ID: 967081663

View in Genome Browser
Species Human (GRCh38)
Location 3:186055168-186055190
Sequence CAGGTTTACCTGCAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967081658_967081663 29 Left 967081658 3:186055116-186055138 CCACTGGTAGGAGTGCAGAAGAT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG 0: 1
1: 1
2: 0
3: 22
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967081663 Original CRISPR CAGGTTTACCTGCAGCTGGA CGG Intronic
900044555 1:495021-495043 CTTGTTTTCCTGCAACTGGATGG + Intergenic
900066357 1:733336-733358 CTTGTTTTCCTGCAACTGGATGG + Intergenic
900143170 1:1146976-1146998 CAGGTTTACATGGACCTGGGTGG + Intergenic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
902757196 1:18556837-18556859 CTTGTTTTCCTGCAACTGGATGG + Intergenic
903060817 1:20667370-20667392 CATGTTTTCCTGCAACTAGACGG - Intronic
905029014 1:34869024-34869046 CAGGCAGACCTGGAGCTGGAGGG - Exonic
905241995 1:36587373-36587395 CAGGCTTACCTGCTGGTGGGCGG + Intergenic
906740777 1:48181740-48181762 CTGGTTTTCCTGCAACTAGATGG + Intergenic
908669256 1:66527886-66527908 CAGCCTTCCTTGCAGCTGGATGG - Intergenic
909346196 1:74590430-74590452 CTTGTTTTCCTGCATCTGGACGG + Intronic
909405817 1:75288004-75288026 CAGGTTTCTCAGGAGCTGGATGG + Intronic
909925643 1:81434713-81434735 CAGTTTTAACTGCAGCTGTCTGG + Intronic
915349056 1:155213275-155213297 CAGCTTTGCCTGCAGCAGCAGGG - Exonic
915352243 1:155233902-155233924 CAGCTTTGCCTGCAGCAGCAGGG - Intergenic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
918558623 1:185836784-185836806 CAGGTCTACTTGAAGGTGGAGGG - Intronic
918581893 1:186141020-186141042 CATGTTTTCCTGCAACTAGAAGG + Intronic
919781774 1:201225845-201225867 CACGTTCTCCTGCAGGTGGATGG - Exonic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
920585525 1:207156105-207156127 CAGGCTTACTTGCAGCCTGATGG + Intergenic
922101083 1:222477276-222477298 CTTGTTTTCCTGCAACTGGATGG + Intergenic
922262183 1:223952414-223952436 CTTGTTTTCCTGCAACTGGATGG + Intergenic
922733536 1:227967396-227967418 CTTGTTTTCCTGCAACTGGATGG - Intergenic
923591745 1:235326954-235326976 CAGGTTCAGCTGCACCTGGAGGG + Exonic
924207139 1:241725163-241725185 CAGGTTTACATACTGCTGGGTGG + Intronic
924344008 1:243057393-243057415 CTTGTTTTCCTGCAACTGGATGG + Intergenic
924946528 1:248850482-248850504 CGGGTTTACCTGCCGCCAGAAGG - Exonic
1063488706 10:6443722-6443744 CAGGTTTCCCTTCACCTTGAAGG - Intronic
1064781236 10:18841137-18841159 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1065806140 10:29395057-29395079 CAGGATTACCAGCTGCTGGAAGG + Intergenic
1066732324 10:38447670-38447692 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068610627 10:59056412-59056434 CTGGTTTTCCTGCAACTAGATGG - Intergenic
1070409420 10:76125719-76125741 CAGGACTGCATGCAGCTGGAGGG + Intronic
1070891141 10:79942860-79942882 CAGGTTTGCCAGGAGCTGCAGGG - Exonic
1072566417 10:96620442-96620464 CAGCTTCACCTGCTCCTGGAGGG + Exonic
1073636937 10:105208933-105208955 CATGTTTAAATGAAGCTGGAAGG - Intronic
1073746901 10:106479434-106479456 CATGTTTTCCTGCAACTAGATGG - Intergenic
1074290629 10:112135906-112135928 CAGGTTCACCTGAAACTGGGAGG - Intergenic
1076114931 10:127888657-127888679 CAGGATTCACTGCAGCTGGCGGG - Intronic
