ID: 967087147

View in Genome Browser
Species Human (GRCh38)
Location 3:186106135-186106157
Sequence CTGGGTAAATGGATTTGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967087147 Original CRISPR CTGGGTAAATGGATTTGGCA CGG (reversed) Intronic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
902674780 1:18001156-18001178 ATGTGTAAATGGACTTGGGAGGG - Intergenic
903664306 1:24997125-24997147 CTGGGTAAATTGAGTTGGTTTGG + Intergenic
906686202 1:47765042-47765064 CTGGCTAAATGGATTGAGCTGGG - Exonic
907073071 1:51554889-51554911 CTGGGAATATGCATTTAGCAAGG - Intergenic
909093953 1:71263734-71263756 CTTGGGAAATGGATTTTGGAAGG + Intergenic
909348145 1:74616435-74616457 CTGGCTAACTGGAAGTGGCATGG + Intronic
909819629 1:80045673-80045695 CAGGCTAGATGGATTTGGGATGG + Intergenic
911438617 1:97896669-97896691 ATGGGTACATGTTTTTGGCAGGG - Intronic
912060793 1:105666149-105666171 CTGGGTACATACATTTGCCAAGG + Intergenic
915282362 1:154831236-154831258 TTGGGTAAATGAATATGGAACGG + Intronic
916947737 1:169745651-169745673 CTGGCTAAAGGTAATTGGCATGG + Intronic
917606513 1:176636476-176636498 CTGGACAAATGAATTTGACATGG + Intronic
918757886 1:188359899-188359921 CTGGGCATATGTATTTGGGAAGG + Intergenic
920713775 1:208320113-208320135 CTTGGTAAAGGGATTTGGAGAGG - Intergenic
921592618 1:217022158-217022180 TTGGCTGAATGGCTTTGGCAGGG - Intronic
922031284 1:221802038-221802060 CTGGGGAAAAGGTGTTGGCATGG + Intergenic
922475621 1:225905276-225905298 CTGGAGACCTGGATTTGGCAGGG + Intronic
923901951 1:238335939-238335961 CTAGGATAATGGATTTGGAATGG + Intergenic
923941917 1:238837317-238837339 CTTGGAAAATGAAATTGGCAAGG + Intergenic
924669125 1:246105199-246105221 CTGGCTAAATTGACTTAGCAGGG + Intronic
1063292117 10:4760467-4760489 CTGTGTAAGAGGATTTGGCTGGG - Intergenic
1063303876 10:4878587-4878609 ATGGGGAAAGGGATTTGGAAAGG + Intergenic
1065158741 10:22897020-22897042 CGAGGTAAATGGAGTTTGCAGGG - Intergenic
1066493474 10:35917786-35917808 CTGGATAAATTGATTTGTCGGGG + Intergenic
1066513949 10:36134261-36134283 CTGAGGGAATGGATTTGGGAGGG - Intergenic
1068202828 10:53805637-53805659 CAGAGTAAAGGAATTTGGCAGGG - Intronic
1068464797 10:57375927-57375949 CTGGATATCTGGATTAGGCAAGG - Intergenic
1071123115 10:82303577-82303599 CTGGGTAAATGTGCTGGGCACGG + Intronic
1071940574 10:90587223-90587245 CTGGGTTAAGGGATTTTACAAGG + Intergenic
1071943339 10:90612430-90612452 CTTGGTAACAGGATTTGGAAAGG - Intergenic
1074870240 10:117570391-117570413 GTGAGTAAATGAAGTTGGCAAGG + Intergenic
1075060987 10:119256540-119256562 CTGGGTACATGGAGTGGGAAGGG + Intronic
1076369780 10:129944979-129945001 CTTGGTAAACTGATTTTGCAAGG + Intronic
1076485384 10:130812344-130812366 CTGGATAAATGGATAAGGCAGGG - Intergenic
1078005526 11:7529685-7529707 CTGGGGAAATGGATTTTGGGAGG - Intronic
1080081918 11:28230873-28230895 ATGGGGAAATAGACTTGGCATGG + Intronic
