164564302 19:29314917-29314939 CTGGCAGGGTGGAGAGGAGGAGG + Intergenic
1164757805 19:30703269-30703291 CTTTAAGGGAGATGAGGAGGGGG + Intronic
1165945523 19:39439595-39439617 CTGGAAGGCTGAAGTGGATGAGG - Intronic
1166254435 19:41592290-41592312 CTTGGAGGGTGAGGAGGAGGTGG - Intronic
1166267176 19:41691447-41691469 CTTGGAGGGCGAGGAGGAGGTGG + Intronic
1167765276 19:51478573-51478595 CTTGGAGGGAGCAGAGGAGGTGG + Intergenic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
925008844 2:467313-467335 CAGGAAGGGTGAACAGGAGGAGG - Intergenic
925691487 2:6528610-6528632 CTTGAAGGGTGGAGGGTGGGAGG + Intergenic
925981686 2:9182143-9182165 GTTGAGGGGTGGAGAGGAGGAGG + Intergenic
928671610 2:33608924-33608946 CTTGAAGGGGGAATAGGGGGTGG - Intergenic
931493074 2:62771006-62771028 GTTGAAGGGTGAAGGGTGGGAGG + Intronic
931697422 2:64881871-64881893 CTTCAAGGGTGAAGCCCTGGAGG - Intergenic
934944883 2:98533175-98533197 CTTGGAGGGTGGCGGGGAGGGGG + Intronic
935847714 2:107184830-107184852 CTTCAAGGGAGAAGGGCAGGAGG + Intergenic
937102528 2:119282881-119282903 TTTGAAGAGTGAAGCGGGGGTGG - Intergenic
938537454 2:132257531-132257553 CATCAAGGGGGAAGTGGAGGAGG + Intronic
939766948 2:146262650-146262672 CCTGAATGGTGAAGGGGAAGGGG + Intergenic
943907993 2:193525181-193525203 TTTGAAGGGTGAAGGGTAGGAGG + Intergenic
944186223 2:196951967-196951989 CTTGAGGGATGAAGCAGATGTGG + Intergenic
945907772 2:215614387-215614409 CTTGAATGGAGGAGGGGAGGCGG - Intergenic
946688495 2:222294245-222294267 CGGGAAAGGTGAAGAGGAGGAGG - Exonic
948072045 2:235135604-235135626 CTTCAAGAGTGAATTGGAGGAGG - Intergenic
948251424 2:236533114-236533136 CTTTAAAGGTGAAGAGGAGATGG + Intergenic
1168949158 20:1784700-1784722 CTGGAAGGCTGAAGGGGAAGTGG + Intergenic
1170767364 20:19301745-19301767 CTAGAAGGGAGATGCTGAGGGGG - Intronic
1171177870 20:23067650-23067672 CTTGAGGGGAGCAGTGGAGGTGG + Intergenic
1171810925 20:29743719-29743741 CGTCCAGGGGGAAGCGGAGGAGG + Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173137588 20:40453049-40453071 CCTGAAGGATCAAGAGGAGGAGG - Intergenic
1173823519 20:46033033-46033055 CTTGATGGATGAGGTGGAGGTGG + Intronic
1174063947 20:47851525-47851547 CCTGAAGGGGCAAGAGGAGGAGG + Intergenic
1174669077 20:52289106-52289128 CTTGAAGGTTGAAGCTGAGAAGG - Intergenic
1175973979 20:62701249-62701271 GTGGAAGGGTGAAGCAGAGAAGG - Intergenic
1176360919 21:5995873-5995895 CTTCAGGGGTGAAGGGGAGCTGG + Intergenic
1176361546 21:6000824-6000846 ACTGAAGGGTGAAGGTGAGGTGG + Intergenic
1176547300 21:8207520-8207542 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1176555205 21:8251729-8251751 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1176566251 21:8390567-8390589 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1176574125 21:8434753-8434775 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1176952816 21:15065516-15065538 GTTGTGGGGTGAAGGGGAGGAGG - Intergenic