1076970885 11:131496-131518 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1077161388 11:1114162-1114184 CAGAGCCACCTGCAGCTGGAAGG - Intergenic
1078714513 11:13827123-13827145 AAGGCTTGCCTGCAGCTGGAGGG + Intergenic
1079882444 11:25944307-25944329 CTGGTGCAGCTGCAGCTGGAGGG - Intergenic
1084116504 11:67045755-67045777 AAGGTGTACCTGCTGCAGGATGG + Exonic
1084179165 11:67438026-67438048 CAGGCTGACCTGCTGCTGCAAGG - Exonic
1085439379 11:76544485-76544507 CTGGTCTGCCTGCAGGTGGATGG - Exonic
1085542600 11:77286471-77286493 GAGGTTTCCCTGCAGTAGGAAGG - Intronic
1086938454 11:92769563-92769585 CCTCTTTACCTGCAGATGGATGG + Intronic
1087736849 11:101843726-101843748 CATGTTTAACTGCACCTTGATGG + Intronic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1089899418 11:121965343-121965365 CAGGCCAACCTGCATCTGGAAGG + Intergenic
1092554565 12:9543326-9543348 CTTGTTTTCCTGCAGCTAGATGG + Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094043644 12:26143979-26144001 CTTGTTTTCCTGCAACTGGATGG - Intronic
1094517534 12:31147309-31147331 CTTGTTTTCCTGCAGCTAGATGG - Intergenic
1096431271 12:51545258-51545280 CTTGTTTTCCTGCAGCTAGATGG + Intergenic
1096503852 12:52080956-52080978 CAGGGTTCCCCGCAGCTGGGGGG + Intergenic
1097169397 12:57104455-57104477 ACGGTTCACCTGGAGCTGGATGG + Exonic
1098937120 12:76492725-76492747 CTTGTTTTCCTGCAGCTAGATGG - Intronic
1099680494 12:85821992-85822014 CGGGTGTACCTGCACCTGGGAGG + Intronic
1103008518 12:117439912-117439934 CAGGTTTCCCCCCAGCTGGCTGG + Intronic
1104800739 12:131553981-131554003 TAGGTTCAGCTGCAGGTGGACGG - Intergenic
1104824489 12:131699025-131699047 CTTGTTTCCCTGCAGCTAGATGG - Intergenic
1106435976 13:29722972-29722994 CAGTTTCAGCTTCAGCTGGATGG + Intergenic
1106845773 13:33736361-33736383 TAGGTTTACCATCAGCTGTAGGG + Intergenic
1108354854 13:49621002-49621024 GAGGATTACCTGCACCTGGGAGG - Intergenic
1110754230 13:79152596-79152618 CAGGTTTTCCTGCAACTAGACGG - Intergenic
1112936568 13:104806936-104806958 CAGGCTGGCCTGCAGCTGGCAGG + Intergenic
1117754649 14:58961040-58961062 CAGTGTTACTTGCAGATGGAAGG - Intergenic
1118329079 14:64801791-64801813 CAACTTTACCTCCAGCTGGAAGG - Exonic
1119062117 14:71485576-71485598 CAGGTTTTCCTGCAACTAGATGG - Intronic
1119458822 14:74780846-74780868 CAGGTTAACCTGTAGCTATATGG - Intronic
1120479590 14:85033650-85033672 CTTGTTTACCTGCAACTAGATGG + Intergenic
1121601126 14:95203717-95203739 CAGGTTAACCTTGATCTGGAAGG + Exonic
1122921051 14:104880300-104880322 CACGCTCACCTGCAGCTGGCTGG - Exonic
1123020160 14:105394280-105394302 CAGGGCTGCCTGCAGGTGGAAGG - Intronic
1123696302 15:22881450-22881472 CAGCTGGACCTGCAGATGGATGG + Intronic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1126524103 15:49631007-49631029 CTGGTTTTCCTGCAACTTGATGG - Intronic
1128014848 15:64334543-64334565 CTTGTTTTCCTGCAACTGGATGG + Intronic
1128875381 15:71197312-71197334 CAGGCTTCCCTGCATCTGGCAGG - Intronic
1130398017 15:83521504-83521526 CTGCTTTACCCGCTGCTGGAAGG + Intronic
1130932401 15:88438930-88438952 CAGGGCTCCCAGCAGCTGGAAGG - Intergenic
1131393045 15:92064844-92064866 GATGGTTACCAGCAGCTGGAGGG + Intronic
1132571876 16:647791-647813 CAGGTGCAACAGCAGCTGGATGG + Exonic
1133143591 16:3766953-3766975 CATGTTACTCTGCAGCTGGAAGG - Intronic