1080100254 11:28451624-28451646 ATTAGTGAATGGATTTGGCATGG + Intergenic
1081252664 11:40854436-40854458 CTGGGTAAATGAGTTTGGCTAGG + Intronic
1081621202 11:44620061-44620083 CTGGGTAAGGGGATCTGGCTTGG + Exonic
1089349898 11:117816326-117816348 CTGGGAAGATGGATTGGGCCTGG - Intronic
1090257503 11:125295686-125295708 CAGGGTCACTGGATTTGGCAAGG + Intronic
1090513220 11:127397514-127397536 TTGTGTAAAAGGATTTGGAAGGG + Intergenic
1091057493 11:132432507-132432529 CTGGCTGAATGGCTTTGGGAAGG - Intronic
1092931803 12:13322533-13322555 TTGGGAAAATGTATTTAGCAGGG + Intergenic
1094045060 12:26158436-26158458 CTGGGGAGATGGATGTGGCTAGG - Intronic
1095743558 12:45633019-45633041 CTGGGTAAGTGGATTAGATAGGG - Intergenic
1096014520 12:48257530-48257552 CTGAGAAAATGGATTCGGAATGG - Intergenic
1096016719 12:48282832-48282854 GTGGGAAAATGGATTTGTGAGGG + Intergenic
1097478515 12:60090574-60090596 TTAAGTAAATGGATTTTGCATGG + Intergenic
1101647895 12:106648118-106648140 ATGAATAAATGAATTTGGCAGGG + Intronic
1102029729 12:109733088-109733110 ATGGGGAAATGGAGCTGGCATGG + Intronic
1103618977 12:122174290-122174312 CTGAGTAAATGGTTTTGCCATGG - Intronic
1104500427 12:129280347-129280369 CAGGGTAAATGCATGTGTCATGG - Intronic
1107026076 13:35802953-35802975 CTGGGTAAGTGAGTTTGGAAAGG + Intronic
1107872261 13:44758192-44758214 TTAGGCAAATGGAGTTGGCAGGG + Intergenic
1108026061 13:46179067-46179089 TTGGGTATATAGTTTTGGCAAGG + Intronic
1111678761 13:91418380-91418402 CTGGGTATATGCATTTACCAAGG + Intronic
1114197485 14:20491570-20491592 CAGGGTATATGGGCTTGGCATGG + Intergenic
1114405527 14:22452828-22452850 TTGGGTAACTGGTTTTGGCGGGG - Intergenic
1117374060 14:55104739-55104761 CTGGGGCTGTGGATTTGGCAAGG + Intergenic
1117967920 14:61224612-61224634 CTGGGGTTATGGATTTGGTAGGG + Intronic
1118891788 14:69916128-69916150 ATGGGTAAATGGGTTTGGTAAGG - Intronic
1120672943 14:87385706-87385728 TTGGGTAGATGGTTTTGGCAGGG + Intergenic
1121454832 14:94031495-94031517 CTCGGTACATGGATTAGGGATGG + Intronic
1202906909 14_GL000194v1_random:79725-79747 CTGGTTAAATGGCTGTGACAAGG + Intergenic
1124085328 15:26544537-26544559 CAGGGGAAATGGATGTCGCATGG + Exonic
1124170557 15:27368814-27368836 CTGAGTAAATGGAGTTTGCTGGG + Intronic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125514386 15:40309553-40309575 CTGTTTGAATGGATTTTGCAAGG + Intergenic
1127184734 15:56466200-56466222 CTGTGTAAATTGATCTGGAATGG + Intergenic
1127253402 15:57266410-57266432 ATGGATAAATGAATGTGGCATGG - Intronic
1130666463 15:85873743-85873765 CTGGGTGAGTGGGTCTGGCATGG + Intergenic
1130676600 15:85958343-85958365 CTGGGTCAAAGGATTTGTGATGG + Intergenic
1131859640 15:96638852-96638874 CTGGATAATTGGCTATGGCAGGG + Intergenic
1136506057 16:30704102-30704124 CTGGGGAACTGGATGAGGCAGGG - Exonic
1140160404 16:72485206-72485228 TTGGGTAAATTGCTTTGGCCTGG - Intergenic
1141314315 16:82946248-82946270 ATGGATAAATGGATGTGGGAGGG + Intronic
