ID: 967081830

View in Genome Browser
Species Human (GRCh38)
Location 3:186056905-186056927
Sequence GAAACTGTCCCATTAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967081827_967081830 -8 Left 967081827 3:186056890-186056912 CCTGTCCATGTATTAGAAACTGT 0: 1
1: 0
2: 0
3: 15
4: 149
Right 967081830 3:186056905-186056927 GAAACTGTCCCATTAATAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967081830 Original CRISPR GAAACTGTCCCATTAATAGG AGG Intronic
903844178 1:26267552-26267574 GAAACTGTCTCAAAAAAAGGGGG + Intronic
904751613 1:32743952-32743974 GAAACAGTTGCAATAATAGGAGG - Intronic
908491306 1:64646719-64646741 GAAACTGTCTCAAAAAAAGGTGG + Intronic
910453964 1:87375532-87375554 CAAACAGCCCCATTAAAAGGTGG - Intergenic
912098360 1:106173578-106173600 GAAACAATCCCATTAAAAAGTGG - Intergenic
916147391 1:161751576-161751598 TAAACTTTACTATTAATAGGGGG + Intronic
916503891 1:165410262-165410284 GCAAGTGTCCCAGAAATAGGAGG + Intronic
917060846 1:171037168-171037190 GAAAATATCCCATTTATAGTAGG + Intronic
920865127 1:209745683-209745705 GAAACTGCCACATTAATTTGAGG + Intergenic
922138650 1:222858642-222858664 GAAACAGCCCCATTAAAAAGTGG + Intergenic
923404551 1:233647121-233647143 AAAACTGACACATTAATAAGTGG - Intronic
1064987676 10:21227130-21227152 GAAAATTTCCAATTAATGGGGGG - Intergenic
1065213715 10:23429813-23429835 GAAGTTGTCACATTTATAGGTGG + Intergenic
1066108097 10:32172881-32172903 GAAACAGTCCCATTGACAAGTGG + Intergenic
1066629915 10:37449203-37449225 GGAAATGTTCTATTAATAGGTGG - Intergenic
1066808755 10:39295830-39295852 GAAACTGTTCCATCAAAAGAAGG + Intergenic
1066810343 10:39324189-39324211 CAAACTGTTCCATCAAAAGGAGG + Intergenic
1074219470 10:111422086-111422108 GAAAATGTCCCAAAAAAAGGAGG + Intergenic
1074242805 10:111655622-111655644 CAAACTGTCCCATGTATAGAAGG - Intergenic
1081524878 11:43920657-43920679 AAAACTGTCCCCTTAAAGGGAGG + Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1085711046 11:78829479-78829501 GTAAATGTCTCATTAATAGTAGG + Intronic
1086618903 11:88860984-88861006 CAAAATATCCCATTAATATGTGG + Intronic
1095075361 12:37914896-37914918 CAAACTGTCCCATCAAGAGAAGG + Intergenic
1095075528 12:37917809-37917831 CAAACTGTCCCATCAAAAGAAGG + Intergenic
1095075698 12:37920802-37920824 CAAACTGTTCCATCAATAGAAGG + Intergenic
1095075856 12:37923704-37923726 CAAACTGTCCCATCAAAAGAAGG + Intergenic
1095075887 12:37924216-37924238 CAAACTGTCCCATCAAAAGAAGG + Intergenic
1095803879 12:46296977-46296999 GAAACTTTCACATTTTTAGGTGG + Intergenic
1099948522 12:89273203-89273225 GAAACAATCCCATTAAAAAGTGG - Intergenic
1100911670 12:99371045-99371067 GAAACTGTCCCATGATTTGAGGG - Intronic
1103397170 12:120616958-120616980 GAAATTATCCCATTTATATGAGG - Intergenic
1109830234 13:67776583-67776605 GAAACTTTCCCCTAAAGAGGAGG + Intergenic
1110214342 13:73009800-73009822 AAATCTGTCTCATTAACAGGAGG + Intronic
1111230391 13:85337852-85337874 AAAACTGTGAGATTAATAGGGGG + Intergenic
1111476108 13:88750169-88750191 AAAAAAGTCCCATTAAAAGGAGG + Intergenic