1133595292 16:7285205-7285227 CAGATTCACATGCAGCTGTAAGG + Intronic
1133608326 16:7410021-7410043 CAGCTTTAATTGCAGCTGAAGGG - Intronic
1134732047 16:16470958-16470980 CAGGTCTCCCAGCAGCTGGGGGG - Intergenic
1134935394 16:18241005-18241027 CAGGTCTCCCAGCAGCTGGGGGG + Intergenic
1135718253 16:24791516-24791538 GAGGTTTGCCTGTAGCTGGTGGG - Exonic
1135966228 16:27037422-27037444 AAGGTTTAACTGCATCTGTAAGG - Intergenic
1136156096 16:28383263-28383285 CAGGTTGATGTGCAGGTGGAAGG + Exonic
1136172725 16:28498262-28498284 CAGGGGTTCCTCCAGCTGGAGGG - Exonic
1136206990 16:28732025-28732047 CAGGTTGATGTGCAGGTGGAAGG - Exonic
1136713787 16:32261036-32261058 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136754124 16:32668394-32668416 CAGGGATGCCTGCAGCTGCATGG + Intergenic
1136813989 16:33201971-33201993 CAGGGATGCCTGCAGCTGCATGG - Intronic
1136820465 16:33312051-33312073 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136827028 16:33368590-33368612 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136832094 16:33467361-33467383 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1138224458 16:55280876-55280898 CAGGGTGTGCTGCAGCTGGACGG + Intergenic
1139001158 16:62511827-62511849 AAGGATTACCTGAAGCTGGGTGG + Intergenic
1141935696 16:87236527-87236549 CAGGTTTACCTGGAGCTCGCCGG - Intronic
1142382179 16:89739154-89739176 CAGTTTCACCTCCAGCTGGCAGG - Exonic
1142448971 16:90162603-90162625 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1142449372 16:90166022-90166044 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1202992565 16_KI270728v1_random:24945-24967 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1203056272 16_KI270728v1_random:928726-928748 CAGGGATGCCTGCAGCTGCATGG + Intergenic
1142457724 17:65859-65881 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1142458125 17:69279-69301 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145886929 17:28388357-28388379 AAGGTGCACCTGCAGCTGCATGG + Exonic
1147045163 17:37746000-37746022 AAGCTTGACCTGCAGCTGGGTGG + Intergenic
1147528966 17:41255602-41255624 CAGGTTGTGCTGCAGCAGGAAGG - Exonic
1147720861 17:42538471-42538493 CAGCTTTACCTGCAGGTAAAAGG + Exonic
1148131428 17:45264668-45264690 CAGCTTCGCCTGGAGCTGGAGGG - Exonic
1148159401 17:45441514-45441536 CAGGTTGGCCTTCAGCTGGCAGG + Intronic
1150172831 17:63018183-63018205 TAGATTTACCTGCAGTTGTAAGG + Intronic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150455841 17:65305787-65305809 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1151030395 17:70731053-70731075 CTGGTTTGGCTGAAGCTGGATGG - Intergenic
1151560180 17:74865806-74865828 CAGGTCTGGCTCCAGCTGGAGGG + Exonic
1151829989 17:76543874-76543896 CATGTCTGCCTGCAGCTGGATGG + Intronic
1152977827 18:240851-240873 CTTGTTTACCTGCAACTAGAAGG + Intronic
1153551229 18:6263553-6263575 CAGTATTACCTGCAGTTAGAGGG - Intronic
1153693337 18:7615837-7615859 CTGGTTTTCCTGCAACTAGACGG + Intronic
1153976176 18:10270238-10270260 CAGCTTTGACTGCAGCTGGATGG + Intergenic
1155991034 18:32279556-32279578 CTTGTTTTCCTGCAACTGGATGG - Intronic
1157778108 18:50412779-50412801 CTTGTTTTCCTGCAGCTAGACGG + Intergenic