1143676564 17:8436829-8436851 ATGGGTAAATGGAGCTGGGATGG + Intronic
1144108498 17:12008725-12008747 GTGGGATAAGGGATTTGGCAAGG - Intergenic
1145855319 17:28150941-28150963 CTGGGTCAATGAATTTGCTATGG - Intronic
1146889380 17:36496185-36496207 CTGATTAAATGTCTTTGGCAAGG + Exonic
1147475077 17:40703390-40703412 CGGGGTCTCTGGATTTGGCAGGG - Exonic
1151218580 17:72594123-72594145 CTGGGTAAATGGGGTTGGGGAGG + Intergenic
1156438626 18:37161136-37161158 CTGGGTTAATGGTTTTGAGAAGG - Intronic
1160005809 18:75068265-75068287 CTGGCTAAACCGATTTGGCAGGG + Intergenic
1163602406 19:18257057-18257079 CTGGGTTAATGGAAGTGGCTTGG - Intergenic
1164542492 19:29131270-29131292 TTTGGAAAATGAATTTGGCAGGG + Intergenic
1165493998 19:36141334-36141356 CTGGGTACATGAATTAGGCCGGG + Intronic
1166506153 19:43373016-43373038 CTGGGTTTATGAATTTGGCTGGG - Intergenic
925253431 2:2462012-2462034 CTTGGTAAATAGATCAGGCAGGG - Intergenic
925629408 2:5874184-5874206 ATGAATAAATGAATTTGGCAAGG + Intergenic
926246866 2:11128212-11128234 CTGGGAAATTGGATTTGGGGAGG + Intergenic
926271209 2:11367794-11367816 CTGAGGAAATGGATTTGAAATGG - Intergenic
926605308 2:14891961-14891983 ATGGGTAAGTGGTTTTGGCCAGG - Intergenic
928925690 2:36576770-36576792 ATTGAGAAATGGATTTGGCAAGG - Intronic
930219981 2:48736386-48736408 CTTGGCAATTGGATTTGGCTGGG - Intronic
932565450 2:72904208-72904230 CTGAGTAATTGGATTTTTCATGG - Intergenic
932966585 2:76482618-76482640 CTAGGAAAATATATTTGGCAAGG + Intergenic
933722376 2:85406424-85406446 CTAGGTAAATGGCCTTAGCAGGG - Intronic
936949799 2:117966393-117966415 AAGGGTAAAGGGATATGGCAGGG + Intronic
937119215 2:119430501-119430523 CTGGGGTAAAGGATTTGACAAGG + Intronic
938117032 2:128609072-128609094 CTGGGTATATGGTATTGGAAGGG + Intergenic
941017868 2:160377501-160377523 CTGTGTGAATGAATTTGGGAAGG + Intronic
944639417 2:201707850-201707872 CAGGGTAAATGGAGTTGGGTGGG - Exonic
944938385 2:204594117-204594139 CTGGGTAAAAGGAGTTGGCAAGG + Intronic
945675033 2:212845841-212845863 CGTGGTAAAGGGAATTGGCAAGG - Intergenic
945915124 2:215695745-215695767 TGAGGTAAATGGATTTAGCATGG + Intergenic
946345337 2:219105431-219105453 CTGTCAAAATGGATGTGGCAGGG - Intronic
947918374 2:233849188-233849210 CTGGGCAAAGGGATGTGGCAAGG + Intronic
948410818 2:237759195-237759217 TTGGGTAAGTGGTTTGGGCAAGG + Intronic
948838693 2:240638511-240638533 CTGGGGAATTGTATCTGGCAAGG + Intergenic
1169131312 20:3167606-3167628 CTGGGGAAATGGGGTTGGAAGGG + Intronic
1170899185 20:20444024-20444046 CTGGGTAACTTGGTTTGGAATGG - Intronic
1171940449 20:31323870-31323892 CTGGATATAGGGATTAGGCAGGG - Intergenic
1174515652 20:51090434-51090456 CTGGGAAACTGGATGTGGGAAGG + Intergenic
1174976012 20:55335282-55335304 CTGGGGAAAAGGATATGGGATGG - Intergenic
1176626258 21:9094526-9094548 CTGGTTAAATGGCTGTGACAAGG + Intergenic
1177494007 21:21865245-21865267 CTGGTTAAATGTATTTTGGATGG - Intergenic