1119580861 14:75779436-75779458 GAAAATTCCCTATTAATAGGTGG - Intronic
1119855006 14:77893108-77893130 GATATTGTCCCTTTAATAGTTGG + Intronic
1122182305 14:99964875-99964897 AAAACAATCCCATTTATAGGAGG - Intergenic
1123945279 15:25235926-25235948 GACACTGTCCCATGAAAAGTGGG - Intergenic
1125351150 15:38768860-38768882 GAAAAGGTCTCATTATTAGGAGG - Intergenic
1127105677 15:55611469-55611491 GAAAATTTTCCATTTATAGGAGG - Intergenic
1128129460 15:65215991-65216013 GCAACTCTCCCATTATGAGGTGG + Intergenic
1137969435 16:52969428-52969450 CAAACAATCCCATTAAAAGGTGG - Intergenic
1139491693 16:67289300-67289322 GAAACTGCCCCAGTAAAAAGGGG - Exonic
1141778980 16:86144052-86144074 GAAGTTGTCCCATTGAGAGGTGG - Intergenic
1144745102 17:17608884-17608906 GAAACTGTCCAAATTATAGGTGG + Intergenic
1145719252 17:27053418-27053440 GAAACTATTCCATAAAAAGGAGG + Intergenic
1146454801 17:33000878-33000900 GAAACAATCCCATTAAAAAGTGG - Intergenic
1150896819 17:69221339-69221361 GAAACTTAGCCATTAATAGAAGG + Intronic
1161776445 19:6264960-6264982 GAAACTGTCAAATAAATAGAAGG + Intronic
1164557931 19:29268054-29268076 GAAATAATCCCATTAAAAGGTGG - Intergenic
930232354 2:48856257-48856279 GAAACAGTGCCATTATTAGTTGG - Intergenic
931862534 2:66371166-66371188 CAAACTATCCCATTAAAAAGCGG - Intergenic
932514350 2:72329394-72329416 TAAACTGTCCCCTAACTAGGAGG - Intronic
935862168 2:107343905-107343927 GGAATTGTCAAATTAATAGGTGG + Intergenic
937657859 2:124397503-124397525 GCCACTGTCACATTATTAGGAGG - Intronic
937715947 2:125032664-125032686 AAAACAATCCCATTAAAAGGTGG - Intergenic
939650697 2:144758567-144758589 GATACAGTCCCATTAAAAAGTGG - Intergenic
940332580 2:152491193-152491215 GAAACTGTCCCAATTTAAGGAGG + Intronic
940972702 2:159910906-159910928 GATACTGTCCCATTAATTTATGG - Intergenic
942041999 2:172075995-172076017 GAAGCTGTGCAATTACTAGGTGG - Intronic
942998812 2:182298718-182298740 GAAACAGTCCCTTCTATAGGAGG + Intronic
1169443705 20:5654070-5654092 GAAACTGTGCAAATTATAGGGGG - Intergenic
1171406877 20:24917686-24917708 GACACTGTCCCACCAAGAGGTGG + Intergenic
1171469123 20:25355962-25355984 GAAACTGGGCCAATAATAGGAGG + Intronic
1172055100 20:32149463-32149485 GAAACTGTCACAAGAAAAGGAGG - Intronic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1177752998 21:25308942-25308964 GGAACTGTCCCAGTGCTAGGTGG - Intergenic
1177933136 21:27310543-27310565 CAAACAGTCCCATTAAAAGCTGG - Intergenic
1182074010 22:27482637-27482659 GAAGCTGTCCCATTCAGAGGCGG + Intergenic
949863660 3:8529383-8529405 GAAACTGTCCCACTAGCAGATGG + Intronic
952520800 3:34155273-34155295 GACACTGTCCCATCAAGAGGTGG + Intergenic
956583445 3:70839198-70839220 GAATCCGTAGCATTAATAGGAGG - Intergenic
957445002 3:80305448-80305470 GATATGGTCACATTAATAGGAGG - Intergenic
957789870 3:84926784-84926806 GAAAATGGCCAATTAATAGAAGG + Intergenic
958142104 3:89574158-89574180 GAAAATATCCCATTGGTAGGAGG + Intergenic
959564401 3:107819548-107819570 GAAACAATCCAATTAAAAGGTGG + Intergenic
960125676 3:113995956-113995978 GAAACAGTCCCATCAAAAAGTGG - Intronic
