ID: 967088124

View in Genome Browser
Species Human (GRCh38)
Location 3:186112190-186112212
Sequence CTGAGCCAGCTCCTGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 8, 3: 78, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967088119_967088124 23 Left 967088119 3:186112144-186112166 CCATCTTGGCTGCAGCATTAAAA 0: 1
1: 0
2: 1
3: 17
4: 238
Right 967088124 3:186112190-186112212 CTGAGCCAGCTCCTGGGCCCAGG 0: 1
1: 1
2: 8
3: 78
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967088124 Original CRISPR CTGAGCCAGCTCCTGGGCCC AGG Intronic
900427012 1:2585514-2585536 CTGTGGCAGCTCCAGAGCCCAGG - Intergenic
900473095 1:2864073-2864095 CTGAGCCGGCACATGGGGCCAGG - Intergenic
900563758 1:3322436-3322458 CAGCTCCAGCTCCTGGGCCTCGG + Intronic
900639449 1:3681772-3681794 CGGAGCCACCTCCAGGTCCCGGG + Intronic
900703413 1:4061701-4061723 CAGAGGCAGCTCCTGGGGGCAGG - Intergenic
901084905 1:6604360-6604382 TTGGCCCTGCTCCTGGGCCCAGG - Intronic
902398684 1:16145727-16145749 CTGACTCAGCTCCTGGCCCTGGG - Intronic
902653526 1:17852305-17852327 CTGACCCGGCCCCTGGGCCCAGG - Intergenic
902821262 1:18944756-18944778 CTCAGCCAGATGCTGGGCCCTGG - Intronic
903135515 1:21307033-21307055 CTGAGCCAACTCTTGGGCTTAGG + Intronic
903216404 1:21845935-21845957 CTGAGCCGGCTCCTTGGTCCTGG + Intronic
903472002 1:23593773-23593795 CTGAGACAGCTTCAGGCCCCCGG - Intronic
903563421 1:24246139-24246161 CTGAGCCTGAGCCTGAGCCCAGG + Intergenic
903667919 1:25019114-25019136 GTGCGCCAGCTCCTGGGCCCTGG - Intergenic
903953420 1:27009706-27009728 CAGTGCCAGCTCCTGCTCCCAGG + Intronic
904285746 1:29452316-29452338 CTCAGCCAGTGCCTGGGCCACGG + Intergenic
904303351 1:29570498-29570520 CTGAGTCAGTTCCTGGGCGGGGG + Intergenic
904389649 1:30173832-30173854 CTGAGCCAGCTCAGGAGCACAGG - Intergenic
904419675 1:30383709-30383731 CTCAGCCAGTGCCTGGGCCACGG - Intergenic
904451702 1:30617080-30617102 CTGAGTCCTCTCCTGGTCCCAGG - Intergenic
904608264 1:31710663-31710685 CTGAGTAAACTCATGGGCCCTGG - Intergenic
905024106 1:34838082-34838104 CTGGCCCAGCTCCTAGGACCAGG + Intronic
905028993 1:34868927-34868949 CTGAGCCCCAGCCTGGGCCCCGG - Exonic
905241807 1:36586441-36586463 CACAGCCAGCTCCTGGAACCAGG + Intergenic
905733573 1:40311955-40311977 CTGGGCCTGCTCCTGGCCACTGG - Intronic
905792723 1:40798892-40798914 CACAGCCAGCTCCTTTGCCCAGG - Intronic
905970038 1:42134894-42134916 ATGATCCATCTCTTGGGCCCAGG - Intergenic
906694875 1:47817220-47817242 CTGCCCCAGCTCCTGGATCCAGG + Intronic
907260674 1:53216209-53216231 CTGAGGCAGCTGCCGGGTCCTGG - Intronic
908388777 1:63666780-63666802 CTGAGTCAGCTCCTGGGTGGGGG + Intergenic
908513387 1:64868319-64868341 CTGAGACAGCACCTGGCCCCGGG + Intronic
912014659 1:105017786-105017808 CTGAGTCAGTTCCTGGGGCGGGG + Intergenic
912499391 1:110112117-110112139 CTGTGCCAGCACCTGGACCTGGG - Intergenic
913074672 1:115331791-115331813 CTGAGCAAGCTCCTTGGGGCAGG + Intronic
914764087 1:150622729-150622751 CCGAGCCACCTCCTGACCCCTGG + Exonic
914807496 1:151002312-151002334 CTGAGGAAGCTCCTGGGGCATGG + Exonic
915457215 1:156048761-156048783 GTGGGGCAGTTCCTGGGCCCTGG - Intronic
915558842 1:156674999-156675021 CTGAGCAATGTCCTGTGCCCAGG - Intronic
915950614 1:160187672-160187694 CTGAGAATGCACCTGGGCCCAGG - Intergenic