1177604895 21:23365158-23365180 CTTGAACTGAGAGGCGGAGGTGG + Intergenic
1178663142 21:34523248-34523270 CTTGCAGGGTGCAGCGGGGTAGG - Intronic
1179574401 21:42298740-42298762 TTTGAAGGGTGAACTGGAGTAGG + Intergenic
1179761972 21:43537726-43537748 ACTGAAGGGTGAAGGTGAGGTGG - Intronic
1179762599 21:43542677-43542699 CTTCAGGGGTGAAGGGGAGCTGG - Intronic
1180103953 21:45605171-45605193 CTTCAGGGGTGAAGGGGAGCTGG + Intergenic
1180191721 21:46168507-46168529 CTTGAAGGGTGCCTGGGAGGGGG + Exonic
1180623660 22:17179563-17179585 CTTGAAGGGTAAACAGGAGTGGG + Exonic
1182123824 22:27802274-27802296 CTTGGAGGGTAAAGCAGACGGGG + Intergenic
1184043275 22:41957089-41957111 CTTAAAGGGTGAATAGGAGCTGG + Intergenic
1184660450 22:45963254-45963276 CTTGAAAGGTGAGGGGGATGTGG - Intronic
1203252173 22_KI270733v1_random:123805-123827 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1203260227 22_KI270733v1_random:168889-168911 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
952013917 3:28934250-28934272 TTTGAAGGCTGAACTGGAGGAGG + Intergenic
952925382 3:38316148-38316170 CTTCAAGGGGGATGAGGAGGGGG - Intronic
953566086 3:44033168-44033190 CATGTAGGGTGCAGCTGAGGTGG - Intergenic
956536691 3:70284741-70284763 ATTGGAGGGTGAAGGGTAGGAGG + Intergenic
964894335 3:161577043-161577065 CTAAAAGGGTGAAACGGCGGGGG + Intergenic
966263694 3:178011910-178011932 TTTGAAGGGTGAAGGGTGGGAGG - Intergenic
967025528 3:185560989-185561011 CTTGAAGGGTGGAGGAAAGGAGG - Intergenic
967081588 3:186054695-186054717 CTTGAAGGGTGAAGCGGAGGAGG - Intronic
967122755 3:186397987-186398009 ATTGGAGGGTGAAGGGTAGGAGG - Intergenic
967184792 3:186935152-186935174 CTTGAAGGGTGGAGGGTGGGAGG - Intronic
968936302 4:3612237-3612259 CTTAAAGGGTGTAGGGCAGGAGG + Intergenic
969063579 4:4459600-4459622 CTTGAAGGGTGAGGAGGAACAGG + Intronic
969099891 4:4760860-4760882 CTTGAGGGGTGATGGGGTGGAGG - Intergenic
969480564 4:7444925-7444947 CTTGGACGATGAACCGGAGGAGG + Intronic
973029388 4:45316593-45316615 GTGGAAGGGTGAAGGGGATGGGG + Intergenic
974950495 4:68579320-68579342 CTTTAAGGGTGATGTGGATGGGG - Intronic
974958882 4:68674839-68674861 CTTTAAGGGTGATGTGGATGGGG - Intergenic
975820051 4:78261508-78261530 CTTCAAGGTAGAAGCGCAGGGGG - Intronic
976410392 4:84706672-84706694 CCTGAAGGATGAAGTGGAGCTGG + Intronic
976774843 4:88697334-88697356 CTTGGAGGGGGAGGAGGAGGAGG - Exonic
978385213 4:108171130-108171152 CTTGAAGGGCCAAGGGTAGGGGG + Intergenic
979511753 4:121562188-121562210 TTTGAAGGGTGGAGGGTAGGAGG - Intergenic
980209907 4:129773443-129773465 ATTAAAGGGTGAAGCGTATGAGG - Intergenic