1177631370 21:23733223-23733245 CTGAGTACATGCATTTGGTACGG + Intergenic
1179082185 21:38181576-38181598 GTATGTAAATGGATTTTGCAGGG + Intronic
1179294908 21:40053153-40053175 CTGAGTAATTGGATTTTGTAAGG - Intronic
1183425721 22:37738389-37738411 TTGGGTAAATGGATATGTGATGG + Intronic
949252232 3:1999670-1999692 CTGGATGGATGTATTTGGCAAGG - Intergenic
949757830 3:7433709-7433731 TTGTGTCAATGAATTTGGCATGG - Intronic
949915877 3:8964127-8964149 CTTGGTAACTTGATTTAGCAGGG - Intergenic
952422494 3:33144632-33144654 CTGTGTGAAGGGATCTGGCAGGG + Exonic
953669699 3:44952173-44952195 CAGGGTACATGGATATGCCATGG - Intronic
955647513 3:61155834-61155856 CTGGGAACATGGATTTGGGAAGG + Intronic
957377956 3:79383699-79383721 CTGAGTACATGAATTTTGCAAGG - Intronic
959110359 3:102115643-102115665 CAGGATAAATGGATGAGGCAGGG - Intronic
959901966 3:111671533-111671555 ATGGGTAGAGGGTTTTGGCATGG - Intergenic
962437735 3:135382278-135382300 CTGGGCAGATGGGTTTGGGATGG - Intergenic
964237512 3:154550134-154550156 CTGGGAATATGGATTTGGCAGGG + Intergenic
966231236 3:177654632-177654654 CTGGGTTTATGGATTTGGAGAGG + Intergenic
967087147 3:186106135-186106157 CTGGGTAAATGGATTTGGCACGG - Intronic
967121878 3:186389493-186389515 CTGGGTAAATTTATTTGAAATGG - Intergenic
971163423 4:24157689-24157711 CTTGGAATATGGATTTGGGAGGG - Intergenic
976098872 4:81539145-81539167 CAGGGTGAAAGGATTTGGTAGGG + Intronic
978075890 4:104528993-104529015 CTTGGTAAATGGATACAGCAAGG + Intergenic
978780389 4:112546807-112546829 CTGGGGACCTGCATTTGGCAGGG - Intronic
979204912 4:118027134-118027156 CTGGGTTAAAGGATTTGGGGTGG - Intergenic
980269324 4:130563763-130563785 CTGGGAAAATGAAACTGGCAGGG - Intergenic
980653802 4:135756093-135756115 CTTGGTAAACTGATTTAGCAAGG + Intergenic
981016959 4:139983921-139983943 TTGGGTAAATGGATTTAACCAGG + Intronic
981257554 4:142680324-142680346 ATGGGCAATAGGATTTGGCACGG - Intronic
983143260 4:164179916-164179938 CTGGCTAAATGTTTATGGCAAGG + Intronic
986026350 5:3854760-3854782 CAGGCTAATTGGATTTGGCCTGG + Intergenic
987043366 5:14084073-14084095 CTGGGCATATAAATTTGGCATGG - Intergenic
988956676 5:36327127-36327149 CAGGGTAAGTGGAATTGGCCTGG + Intergenic
990928681 5:61060945-61060967 CTGTGTGAATGGATTAGGAAAGG + Intronic
992047780 5:72913531-72913553 CTTGGCAAATAGATTTGGCCTGG - Exonic
992548456 5:77838757-77838779 CTGTGGAAAGGCATTTGGCATGG + Intronic
993167674 5:84378386-84378408 CTGGGTACATGCAGTTGGGAGGG - Intronic
993799584 5:92316299-92316321 TTGGGTAAAGGAATTAGGCAAGG - Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
993969133 5:94395737-94395759 TTTTGTAAATGGATTGGGCATGG - Intronic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
997400011 5:133595077-133595099 CTGGATTCATGGTTTTGGCAAGG + Intronic
1004300469 6:14453068-14453090 CTGCGGAAAAGGATTTGACAAGG + Intergenic
1005916739 6:30358468-30358490 CTGGGAAGACGCATTTGGCAAGG - Intergenic