916617602 1:166458745-166458767 CTGGGCCAAATTCTGGGCCCAGG + Intergenic
917557279 1:176102852-176102874 CTGAGTCAATTCCTGGGCCAGGG - Intronic
919744525 1:201000255-201000277 CTGAGGCAGCCCCTGGGGCTGGG + Intronic
919756251 1:201067897-201067919 CTGAGCCTGTTCCTGGGGCTCGG + Intronic
920295688 1:204954760-204954782 CTGACCCTGCTCCTTGCCCCGGG + Intronic
920340525 1:205272634-205272656 CTGAGCCTGCTCTCTGGCCCTGG - Exonic
920398616 1:205663419-205663441 CAGTGCCAGCTCCAGGGGCCTGG + Exonic
920504383 1:206506390-206506412 CTGAACCTGGGCCTGGGCCCTGG - Intergenic
920799619 1:209174144-209174166 CTGAGAGCTCTCCTGGGCCCTGG - Intergenic
920879157 1:209864215-209864237 CTTACCCAGCTCCTGGGATCAGG + Intergenic
922421524 1:225463746-225463768 CTGTGCCAACTCCTTGTCCCTGG - Intergenic
922744532 1:228036829-228036851 GAGATCCAGCTGCTGGGCCCTGG - Intronic
923092787 1:230752643-230752665 CTGTGCTAGCTCCTGGGGCAGGG - Intronic
923107522 1:230866108-230866130 GAGGGCCAGCTCCTGGGCACAGG - Intronic
923127433 1:231044567-231044589 CTGAGGCAGCTCCAGTGCTCTGG + Intergenic
923916829 1:238516462-238516484 CTGAGTCAGCTCCTGGGTGGAGG - Intergenic
924179221 1:241424281-241424303 CGGCCCCAGCTCCTGGTCCCAGG - Intergenic
924512128 1:244736343-244736365 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
1062856328 10:781235-781257 CTCAGCCAGCTCCGTGGCCCTGG + Intergenic
1062857802 10:788117-788139 CTGGGCCAGCCACTGGGCGCTGG + Intergenic
1063039945 10:2327472-2327494 CTGAGACACGTCCTGGGCCACGG + Intergenic
1063300951 10:4848464-4848486 CTGGCCTAGCTCCTGTGCCCTGG + Intergenic
1063365488 10:5487827-5487849 CTGCGCCGGCCTCTGGGCCCAGG - Intergenic
1063408603 10:5819175-5819197 CTGGGCCAGTTTCTGGGCCCAGG - Intronic
1063870979 10:10417461-10417483 CTGAGCCAGCCACTGGGCCCTGG - Intergenic
1063884277 10:10561891-10561913 CTGAACCTGCACCTAGGCCCTGG - Intergenic
1064216174 10:13402459-13402481 CAGAGCCAGGTCCTGAACCCAGG - Intergenic
1064637804 10:17386959-17386981 CTCCGCCAGCTTCTAGGCCCTGG + Intronic
1066521013 10:36219185-36219207 CTGTGCCAGTTTCTAGGCCCAGG - Intergenic
1067096902 10:43307482-43307504 CAGACCCAGCTGCTGGGCCACGG + Intergenic
1067285224 10:44903009-44903031 CTGGGCCAGCCCCTTGCCCCTGG + Intergenic
1067294043 10:44964353-44964375 CTGAGCTATGTCCTGGGACCTGG + Intronic
1067522987 10:47022062-47022084 CTGGGCCAGTTTCTGGGCTCAGG - Intergenic
1069960181 10:72074927-72074949 CTCTGTCTGCTCCTGGGCCCAGG - Intronic
1070657622 10:78282205-78282227 CTGAGCTTCTTCCTGGGCCCAGG - Intergenic
1070730545 10:78824866-78824888 CTTAGCATGCTACTGGGCCCTGG - Intergenic
1071054893 10:81498177-81498199 CTGAGTCAGTTCATGGGCACGGG + Intergenic
1071354864 10:84784191-84784213 CTGAGCCAGCACCTGAACTCTGG - Intergenic
1071597835 10:86940934-86940956 CAAAGCCAGCTCCCAGGCCCAGG + Intronic
1072120574 10:92402352-92402374 CTGAGCCAGTTCCTGGGTGGGGG - Intergenic
1072830250 10:98649928-98649950 CTGAGCTTGCTCCTGGGGACAGG + Intronic
1073357553 10:102869463-102869485 CGCAGCCAGCTCCTGTGCCGAGG - Intronic
1073445370 10:103577077-103577099 CTGAGCCAGCTGTTGGGCTGGGG + Intronic
1073650435 10:105352724-105352746 CTGAGCCATCACCTGTGACCAGG - Intergenic
1074555894 10:114489628-114489650 CTGAGCCTGCACCTGACCCCTGG - Intronic