962821175 3:139048501-139048523 AAAATTGTCCCATTAAAAAGTGG - Intronic
965262085 3:166500124-166500146 GAAACTATCCCATTAAAAAGTGG - Intergenic
965861198 3:173152834-173152856 GAAACTTTCCCCTTAAAATGTGG - Intergenic
965933653 3:174079199-174079221 AAAACTTTCCCATTAAAAAGTGG + Intronic
967081830 3:186056905-186056927 GAAACTGTCCCATTAATAGGAGG + Intronic
970026953 4:11633951-11633973 GAATTTGTCCCATTAATATATGG + Intergenic
971577662 4:28297033-28297055 GAAACAATCCCATTAAAAGGTGG + Intergenic
971994456 4:33947026-33947048 CAAACAATCCCATTAAAAGGGGG + Intergenic
972231833 4:37081792-37081814 GAAACAACCCCATTAAAAGGTGG + Intergenic
972976127 4:44638528-44638550 GAAACAATCCCATTAAAAAGTGG - Intronic
976118109 4:81750011-81750033 GAAACTGTCCCATGACAAGAAGG - Intronic
976368926 4:84264727-84264749 GAAACAATCCCATTAAAAAGTGG + Intergenic
977352470 4:95905880-95905902 CATACTGTCCCCTTAATAGGAGG + Intergenic
977649117 4:99449080-99449102 CAAACAGTCCCATTAAAAAGTGG - Intergenic
980785735 4:137552047-137552069 GATACTGTATAATTAATAGGTGG + Intergenic
981640735 4:146940917-146940939 GACACTCTCCTATCAATAGGTGG - Intronic
985188189 4:187341231-187341253 AAAACAATCCCATTAAAAGGTGG + Intergenic
986621462 5:9680055-9680077 GACACACTCCCATTAATATGGGG - Intronic
989838025 5:46019784-46019806 CAAACTGTTCCATGAATAGAAGG - Intergenic
989853355 5:46244475-46244497 CAAACTGTTCCATTAAAAGAAGG + Intergenic
989857058 5:46310219-46310241 CAAACTGTACCATTAAAAGAAGG + Intergenic
990631796 5:57678668-57678690 GAAACTGACCCATTTTGAGGTGG + Intergenic
990737246 5:58877702-58877724 GAAACTGTCACAACAAAAGGGGG + Intergenic
991651538 5:68860270-68860292 GAAATTGACCCATAAATATGTGG + Intergenic
994980835 5:106874270-106874292 CAACCTCACCCATTAATAGGTGG + Intergenic
998007730 5:138668174-138668196 GAGGCTGTCCCAGAAATAGGAGG - Intronic
1000176935 5:158765751-158765773 GAAACCATCCCATTAATATCAGG - Intronic
1001128498 5:169043054-169043076 GAGACAGTCACATAAATAGGAGG - Intronic
1001502933 5:172253332-172253354 GAAACTTGCCCATTATTAGCTGG + Intronic
1004013605 6:11712100-11712122 GAAACTGTCCCCGTTACAGGAGG - Intronic
1004652515 6:17624638-17624660 GACACTGTCCCAAAAGTAGGTGG + Exonic
1007127692 6:39441278-39441300 GAAGCTCTTCCTTTAATAGGTGG + Intronic
1010480400 6:76345165-76345187 TAAACTATCCCATTTATATGTGG - Intergenic
1014414027 6:121162012-121162034 CAAACAGTCCCATTAAAAAGTGG - Intronic
1017937829 6:159022327-159022349 GAAATTGTCCCATCTAAAGGAGG + Intergenic
1019896412 7:3986907-3986929 GACGCTGTCACATAAATAGGGGG - Intronic
1020921100 7:14265439-14265461 GAAACTGTCACAGGATTAGGGGG - Intronic
1026076364 7:67173709-67173731 GAAGCTTTCCCATTAATATCAGG - Intronic
1026700490 7:72638574-72638596 GAAGCTTTCCCATTAATATCAGG + Intronic
1031254776 7:119433796-119433818 AAAACAGTCCCATTAAAAAGTGG + Intergenic
1031277524 7:119748012-119748034 GAAACTTTTTCATTAATAGTAGG - Intergenic
1032549857 7:132774511-132774533 GAAACTGACCCATGCATATGTGG - Intergenic
1037114826 8:15211686-15211708 GAACCAGTCCCATTCATAGGCGG - Intronic