1158045065 18:53145860-53145882 CTGATGTACCTGCACCTGGAAGG + Intronic
1158681946 18:59575959-59575981 AATGTTTGCCTGGAGCTGGAGGG - Intronic
1160647837 19:201785-201807 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1160717906 19:584739-584761 GTGGTATACCTGGAGCTGGAGGG + Intergenic
1161296472 19:3522942-3522964 AAGGTTAGCCTGCAGCGGGAAGG - Intronic
1162052694 19:8044304-8044326 CAGGGGGACCTGCAGCTGAATGG - Intronic
1162141254 19:8586685-8586707 CAGGAGTCCCTGCTGCTGGAGGG - Exonic
1162907670 19:13833292-13833314 CAGGTGTTGGTGCAGCTGGATGG + Intergenic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1165738630 19:38192973-38192995 CAGCCTTACCCGGAGCTGGAGGG + Intronic
1166321594 19:42022343-42022365 CAGGTCTGCCTTCTGCTGGAGGG + Exonic
1167507677 19:49879502-49879524 CAGGTTGGCCTGCATCTGGTTGG + Intronic
1168191120 19:54739461-54739483 CTGGTTTGCCTGCAGATGGATGG + Intronic
1168201264 19:54817488-54817510 CTGGTTTGCCTGCAGAGGGATGG + Intronic
1168407405 19:56118104-56118126 CTGGTTTCTCTGCAGCTGTAAGG + Intronic
925154259 2:1637974-1637996 CAGGAGGACCTGCAGCTGCACGG + Intronic
926302190 2:11612531-11612553 CAGACTTACTTGGAGCTGGAGGG + Exonic
926823544 2:16879876-16879898 CCTGTTTACCTGCAACTAGATGG + Intergenic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
927706592 2:25299990-25300012 ATGGGGTACCTGCAGCTGGAGGG + Intronic
928239769 2:29576403-29576425 CAAGTTAGCCTGCAGTTGGAAGG - Intronic
928670146 2:33594843-33594865 TAGGTTTACCTACAGCAGGAAGG + Intronic
932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG + Intronic
932163090 2:69480831-69480853 CAGGTGTCTCTGCAGCTGCAGGG - Intronic
932838276 2:75057655-75057677 GAGGTTTACCAGGAGTTGGAGGG + Intronic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
933227821 2:79771507-79771529 CTTGTTTTCCTGCAACTGGATGG + Intronic
933649878 2:84841963-84841985 CAGGCTTTCCTGCTGCAGGAGGG + Exonic
934104774 2:88685696-88685718 CAGGATTATCTGGAGCTTGATGG - Intergenic
936080128 2:109427455-109427477 CAGGTATGCCTGTACCTGGAGGG + Intronic
937279080 2:120705063-120705085 AAGGTTCACCTGCATTTGGAGGG + Intergenic
939246480 2:139631087-139631109 CAGATTTAAGTGCAGTTGGAGGG - Intergenic
942909979 2:181231484-181231506 CAGCTCTCCCTGCAGCTGCACGG + Intergenic
944355131 2:198778580-198778602 AAGGTTTACTTGCAGATGAAAGG - Intergenic
945299275 2:208200665-208200687 CAGTTGTAGCTGCAGATGGATGG + Intergenic
946166287 2:217866096-217866118 GAGTTTTAGCTGCTGCTGGAAGG - Intronic
946183131 2:217960793-217960815 CAGATCGAACTGCAGCTGGAGGG - Intronic
946233484 2:218307378-218307400 CTTGTTTTCCAGCAGCTGGATGG + Intronic
948735297 2:239999718-239999740 CAGCTTTAGCTGCAGCTGTCAGG - Intronic
948908195 2:240989799-240989821 CACCTTTACCTGCTGCTGGTGGG - Intronic
1168909316 20:1434176-1434198 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1170463346 20:16599739-16599761 CAGGTGTATGTGCACCTGGAGGG + Intergenic
1171212573 20:23328069-23328091 CAGCATCACCTGCATCTGGAAGG + Intergenic
1171502351 20:25603605-25603627 CAAGCTAAGCTGCAGCTGGAGGG + Intergenic
1172446324 20:34995328-34995350 CAGGTTGTCCTGCTCCTGGAGGG - Exonic
1172950380 20:38719767-38719789 GAGGTTTTCCTATAGCTGGAGGG - Intergenic
1173180486 20:40803098-40803120 CAGCTTTCCTTGCAGCTAGATGG - Intergenic