1075902928 10:126057632-126057654 CTGGGCCACTTCCTGGGGCCAGG + Intronic
1076220771 10:128731595-128731617 CTCAGGCAGCGCCTGGCCCCAGG - Intergenic
1076244330 10:128934235-128934257 CTGAGGCTGCTCCCCGGCCCAGG - Intergenic
1076297683 10:129399754-129399776 CAGAGCCAGCTCCTGGCCCCGGG + Intergenic
1076328012 10:129643470-129643492 CTGAGCAAGCCTCTGTGCCCTGG - Intronic
1076420745 10:130330014-130330036 CCGTGCCGGCTCCTGAGCCCAGG - Intergenic
1076733937 10:132450514-132450536 CTGAGGAGGCTCCTGGGCCATGG + Intergenic
1076745204 10:132509525-132509547 TTGACCCAGCCCCTGGGCACTGG - Intergenic
1076791266 10:132777956-132777978 CTGAGCCAGCACCTGGGCTGGGG + Intronic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1076909663 10:133380531-133380553 CTCAGCCAGCCCCGGTGCCCTGG - Intronic
1077008490 11:369927-369949 CTGCGCCAGCGCCTGGGCTACGG + Exonic
1077235297 11:1479221-1479243 CTGAGCCAGCACTTGGCCACAGG + Intronic
1077310885 11:1888615-1888637 CAGAGCCAGATCCTGGGACTAGG - Intronic
1077384365 11:2262014-2262036 ATGAGGCATCTCCTGGGACCAGG - Intergenic
1077475755 11:2789674-2789696 CAGGCCCAGCTCCTGGGCACTGG + Intronic
1077498246 11:2897052-2897074 CAGAGCCTCCTCCGGGGCCCTGG + Intronic
1077919324 11:6631199-6631221 CTGAGCCAGGACCTGGGGACAGG + Exonic
1078571043 11:12458274-12458296 CTGAGAAAACTCCTGGGGCCAGG - Intronic
1078577417 11:12513848-12513870 CAGAGAGAGCTCCTGGGCCCAGG + Intronic
1078827370 11:14942043-14942065 CTGAGTCAGTTCCTGGGCAGAGG + Intronic
1079574673 11:21988792-21988814 CTGGGCCAGCCCCTGGTCCAAGG - Intergenic
1080451360 11:32381370-32381392 CAGAGCCTGATGCTGGGCCCCGG - Intergenic
1081691274 11:45080239-45080261 CAGCGCCAGCTCCAGGGCCCAGG + Intergenic
1081981679 11:47270428-47270450 CTGAGCCCCCTCCTCTGCCCGGG - Intronic
1082790425 11:57343049-57343071 CTGCCCTAGCTCCTGAGCCCTGG + Intronic
1082816694 11:57514266-57514288 CGGAGCCAGCTCCTTGGCACCGG - Intronic
1082867473 11:57912973-57912995 CTGAGTCAGTTCCTGGGTGCAGG + Intergenic
1082993649 11:59231590-59231612 CTGAGCCAGCTCCTGCTCTGTGG + Intergenic
1083163846 11:60871660-60871682 CTCAGCCTCCTCCTGGGACCTGG - Intronic
1083473949 11:62903653-62903675 CTGGGCCAGCTCCAAGGTCCTGG - Intergenic
1083614900 11:64021486-64021508 CTGAGCAGGTTCCTGGGCCAGGG + Intronic
1083641031 11:64145448-64145470 GTGTGCCAGGCCCTGGGCCCAGG + Intronic
1083714515 11:64567897-64567919 GGGAGGCAGCTCCTGGGGCCAGG - Intronic
1084199446 11:67545627-67545649 CAGAGGGAGCTCCTGGCCCCTGG - Intergenic
1084321865 11:68377721-68377743 TTGAGCCACCTCCTGGGCCTGGG - Intronic
1084493355 11:69489972-69489994 CTGAGTCAGCTCCTGCACCCTGG + Intergenic
1085041159 11:73327123-73327145 CCCAGCCAGCTCCAGGCCCCGGG - Intronic
1085390734 11:76180863-76180885 CAAAGCCAGCTCCTGGGGCCTGG - Intergenic
1085713762 11:78853909-78853931 CTGAGCTGGCTTCTGAGCCCAGG - Intronic
1086374964 11:86190773-86190795 CTGAGCCTGCTCCCAGACCCAGG - Intergenic
1086590525 11:88509329-88509351 CTGCGCCAGCGCCAGCGCCCAGG + Exonic
1087015064 11:93546613-93546635 CTGAGCCAGCTCCAGGACCTTGG - Intergenic
1087730730 11:101775719-101775741 CTGAGCAAGTTCCTTGGCCTTGG - Intronic
1087954873 11:104273486-104273508 CTAAGACAGCTCCTGTGCCATGG - Intergenic
1087954892 11:104273677-104273699 CAGAGGCAGCTCCAGTGCCCTGG - Intergenic