981682316 4:147413780-147413802 CTTGGAGGGTGGAGGGTAGGAGG - Intergenic
982046620 4:151453758-151453780 CTTGAACTGGGAGGCGGAGGTGG + Intronic
985924452 5:3004895-3004917 CTAGAAGGGAGAAGCTGAGCTGG - Intergenic
988617888 5:32793116-32793138 CTTGAGGAGTGGAGAGGAGGAGG + Intergenic
988641745 5:33048331-33048353 CATGGATGGTGAAGGGGAGGGGG + Intergenic
989025619 5:37063971-37063993 CTTCAGGGGTGAGGCGGAGGAGG + Exonic
989156158 5:38346947-38346969 CATGTAGGGTGGAGTGGAGGTGG + Intronic
990185151 5:53203439-53203461 CTTTAAGGGTAATGCGGACGGGG - Intergenic
991964564 5:72078315-72078337 CTAGAAAGGTGAAGCTCAGGGGG - Intergenic
994660527 5:102648408-102648430 GTGGGAGGGTGAAGGGGAGGTGG + Intergenic
995912932 5:117209489-117209511 ATTGAAGGGTGGAGGGTAGGAGG - Intergenic
999129821 5:149273760-149273782 CTAGGAGTGTGAAGGGGAGGGGG - Intronic
999192244 5:149757001-149757023 CCTGAAGGATGATGCTGAGGTGG - Intronic
999315107 5:150578624-150578646 CTTGAACCGGGAAGCAGAGGTGG + Intergenic
999425150 5:151481589-151481611 TTTGGAGGGTGAAGAGGAGGAGG - Intronic
1000965591 5:167652423-167652445 CCTGAAGGCAGAAGAGGAGGAGG - Intronic
1003071490 6:2948627-2948649 CATGATGGATGAAGAGGAGGTGG - Exonic
1003490065 6:6613614-6613636 TATGAAGGGGGAAGCGCAGGCGG - Intronic
1003490251 6:6614948-6614970 CATAAAGGGCTAAGCGGAGGCGG + Intronic
1005048368 6:21663383-21663405 CTTGAATGGGGAAGCAGAGAGGG + Intergenic
1006465535 6:34191886-34191908 CTTGAACCGGGAGGCGGAGGTGG + Intergenic
1007696468 6:43737075-43737097 CTTGTAGGGTGACACGGTGGGGG + Intergenic
1011778690 6:90761859-90761881 GTTGAAGGCTGAGGAGGAGGAGG + Intergenic
1013452451 6:110297920-110297942 TTTAAAGGATGAAGAGGAGGAGG + Intronic
1015117796 6:129668586-129668608 CTTGAAGGGAGAAGTGGGAGAGG - Intronic
1015378891 6:132544300-132544322 CCTGAAGTGTGAAATGGAGGGGG + Intergenic
1016030002 6:139327222-139327244 CTTGAAGAGTGAGGGGGAGGTGG - Intergenic
1016932877 6:149427219-149427241 CGTAAAGGGTGAAGAGGTGGTGG - Intergenic
1017526811 6:155248172-155248194 CCTGACGGGTGAGGCGGCGGCGG + Exonic
1018609380 6:165632695-165632717 CATGAGGGGTGAAGCGGCCGTGG + Intronic
1018618787 6:165711127-165711149 CTTTAAGCATGAAGGGGAGGCGG + Intronic
1018653147 6:166007849-166007871 CTGCAAGGGGGAAGCGGGGGCGG + Intergenic
1019761599 7:2816897-2816919 CTTGATGGGAGCAGAGGAGGCGG - Intronic
1019941271 7:4293329-4293351 CTTGAAGGATGAATAGGAGTTGG + Intergenic
1020537230 7:9415439-9415461 GTTGAAGGGTGAAGCTGGAGAGG - Intergenic
1022003366 7:26246048-26246070 CTTTAAGGGTAATGCGGATGGGG - Intergenic
1023477359 7:40594858-40594880 CTTGAAGGGTTAAGGTGAGCAGG - Intronic
1025113691 7:56240108-56240130 CTGGAAGGCTGAAGCTGGGGAGG - Intergenic
1026098377 7:67364889-67364911 CTTGCAGGGAGAAGCGCGGGCGG - Intergenic
1026582361 7:71629075-71629097 CTAGAAGGGTCAAGAGGAGTTGG + Intronic