1007844087 6:44739631-44739653 CTGGTCAAATGGCTTTGGCTGGG - Intergenic
1010741811 6:79515169-79515191 CTGGGTAAATAGACTTGGAAAGG - Intronic
1012985970 6:105876769-105876791 CTGGATAAAAGAATTTGGCTGGG - Intergenic
1014090728 6:117401097-117401119 GTGGCTGAATGGATTTGGCAAGG - Intronic
1014808109 6:125854546-125854568 CTGAGTAAAAGGATTTGGCAAGG - Intronic
1015425723 6:133064978-133065000 CCTGGTCCATGGATTTGGCAAGG - Intergenic
1016083222 6:139880763-139880785 CTGGGTAAATGCTTTTGTCCCGG - Intergenic
1016540361 6:145157737-145157759 TTGGGCAAATGAATTTGGAAGGG - Intergenic
1018724793 6:166603548-166603570 CCAGGTAAAGGGCTTTGGCATGG + Intronic
1019685331 7:2378910-2378932 CTGGGGAACTGGGGTTGGCACGG + Intronic
1020074373 7:5248253-5248275 CTGACTTAATGGATTTGGCGGGG - Intergenic
1023083468 7:36547059-36547081 ATGGGAAAACTGATTTGGCAAGG - Intronic
1026242026 7:68584141-68584163 CTGTGTCCAAGGATTTGGCATGG + Intergenic
1029977963 7:104851969-104851991 GTGGGTAAATGGATAAGGAAAGG - Intronic
1030607075 7:111649170-111649192 CTGGGGAAGTGTATTTGGAAAGG - Intergenic
1031934812 7:127725681-127725703 GGGGGTCAATGGCTTTGGCATGG + Intronic
1032018251 7:128393080-128393102 CTGGGGAAAGGGTTTTGGGAAGG - Intronic
1032334963 7:131016802-131016824 CGGGATATATGGATTTGGGATGG - Intergenic
1036046425 8:5146453-5146475 CTAGGAAAATGGTTTTGGGAAGG + Intergenic
1038612906 8:29070924-29070946 CTGGCTAAATGAATGTGGCCAGG + Intronic
1040768993 8:50950384-50950406 GTGAGTAAATGGATTTGTGATGG - Intergenic
1042906132 8:73773958-73773980 CTGGGGAGATGGCTTTGGCCAGG - Intronic
1043435974 8:80236760-80236782 CTGGGTAAAAGGATCAGGGAAGG + Intergenic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1045913264 8:107435563-107435585 CTGGGCACAGGGATCTGGCAAGG + Intronic
1047870564 8:129077443-129077465 CTGGGCAAAATTATTTGGCAAGG - Intergenic
1052534094 9:29726213-29726235 ATGGGTGAGTTGATTTGGCAAGG + Intergenic
1053011954 9:34638530-34638552 CTCTGGAAATGGAGTTGGCAGGG + Intronic
1059101295 9:111474416-111474438 CAGTGGAAGTGGATTTGGCAAGG - Intronic
1060183843 9:121551982-121552004 CTGGGTAGGTGGAGGTGGCAGGG + Intergenic
1060206658 9:121686396-121686418 CTGGGGAAATGGAATTTACAGGG - Intronic
1186476255 X:9859917-9859939 CGTGGTAAATGGATTTTACAGGG + Intronic
1187024391 X:15418944-15418966 CATGGTAAAGGGATTTGACATGG - Intronic
1189089149 X:38060697-38060719 GAGGGCAAATGCATTTGGCATGG - Intronic
1189279890 X:39813621-39813643 CTGAGTAGATGGATGTTGCATGG + Intergenic
1189466498 X:41281597-41281619 CTGGGAACTTGGATTTGGGAGGG - Intergenic
1192390206 X:70718416-70718438 TTGGGGAAATGCTTTTGGCAAGG - Intronic
1192410088 X:70926342-70926364 TTGGGTAAATGGAACTGGAAAGG + Intronic
1197907364 X:131440396-131440418 CTGGCTAAGTGGATTTTGCATGG - Intergenic
1199207265 X:145163715-145163737 CTGGGAGATTGGATTTAGCATGG - Intergenic
1200576938 Y:4899881-4899903 GTGGGTAAATTGATTTTTCAAGG + Intergenic