1089104157 11:115988145-115988167 GTGAGCCACCTCCTGGCCCTGGG - Intergenic
1089149957 11:116356934-116356956 CTGTGCCTGCTTCTCGGCCCCGG - Intergenic
1089273289 11:117315936-117315958 CTGGGCCAGCCCCCGGGTCCGGG + Exonic
1089461542 11:118657025-118657047 CTGTGACAGCTCCTCAGCCCTGG - Exonic
1089690088 11:120181745-120181767 CTGAGCCAGGTCCTGGGCTATGG + Intronic
1089780498 11:120870204-120870226 CTGAGTCAGCCCCAGGTCCCAGG - Intronic
1089837028 11:121379574-121379596 CAGAGCTAGCTACTGGGCTCTGG - Intergenic
1090334611 11:125954220-125954242 ACGCCCCAGCTCCTGGGCCCAGG - Intergenic
1090435566 11:126683977-126683999 CGGAGCCAAACCCTGGGCCCTGG - Intronic
1090936900 11:131351226-131351248 CAGAGCCAGCTCTTTTGCCCTGG + Intergenic
1091747122 12:2999599-2999621 CTGGGCCGGCTCCCGAGCCCGGG + Intronic
1091979362 12:4853120-4853142 TTGAGCCAGCAACTGGGCCCTGG + Intergenic
1095960064 12:47828868-47828890 CTTAGCCAGGGCCTGGGGCCGGG + Intronic
1096558824 12:52421625-52421647 CTCAGCCAGTGCCTGGGCCAGGG - Intergenic
1096649049 12:53053039-53053061 CCAAGCCAGCTCCAGGGCCCTGG - Intronic
1099095968 12:78374801-78374823 CTGAGGCAGCCCCAGTGCCCTGG - Intergenic
1100345215 12:93723439-93723461 CTGAGTCAGTTCCTGGGTGCGGG - Intronic
1101420305 12:104545275-104545297 CTGAGGCAGCTCATGGGGCTGGG - Intronic
1101496166 12:105256362-105256384 CTGCACCAGCTCCTGGGCCAGGG + Intronic
1101708686 12:107244668-107244690 CAGAGCCAGGACTTGGGCCCAGG + Intergenic
1102088339 12:110163071-110163093 CTGAGCCATCTCATGGGACAAGG + Intronic
1102219135 12:111182595-111182617 CGGAGCCAGCTTCTGGGAACTGG - Intronic
1102458918 12:113087991-113088013 CTGAGCCAGCTCCAGGATCCAGG + Intronic
1102462267 12:113107198-113107220 CTGGGCCAGCAGCTGGGCCAAGG - Exonic
1102952129 12:117038068-117038090 CTGGGCCAGTTGCAGGGCCCAGG - Intergenic
1103170701 12:118816993-118817015 CTGTGCCAGTTCCTGGGCCCAGG + Intergenic
1103415838 12:120741084-120741106 CTGGGCCTGGTCCAGGGCCCCGG + Intergenic
1103611594 12:122127435-122127457 CAGAGTCTGCTCCTGGGACCTGG + Intronic
1103728659 12:123011940-123011962 CTGGAGCAGCTCCTGGGCCATGG + Intronic
1104735030 12:131131295-131131317 GAGAGCCAGCTCCTGTGCCGGGG + Intronic
1104854795 12:131896523-131896545 CTCAGCCAGGGGCTGGGCCCTGG - Intronic
1104920506 12:132288106-132288128 CGGCGCCAGCTCCTGGAGCCTGG + Intronic
1104933325 12:132351843-132351865 CTGAGCAAGTCCCTGGGCTCTGG + Intergenic
1105011755 12:132761359-132761381 CGGAGGCTGCTCCAGGGCCCGGG + Intronic
1105701165 13:22936580-22936602 CAGAGCCAGATCCAGGGGCCAGG + Intergenic
1105853998 13:24359631-24359653 CAGAGCCAGATCCAGGGGCCAGG + Intergenic
1105886536 13:24647454-24647476 CTGAGCCTGCTGCTGTCCCCAGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1106128290 13:26919481-26919503 CTGACTCAGCTCCAGGGTCCTGG - Intergenic
1107299507 13:38950180-38950202 CTGAGCCAGTTCCTGGGTGGGGG + Intergenic
1107886944 13:44881530-44881552 CTGATACAGCTCCTGGGCATGGG - Intergenic
1107957915 13:45534369-45534391 CTGAGGCAGCCACTGGGCACTGG - Intronic
1108363833 13:49691321-49691343 CTGGGCCTGCGCCTGGGCCGCGG - Exonic
1108408429 13:50125846-50125868 CTCACCCAGCTCGTGGGCTCGGG + Intronic
1110444700 13:75565893-75565915 CTGAGCCAGGACGTGGGCCCAGG + Intronic
1111029028 13:82571772-82571794 CTGAGTCAGTTCCTGGGTACGGG + Intergenic