1031359529 7:120831638-120831660 CTGGTAGGGTGAAGAGGAGGAGG + Intronic
1031897562 7:127368996-127369018 CTTAAAGAGTAAAGGGGAGGGGG + Intronic
1033071690 7:138209065-138209087 CATGAAGGGTGAAGCACAGCAGG - Intergenic
1034086879 7:148329798-148329820 CTTGAAGGATGAATCAGAGTTGG - Intronic
1034434065 7:151054788-151054810 CCTGAGGGGTGAAGCCGAGAGGG - Intronic
1034590522 7:152134259-152134281 CCTGAAGGATGAAGAGGAGCTGG - Intergenic
1036116782 8:5967695-5967717 CTTGAAGGAGAAAGAGGAGGGGG - Intergenic
1036391479 8:8328016-8328038 CTGGGAGGATGAGGCGGAGGGGG + Exonic
1036711876 8:11085080-11085102 CTGGAAGGAGGAGGCGGAGGAGG - Intronic
1036748697 8:11429428-11429450 CTTGAAGGGAAAACAGGAGGAGG - Intronic
1037516619 8:19638194-19638216 CCTGAAGGGTGAGGTGGATGTGG - Intronic
1039504480 8:38042095-38042117 CTTGGAGGGGGAAGAGGAGATGG - Intronic
1043343370 8:79269066-79269088 ATTCAAGGGTGAAGAGGAGAGGG + Intergenic
1046825592 8:118688245-118688267 TTTCAAGGGTGAAGTGGACGTGG - Intergenic
1047893756 8:129342769-129342791 CTTCAAGAGAGAAGAGGAGGGGG - Intergenic
1048219050 8:132524792-132524814 CTGGAGGGATGAAGAGGAGGCGG - Intergenic
1048468528 8:134687043-134687065 CCTGCAGGGTGGAGGGGAGGTGG - Intronic
1051604807 9:18908678-18908700 CTTGAAGGTGGAGGTGGAGGAGG - Exonic
1051756096 9:20402479-20402501 CCTGGAGGGTGGAACGGAGGAGG + Intronic
1053861288 9:42388593-42388615 CATGAAAGGTCAAGCGGTGGGGG + Intergenic
1056427190 9:86488944-86488966 CTTGAGAGGTGAAGCGTAGTGGG + Intergenic
1056805714 9:89727069-89727091 CTTGAAGGTTGTAGGGGAGGGGG + Intergenic
1059409646 9:114124048-114124070 CTGGAAGAGTGAAGGGGAAGGGG - Intergenic
1060253044 9:122001512-122001534 CATGAAGGGGGAAGGGGGGGCGG + Intronic
1060514925 9:124259584-124259606 CTTGATGGGGGAAGGAGAGGGGG - Intronic
1060823477 9:126674365-126674387 CTTGTAGGGTGGGGTGGAGGAGG + Intronic
1203468576 Un_GL000220v1:106955-106977 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1203476397 Un_GL000220v1:150927-150949 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic
1186590125 X:10921435-10921457 CTTGAAGGAGGAGGAGGAGGAGG - Intergenic
1187009632 X:15266452-15266474 CTTGAAGAGCTAAGTGGAGGAGG - Intronic
1188309515 X:28599412-28599434 CTTGAAAGTTGAAGCTGAGTTGG - Intronic
1188732222 X:33663818-33663840 GTTGGGGGGTGAAGCAGAGGGGG + Intergenic
1190745456 X:53319776-53319798 CTTGAAGGGTGGAGAGGGGGTGG + Intronic
1191672431 X:63760692-63760714 CATGAAAGGTGAGGGGGAGGAGG + Intronic
1197485569 X:127045934-127045956 CTTGAAGGTGGAGGAGGAGGTGG + Intergenic
1199839793 X:151633223-151633245 CTTGCAGGGTGAAGTGGGTGCGG + Intronic
1200901536 Y:8437405-8437427 TTTGAAGGGTGAAGCAGGGGAGG + Intergenic
1201076887 Y:10195922-10195944 CGTCGAGGGGGAAGCGGAGGAGG - Intergenic