1038895185 8:31774743-31774765 AAAACAATCCCATTAAAAGGGGG + Intronic
1039508230 8:38067909-38067931 GAAACTGTCCCAGGAGTTGGAGG - Intergenic
1040677982 8:49774375-49774397 CAAACTGTCCCATCAAAAAGTGG + Intergenic
1040764369 8:50889175-50889197 GAAACATTCCCATTAAAAAGTGG - Intergenic
1041320022 8:56603306-56603328 GAAACTGTTCCATACATAGAGGG + Intergenic
1042469500 8:69168195-69168217 AAAAGTGTCCCATTAGTAGGAGG - Intergenic
1043166016 8:76903365-76903387 GAAACAGTCCCATCAAAAAGTGG - Intergenic
1046157008 8:110305299-110305321 GATACAGTCCCATTAAAATGTGG + Intergenic
1046524351 8:115365134-115365156 CAAACAATCCCATTAAAAGGCGG - Intergenic
1047672294 8:127161428-127161450 CAAACTGTCCCCTTATTAGGTGG - Intergenic
1048131601 8:131703797-131703819 GAAACTGGGGCATTTATAGGTGG - Intergenic
1048388914 8:133941693-133941715 GAAACTTTCCCATTAAGATCAGG + Intergenic
1051801195 9:20936408-20936430 TAAAATGTCCATTTAATAGGTGG + Intronic
1055367473 9:75560264-75560286 CAAACAGTCCCATTAAAAAGAGG - Intergenic
1060337005 9:122734433-122734455 AAAACAGCCCCATTAATAAGTGG + Intergenic
1062366780 9:136213661-136213683 GACACTCTCCCATTAACAGGTGG + Intronic
1188336362 X:28938834-28938856 AAAACAGTCCCATTAAAAAGTGG + Intronic
1188507456 X:30897866-30897888 GTATCTGTCCCATTGATAGCAGG + Intronic
1188959675 X:36475506-36475528 CAAACTGCCCCATTAAAATGTGG + Intergenic
1189562827 X:42208593-42208615 GAAACTGTCCCTTTAAAATAAGG + Intergenic
1190506479 X:51131413-51131435 GAAACTGTGCCAAAAACAGGAGG - Intergenic
1191278419 X:58630659-58630681 AAAACTGCTCCATCAATAGGAGG - Intergenic
1191440036 X:60792282-60792304 AAAACTGCTCCATCAATAGGAGG - Intergenic
1191520708 X:61871608-61871630 AAAACTGCTCCATCAATAGGAGG - Intergenic
1191533039 X:62036373-62036395 AAAACTGCTCCATCAATAGGAGG - Intergenic
1191552390 X:62295500-62295522 AAAACTGCTCCATCAATAGGAGG - Intergenic
1191560981 X:62410182-62410204 AAAACTGCTCCATCAATAGGAGG - Intergenic
1192998945 X:76542390-76542412 GAAACTGTACCTTCAAGAGGTGG + Intergenic
1193375312 X:80753035-80753057 GAAACAATCCCATTAACAAGTGG - Intronic
1197110397 X:122766714-122766736 GAAACTGTTCCAAAAATAGAGGG + Intergenic
1197348655 X:125356516-125356538 CAAACAGTCCCATTAAAAAGTGG + Intergenic
1198341727 X:135720665-135720687 GAAACTGTCCCATGAGTACCAGG + Intronic
1198346267 X:135762697-135762719 GAAACTGTCCCATGAGTACCAGG - Intronic
1198348173 X:135779982-135780004 GAAACTGTCCCATGAGTACCAGG - Intergenic
1198350079 X:135797244-135797266 GAAACTGTCCCATGAGTACCAGG - Intronic
1198351989 X:135814517-135814539 GAAACTGTCCCATGAGTACCAGG - Intronic
1198353893 X:135831786-135831808 GAAACTGTCCCATGAGTACCAGG - Intronic
1198355805 X:135849035-135849057 GAAACTGTCCCATGAGTACCAGG - Intronic
1198357716 X:135866314-135866336 GAAACTGTCCCATGAGTACCAGG - Intergenic
1198359629 X:135883597-135883619 GAAACTGTCCCATGAGTACCAGG - Intronic
1198366485 X:135945375-135945397 GAAACTGTCCCATGAGTACCAGG - Intergenic
1199423835 X:147678129-147678151 CAAACAGTCCCATTAAAAAGTGG + Intergenic