1112580026 13:100670385-100670407 CTGAGCCTCCTTCTGGCCCCTGG - Exonic
1113465310 13:110508392-110508414 CTGAGCCACATGCTGGGCACAGG + Intronic
1113681504 13:112248026-112248048 CTGAGCCGGCTCCTGAGCCTGGG - Intergenic
1113933738 13:113982241-113982263 CTGGGCTGGCTCATGGGCCCTGG + Intronic
1114080440 14:19198582-19198604 CTGAGCCAGTCCATGGGCTCAGG - Intergenic
1114262076 14:21044326-21044348 CAGAGCCAGGTCCAGGGCCTAGG - Intronic
1114635552 14:24184886-24184908 CACAGCCAGCTCCTTGGCCCGGG + Exonic
1114650712 14:24282887-24282909 CTGAGCCTGCACCTGGACTCTGG + Intergenic
1115070787 14:29319642-29319664 CTTAGCCTGCTACTGGGCCTTGG + Intergenic
1116532496 14:45989902-45989924 CAGAGCCAGCTCCAGAGTCCAGG - Intergenic
1117612704 14:57501178-57501200 CTGAGCCAGGTCTAGGGCCCTGG - Intergenic
1118450992 14:65902019-65902041 CTCAGACAGCTCCAAGGCCCCGG - Intergenic
1118792513 14:69107996-69108018 GTGAAGCAGCTCCTGGGCACTGG + Intronic
1119115182 14:72013625-72013647 CAGATCCAGCTCTTGGGCCGTGG + Intronic
1119617466 14:76108141-76108163 CTGAGCCAGCTGCAGGGGCAGGG + Intergenic
1121262798 14:92578712-92578734 CTGAGTCAGTTCCTGGGCGAGGG + Intronic
1121464006 14:94102522-94102544 CTGGGACAGCTCTTGGGGCCTGG + Exonic
1121884120 14:97527289-97527311 CTGAGCCTGCTCCCAGGGCCTGG + Intergenic
1122270507 14:100566824-100566846 CAGGGCCATCTCCTGGGCCATGG - Intronic
1122323449 14:100868851-100868873 CAGGCCCAGCTCTTGGGCCCTGG + Intergenic
1122641151 14:103160441-103160463 CTGCGCCAGCATCTGGGCCCTGG - Intergenic
1122647730 14:103206352-103206374 CCCCGCCAGCTCCTGGTCCCAGG - Intergenic
1122705348 14:103617351-103617373 TCCAGCCAGCTCCTGGGCACAGG + Intronic
1122857144 14:104565420-104565442 CCGAGCCAGCTCTGGGCCCCAGG + Intronic
1122891063 14:104732489-104732511 CTGAGCTGGCTCCTGCTCCCAGG + Intronic
1123033139 14:105460532-105460554 CTGGGGCAGGTGCTGGGCCCTGG - Intronic
1123449578 15:20351465-20351487 CTGAGCCAGCTCTTAGTCCATGG - Intergenic
1124346130 15:28922696-28922718 CTGAGCCAGCTCCTGGGAACAGG - Intronic
1124626288 15:31309272-31309294 CTGAGCCACTTCCCTGGCCCTGG + Intergenic
1127266112 15:57363409-57363431 ATGAAGGAGCTCCTGGGCCCAGG - Intergenic
1127295873 15:57608058-57608080 CTGAGCCAGCTCCAATCCCCTGG - Intronic
1128229897 15:66027122-66027144 CCCAGCAAGCTCCAGGGCCCTGG + Intronic
1129028918 15:72604745-72604767 CTCACCCACCTCCTGAGCCCTGG + Intergenic
1129191989 15:73942679-73942701 CTGACCCCACACCTGGGCCCAGG + Intronic
1129274075 15:74433957-74433979 CTGAGCCAGCGCCCGGCCGCAGG + Exonic
1129710898 15:77819807-77819829 CCGAGTCGGCACCTGGGCCCAGG - Intronic
1129982097 15:79882559-79882581 CTGAGGTAGCTGCTGGGCCCTGG - Intronic
1131063869 15:89421037-89421059 CTGAACTAGCTCATGTGCCCTGG - Intergenic
1132467590 16:84628-84650 TTGAGTGAGCCCCTGGGCCCAGG + Intronic
1132541187 16:510580-510602 CTGAGGCAGCTTCTGGGCATGGG + Intronic
1132833808 16:1942691-1942713 CAGGGCCAGCTCCTGTGGCCGGG - Intronic
1132834191 16:1944375-1944397 CTGAGTCAGCTCCTGGGTGGTGG - Exonic
1133103856 16:3494603-3494625 CTGTGGCAGGTCCAGGGCCCAGG + Exonic
1133103891 16:3494727-3494749 CTGCGCCACCTCCGGGGCCTGGG - Exonic
1133203345 16:4218061-4218083 CAGAACGAGCTCCTGGCCCCTGG - Intronic