1173725584 20:45295016-45295038 CTTGTTTTCCTGCAGCTAGATGG - Intronic
1174030784 20:47624317-47624339 CTTGTTTTCCTGCAGCTAGATGG + Intronic
1174142835 20:48428606-48428628 CTTGTTTTCCTGCAGCTAGACGG + Intergenic
1174274040 20:49390646-49390668 CAGCCTCCCCTGCAGCTGGATGG + Intronic
1174795324 20:53517510-53517532 CTTGTTTTCCTGCAACTGGACGG - Intergenic
1175627953 20:60504656-60504678 CAGATTCACATGCACCTGGACGG + Intergenic
1178596382 21:33957211-33957233 TAGGTTTTTCTGCAGTTGGAAGG + Intergenic
1179784264 21:43720579-43720601 AGGGTCTGCCTGCAGCTGGATGG - Intronic
1179833099 21:44010840-44010862 CTTGTTTTCCTGCAACTGGACGG - Intergenic
1179898088 21:44374537-44374559 CTTGTTTTCCTGCAGCTAGACGG + Intronic
1181001705 22:19990805-19990827 CTGCTTTGCCTGCAGCTGGCGGG - Exonic
1181881297 22:25982342-25982364 CAGGCTTGACTGCAGCTGGAGGG - Intronic
1182202190 22:28585302-28585324 CTTGTTTTCCTGCAGCTAGACGG + Intronic
1182315583 22:29444731-29444753 GAGGTTCACCTGAACCTGGAAGG + Intergenic
1182752867 22:32655702-32655724 CTTGTTTTCCTGCAGCTAGACGG - Intronic
1183160320 22:36108969-36108991 CTGGTTTTCCTGCAACTAGAGGG + Intergenic
1183456915 22:37927807-37927829 CACCTTTACCTGCAGCTGTGGGG - Exonic
1183502796 22:38191035-38191057 CTGGTTTTCCTGCAACTAGATGG + Intronic
1184325531 22:43780811-43780833 CAGGCTTACTTGCAACTGGCAGG - Intronic
1184566625 22:45295827-45295849 AGGGTTTTCCTGCAGTTGGAGGG - Exonic
1185240043 22:49737491-49737513 GAGGTTGACCAGCAGCGGGAAGG - Intergenic
951044337 3:18021602-18021624 CAGGTAGACCAGCAGCTGAAGGG + Intronic
954803104 3:53198805-53198827 CAGGCTGACTTGGAGCTGGAAGG + Intergenic
954865922 3:53729441-53729463 CAGTTTTGCCTGCAGATGGCCGG + Intronic
955245942 3:57225302-57225324 CAGGTTCACATTCAGTTGGATGG - Intronic
956959103 3:74376540-74376562 CTTGTTTTCCTGCAACTGGATGG - Intronic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
962853047 3:139322246-139322268 AAGGTTTACCAGAACCTGGAAGG - Intronic
963646588 3:147922640-147922662 CATGTTTACATGCAACTTGAAGG + Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967887365 3:194342235-194342257 CTGGTTCCCCTGCAGGTGGAGGG + Exonic
967890275 3:194359844-194359866 CTGGTTGTTCTGCAGCTGGATGG + Exonic
968370010 3:198218330-198218352 CTTGTTTTCCTGCAACTGGATGG - Intergenic
969324123 4:6431186-6431208 CGTGTTTCCCTGCACCTGGAGGG + Intronic
969579520 4:8056245-8056267 CAGGTGTACCTACAAATGGAAGG + Intronic
969670345 4:8586724-8586746 CAGGTGTACGTGCAGGTGGGTGG + Intronic
970801933 4:19982539-19982561 CAGGTTTACCAGCGGATGCAGGG + Intergenic
972956287 4:44396068-44396090 CTTGTTTTCCTGCAGCTAGATGG + Intronic
973661898 4:53116664-53116686 CAATTATACCTGAAGCTGGATGG + Intronic
976271717 4:83237337-83237359 CAGGCTTGCCTGGAGTTGGAGGG + Intergenic
976529258 4:86132832-86132854 CTTGTTTTCCTGCAGCTAGATGG - Intronic
979258708 4:118630295-118630317 CTTGTTTTCCTGCAACTGGATGG - Intergenic
979329640 4:119410261-119410283 CTTGTTTTCCTGCAACTGGATGG + Intergenic
979997586 4:127450604-127450626 CAGGTTCAACTGCAGCTGCGTGG + Intergenic
981776692 4:148376679-148376701 CAGGTTTAGCTGCCCTTGGACGG - Intronic
982023927 4:151233171-151233193 CTGGTTTTCCTGCAACTAGATGG - Intronic
982073120 4:151713169-151713191 CTGGTTTTCCTGCAACTAGATGG - Intronic