1133236742 16:4390924-4390946 CTGGGCCAGCTCTTGCTCCCTGG + Intronic
1133339781 16:5028703-5028725 CTGACCCTGCTCCTAGGCCTGGG + Intronic
1134490324 16:14691352-14691374 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134495705 16:14730469-14730491 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134501252 16:14770780-14770802 CTGTGGCAGCTCCCAGGCCCTGG + Intronic
1134579328 16:15358254-15358276 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1134723254 16:16399300-16399322 CTGTGGCAGCTCCCAGGCCCTGG + Intergenic
1134944174 16:18312570-18312592 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1135002634 16:18789986-18790008 CTGAGGCAGCGCCTTGGCCCCGG - Intronic
1135545970 16:23366986-23367008 CTGAGCCTTCTGGTGGGCCCAGG + Intronic
1136116763 16:28099458-28099480 CTGAGCTGGCTGCTGGGGCCAGG - Intronic
1136165598 16:28450912-28450934 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136197374 16:28664097-28664119 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136213713 16:28778244-28778266 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136258447 16:29058168-29058190 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136320048 16:29478148-29478170 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136434619 16:30217489-30217511 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1137236307 16:46621220-46621242 CAGAGGCGGCTCCTCGGCCCCGG + Intronic
1137469810 16:48744114-48744136 CAGAGTCAGGTCCTGAGCCCAGG + Intergenic
1138332661 16:56227423-56227445 CTGAGCCAGTCACTGGGGCCTGG + Intronic
1138420085 16:56893158-56893180 CTGAGCTCACTGCTGGGCCCAGG - Intronic
1138448243 16:57077969-57077991 CTGAGCCAGCCCCAGGGCTGTGG - Exonic
1138539965 16:57682195-57682217 CTCAGCCATGGCCTGGGCCCAGG - Intronic
1139140912 16:64261209-64261231 CTGGGCCTGCGCCTGGGCCGCGG - Intergenic
1139446251 16:67000465-67000487 CTCCGCCAGCCCCGGGGCCCAGG - Intronic
1140469859 16:75207887-75207909 CTTAGCCATCCCCTGGGACCCGG - Intergenic
1141850157 16:86639738-86639760 CTGTGCCAGGTCCTCGTCCCAGG - Intergenic
1142022965 16:87795524-87795546 CTGGCCCAGCTGCCGGGCCCTGG + Intergenic
1142034489 16:87855014-87855036 CAGAGCCAGCGCCAGGGCCTTGG + Intronic
1142171977 16:88627733-88627755 CTCAGCCAGCTCTCGGTCCCCGG + Exonic
1142244512 16:88963516-88963538 CAGTGACAGCTCCTGGGGCCGGG - Intronic
1142498983 17:321799-321821 ATCCGCCAGCTCCTGGGCCTTGG + Intronic
1142503729 17:349432-349454 CTGGGCACGCTCCTGGCCCCTGG - Intronic
1142552128 17:747342-747364 CAGAGTCGGATCCTGGGCCCGGG - Exonic
1142715957 17:1747102-1747124 CTCTGCCAGGACCTGGGCCCCGG + Exonic
1142717666 17:1755771-1755793 CTGCCCCAGCTCCTGGGCTCTGG - Intergenic
1143466886 17:7143121-7143143 CTGAGCCAGATTTTGGACCCAGG - Intergenic
1143795649 17:9334119-9334141 CTGAGTCAGTTCCTGGGTGCGGG + Intronic
1144564494 17:16348802-16348824 TTGCCCCAGCTCCTCGGCCCTGG - Intronic
1145888127 17:28396706-28396728 CTGAGCAAGGGCCTGGGCCCAGG + Exonic
1146061151 17:29608007-29608029 CTGCACCAGCTCCAGGTCCCGGG - Exonic
1146941601 17:36847440-36847462 CTGAGCCAATTCCGGGGCTCAGG - Intergenic
1147767154 17:42844837-42844859 CTGACCCAGCGGCTGGGGCCAGG + Exonic
1147768348 17:42851566-42851588 CTGACCCAGCGGCTGGGGCCAGG + Exonic
1147770939 17:42867498-42867520 CTGACCCAGCAGCTGGGGCCAGG + Intergenic
1147870349 17:43582693-43582715 CTGACCCAGCTCCTGGTTCAGGG - Intergenic
1148201366 17:45752114-45752136 CTGGGCCAGCACCTGGGCTCTGG + Intergenic
1148208618 17:45794846-45794868 CAGAGCCGGGTCCTGGGCCCTGG - Intronic
1148221821 17:45868355-45868377 CTGAGTCAGTTCCTGGGCGGGGG - Intergenic
1148820787 17:50358417-50358439 CTGAGCCGGCCCCTGCGGCCAGG + Exonic
1150279102 17:63918603-63918625 CTCAGAAAGCTCCTGGTCCCTGG - Intronic
1151570853 17:74924631-74924653 CTGGGCCAGCTCCTCGGACATGG - Exonic
1151724460 17:75876276-75876298 CTGAGTCAGCTTCAGGGACCTGG + Exonic
1151768649 17:76145537-76145559 CAGAGCCTGCTCCTGCCCCCTGG + Intronic
1151791176 17:76307087-76307109 CTGAGCCAGCTCTGGGTCCTTGG + Intronic
1151918687 17:77138095-77138117 CTGAGTCAGTTCCTGGGCGGGGG + Intronic
1152031543 17:77846307-77846329 CTGAGCCCCCTCCTGACCCCAGG - Intergenic
1152184114 17:78843436-78843458 CAGAGGCAGCTGCTGGGCACAGG + Intergenic
1152268160 17:79308243-79308265 CAGGCCCAGCTCCTGGGCGCTGG + Intronic
1152302474 17:79503322-79503344 CTGTGCCAGCTCCGGGGCAGAGG - Intronic
1152303623 17:79509107-79509129 ATGACCCAGCCCCAGGGCCCCGG + Intronic
1152339054 17:79714425-79714447 CTGAGCCAGCTCTTAGTCCACGG + Intergenic
1152367650 17:79865915-79865937 CGGAGCCAGCAGCTGGCCCCTGG - Intergenic
1152554572 17:81046504-81046526 GTGAGCCAGCTCCCAGGCTCTGG + Intronic
1152636773 17:81433422-81433444 CTGAGGCCCCTCCTGTGCCCAGG + Intronic
1153376502 18:4386582-4386604 CTGAGCCAGCTCTTTGACCTTGG - Intronic
1153466558 18:5394782-5394804 CTGAGCCAGCGCCTATCCCCGGG + Exonic
1153617726 18:6950118-6950140 CTGAGCCAGTTCCTGGGTAGGGG - Intronic
1153634867 18:7104873-7104895 CAGAGCCAGAACCTGGGCCTGGG - Intronic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1155356557 18:24959214-24959236 CTGAGACAGCTCGAGGGCTCAGG - Intergenic
1158720186 18:59917663-59917685 GTGAGCCAGTTCCTGAGCACAGG + Intergenic
1158727424 18:59986320-59986342 CTGCTCCAGCTTCTGTGCCCAGG + Intergenic
1158939057 18:62390113-62390135 CTGAGATGGCTCCTGAGCCCAGG - Exonic
1159955763 18:74517312-74517334 CCAAGGCTGCTCCTGGGCCCCGG - Intronic
1160523598 18:79522746-79522768 CCCAGCCAGCTCCTGGCCCCAGG - Intronic
1160846942 19:1170257-1170279 CTGAGCCCTCTCCTGAGTCCTGG + Intronic
1161066422 19:2240617-2240639 CTGAGCCAGCCACTGGCCGCTGG + Intronic
1161168452 19:2801171-2801193 CCGTGCCAGCTCGTGGGTCCTGG + Intronic
1161267245 19:3370022-3370044 CTTAAGCATCTCCTGGGCCCTGG + Intronic
1161297317 19:3526529-3526551 CTTAGCCAGGTCAGGGGCCCTGG + Intronic
1161317688 19:3625816-3625838 CTGAGCCAGCACTGGGGCCCCGG + Intronic
1161465687 19:4429015-4429037 CTGAGCCAGCACCGAAGCCCAGG - Intronic
1161594210 19:5142916-5142938 CCGAGCCAGCACCGGGGCCCTGG - Intronic
1161684426 19:5695956-5695978 CTCTGGGAGCTCCTGGGCCCGGG - Intronic
1161865292 19:6828611-6828633 CTGAGCCAGGTCCTGGGGAGGGG - Exonic
1161975914 19:7607711-7607733 CTGACCCTGGTCCTGAGCCCCGG - Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1162806549 19:13140428-13140450 GGGGGCCAGCTCCTGGGCCTGGG + Exonic
1163266460 19:16225302-16225324 TGGAGCCAGCATCTGGGCCCAGG + Intronic
1163479124 19:17544316-17544338 CTGACCCAGCTCCAGGGCTCAGG - Intronic
1163559526 19:18010492-18010514 ACAAGCCAGCTCCTGGCCCCTGG + Intronic