982203258 4:152978058-152978080 CAGGCTTCCCTGCAGATGGGTGG + Exonic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987190639 5:15473882-15473904 CAGGTGGACCTCCAGCTAGAAGG + Intergenic
987350718 5:17019498-17019520 CAGGATTGCTTGCATCTGGAAGG + Intergenic
988692739 5:33588802-33588824 CATGTTTGCCTGCAGGTGGTGGG - Exonic
989584187 5:43061722-43061744 CTGGGATACCTGCAGCTTGAAGG - Intergenic
990734059 5:58840975-58840997 CAGGTCTACATGCAGGTGCAAGG + Intronic
992863273 5:80933592-80933614 CAGGTTAGCCGGCAGATGGAGGG - Intergenic
995133080 5:108650613-108650635 CAGGTTTCTCTGCTGCTGTATGG - Intergenic
995463889 5:112430980-112431002 CTTGTTTTCCTGCAGCTGGATGG + Intergenic
995488910 5:112669233-112669255 CAGCTCTACTTGCAACTGGATGG + Intergenic
995874998 5:116781046-116781068 CAGGTTCACCTCCAACTGGCAGG - Intergenic
999128026 5:149260952-149260974 TCTCTTTACCTGCAGCTGGAAGG - Intergenic
999686939 5:154111570-154111592 GAGGATTACCTGAGGCTGGAAGG + Intronic
1000765765 5:165286807-165286829 CAGGTGTGCCAGCTGCTGGAGGG - Intergenic
1002081039 5:176737642-176737664 CAGCCGTACCTGAAGCTGGACGG - Intergenic
1002729289 5:181323908-181323930 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003966404 6:11256314-11256336 CAGGTGTATGTGCAGCAGGAGGG + Intronic
1004770095 6:18771625-18771647 CTTGTTTTCCTGCAACTGGAAGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007344151 6:41215791-41215813 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1008231620 6:48990311-48990333 CAGGACTACCAGCAGTTGGAAGG + Intergenic
1009416920 6:63425992-63426014 TAGATTTACCTGCAGTTGTAAGG - Intergenic
1009854984 6:69250645-69250667 AAGGTTTGCTTGGAGCTGGAAGG + Intronic
1012517420 6:100078807-100078829 CAGCTGTACCTGCAGCTGTAAGG + Intergenic
1012517785 6:100082481-100082503 CTTGTTTTCCTGCAGCTAGATGG - Intergenic
1012544765 6:100405825-100405847 CAGGGTGATGTGCAGCTGGAAGG + Intronic
1012761723 6:103310519-103310541 CTGATCTACCTGAAGCTGGAGGG - Intergenic
1014957836 6:127643020-127643042 CAGGTATGCCTTCAGCTGCAGGG - Intergenic
1015833469 6:137394357-137394379 CTGGTTTCACAGCAGCTGGATGG + Intergenic
1018975829 6:168564871-168564893 AAGGTTAACCTGGACCTGGAGGG + Intronic
1019735458 7:2647944-2647966 CAGGTTTGCCTGCAGGTGGCTGG + Exonic
1020454698 7:8358721-8358743 TATGTTTCCTTGCAGCTGGATGG + Intergenic
1020962641 7:14825406-14825428 CTTGTTTTCCTGCAACTGGATGG + Intronic
1021877616 7:25063355-25063377 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1023294071 7:38697039-38697061 CTGGTTTCTCTGCAGCTGTAAGG - Intergenic
1023400683 7:39791600-39791622 CTCGTTTTCCTGCAACTGGATGG - Intergenic
1023425862 7:40035617-40035639 CTGGTTTTCCTGCAACTAGATGG - Intronic
1024649721 7:51392853-51392875 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1025053800 7:55748184-55748206 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1025131905 7:56378658-56378680 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1029608783 7:101615508-101615530 CAGAGTTGGCTGCAGCTGGAGGG - Intronic
1029658281 7:101941964-101941986 CAGTTTCACCTCCAGCTGAAAGG - Intronic
1030479685 7:110087172-110087194 GAGGCTCACCTGCATCTGGAGGG - Intergenic
1032051011 7:128651044-128651066 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1032236404 7:130127401-130127423 CAGGCTTTCCTGCAGCCCGAAGG + Exonic
1033938108 7:146614586-146614608 CAGGTTTGCATTCAGCTGGATGG - Intronic
1034685312 7:152966037-152966059 CTTCTTTTCCTGCAGCTGGATGG + Intergenic
1035706319 8:1678257-1678279 CAAGCTGACCTGGAGCTGGAGGG + Exonic
1036190794 8:6669029-6669051 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG + Intronic
1037783143 8:21885098-21885120 GATGATTACCAGCAGCTGGAGGG + Intergenic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038265672 8:26038438-26038460 CAGTCTTAACTACAGCTGGATGG + Intronic
1038724484 8:30068407-30068429 CTTGTTTTCCTGCAACTGGATGG - Intronic
1038908251 8:31932010-31932032 CATTTACACCTGCAGCTGGATGG + Intronic
1039095508 8:33880693-33880715 CTGGTTTGCCTCCTGCTGGAAGG + Intergenic
1041646545 8:60258668-60258690 CTTGTTTTCCTGCAACTGGATGG + Intronic
1041686064 8:60645507-60645529 CAGTTTTCCCTGGACCTGGATGG - Intergenic
1042876833 8:73448151-73448173 CATGGGTACCTGCAGCTGGGAGG - Intronic
1043250324 8:78064394-78064416 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1043949859 8:86296808-86296830 CAGGTTTTCAATCAGCTGGATGG - Intronic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1048071823 8:131029240-131029262 AATGTTTTCCTGCAGCTAGATGG - Intronic
1048318320 8:133378326-133378348 CAGGTTTGCCTGCTGCAGGCCGG + Intergenic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1055062361 9:72083074-72083096 AAGATTTACCTTCAGGTGGAAGG + Intergenic
1056538622 9:87552333-87552355 GAGGGATATCTGCAGCTGGAAGG + Intronic
1056538626 9:87552355-87552377 GAGGGATATCTGCAGCTGGAAGG + Intronic
1059458695 9:114415930-114415952 GAGGGGTCCCTGCAGCTGGAGGG + Intronic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1061408954 9:130407987-130408009 CAGCACTACCTGCAGCTGGATGG + Intronic
1062037354 9:134388719-134388741 CTGGTCTTCCTGCACCTGGATGG + Intronic
1062753950 9:138277600-138277622 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1203576469 Un_KI270745v1:12379-12401 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1203576866 Un_KI270745v1:15788-15810 CTTGTTTTCCTGCAACTGGATGG - Intergenic
1185508253 X:644394-644416 CAGGCTCAGCTGCAGCTGGAAGG + Exonic
1185851262 X:3490837-3490859 CTTGTTTTCCTGCAACTGGAAGG - Intergenic
1185930881 X:4202280-4202302 CTTGTTTACCTGCAACTAGATGG + Intergenic
1186336573 X:8596056-8596078 CTTGTTTTCCTGCAACTGGATGG - Intronic
1187045867 X:15647077-15647099 CAGGCTTGCCTGCACCTGGAAGG + Intronic
1187051845 X:15703378-15703400 CAGGCTTGCCTGCACCTGGAAGG + Intronic
1189851601 X:45182872-45182894 CAGGTTGTCCTGCAGCTGAGAGG + Intronic
1191608703 X:63088588-63088610 GAGGATTACCTGGAGCTTGATGG - Intergenic
1193475688 X:81962665-81962687 CAGGTTTACCTGCCTGTGGTGGG - Intergenic
1195781040 X:108464451-108464473 CAGGTTTATCTGCAACTATAGGG + Intronic
1195922349 X:109996130-109996152 CTTGTTTTCCTGCAACTGGATGG + Intergenic
1198059129 X:133026192-133026214 CAGGTTTACCTCCAGCTTTGTGG + Exonic
1198546076 X:137694178-137694200 CAAGTTTACATGCTGCAGGAGGG + Intergenic
1199505277 X:148554439-148554461 CAAGTTTACCTGTGCCTGGAGGG + Intronic
1199547640 X:149023476-149023498 CATATTTATATGCAGCTGGAGGG + Intergenic
1201500039 Y:14631801-14631823 CAGGTTAAGTTGTAGCTGGAAGG - Intronic