1163809203 19:19419925-19419947 GTCAGCCACCTCCTAGGCCCAGG - Intronic
1164085922 19:21902394-21902416 ATTAGCTAGGTCCTGGGCCCAGG - Intergenic
1165020710 19:32921797-32921819 CTCAGGCAGCTCCTGGGTCTTGG - Intronic
1165122427 19:33568923-33568945 CTGAGTCAGCTCCTGGGTGGGGG - Intergenic
1165411516 19:35665338-35665360 CTGAGCCAGCGCGTGTCCCCAGG - Intergenic
1165468010 19:35986496-35986518 CTGAACCATATACTGGGCCCTGG + Intergenic
1166296533 19:41892735-41892757 CTGGGCCAGCTCCTGCTCCCAGG - Exonic
1166296547 19:41892781-41892803 CCGAGCCAGCTACGAGGCCCGGG + Exonic
1166979126 19:46622329-46622351 CAGAGCCAGGTCCTGGTCCTGGG - Intronic
1167206697 19:48107250-48107272 CTGAGTCAGTTCCTGGGAGCGGG + Intronic
1167681122 19:50922031-50922053 CTCAGCCACCTCCTGGGGCCAGG - Intergenic
1167712804 19:51122858-51122880 CTGAGGCAGCTCCAGGCCCCCGG - Intergenic
1167756210 19:51415269-51415291 CCGAGGCAGCTCCAGGACCCCGG + Exonic
1167758210 19:51426525-51426547 CTGGGGCAGCTCCAGGACCCGGG + Intergenic
1167772444 19:51529812-51529834 TTGAGGCAGCTCCAGGACCCCGG + Exonic
1167792073 19:51689237-51689259 CTGGGCCAGCTCCGGGGCAGGGG + Intergenic
1168254778 19:55159383-55159405 CTGAGCTAGCTCCCTGACCCGGG + Exonic
925492920 2:4415233-4415255 CTCAGGCAGCTCTTGGGGCCAGG - Intergenic
925882534 2:8365078-8365100 CTGAGCCCGCTCTTGGCCTCAGG + Intergenic
927217423 2:20675903-20675925 CTCAGCCAGCTCCTGGCTCTGGG - Intergenic
927669420 2:25056691-25056713 ATTTGCCAGCTGCTGGGCCCAGG - Intronic
927674876 2:25097993-25098015 CTGGGTCAGCTCCAGGGCCAGGG - Intronic
928376749 2:30781154-30781176 CTGAAGCTGCTCCTTGGCCCTGG - Intronic
929023778 2:37579286-37579308 CTGACCCAGCTCCCTGGCACAGG - Intergenic
929533739 2:42767790-42767812 ATCAGCCCGCTCCTCGGCCCTGG - Intronic
929534449 2:42771754-42771776 CAAGCCCAGCTCCTGGGCCCAGG + Intronic
930100159 2:47597030-47597052 CTGAGCCAGTCCCTGAGGCCAGG - Intergenic
930198409 2:48530447-48530469 CTGAGACTGCTGCTGGGACCGGG + Intronic
931744263 2:65278284-65278306 CTGAGCCAAATCCGGGGCCTTGG - Intergenic
932403912 2:71500848-71500870 CTGAGTCAGCCCCAGGACCCGGG - Intronic
932491688 2:72126920-72126942 CTGGGCCAGCTCCCGGCCCATGG + Intergenic
933186897 2:79288727-79288749 CTGAGCCAACTTCTGGGCCCAGG - Intronic
933536576 2:83583090-83583112 CTGAGGCAGCTCCTGGGTGGGGG + Intergenic
933764411 2:85697153-85697175 CCCAGCCAGGTCCTGGACCCAGG + Intronic
935573724 2:104688169-104688191 ATGAGCCAGGCCCTGGGCCTGGG - Intergenic
935595319 2:104873349-104873371 TTGAGCGAGCGCCTAGGCCCTGG - Intergenic
936153567 2:110034656-110034678 CTGCAGCAGCCCCTGGGCCCAGG + Intergenic
936191114 2:110336759-110336781 CTGCAGCAGCCCCTGGGCCCAGG - Intergenic
936271191 2:111050507-111050529 TTGAAGCAGCTCTTGGGCCCTGG + Intronic
936279295 2:111123335-111123357 CTGCGCCCGCTCCTGTGCTCCGG + Intronic
936985626 2:118309429-118309451 CTGAGGCATCTCCTGGGGTCAGG + Intergenic
937207634 2:120246641-120246663 CGGATCCAGGTCCTTGGCCCAGG - Intronic
937887434 2:126909468-126909490 CTGAGCCCACTTCTGGTCCCTGG - Intergenic
937904215 2:127044993-127045015 CTGAGCCAGTTGCTGTGGCCTGG - Intergenic
937990760 2:127660962-127660984 CTGGGGCAGCCCCTGGGCACAGG - Intronic
942300893 2:174561369-174561391 CTGAGCAAGCTCCTGAGGCTGGG - Exonic
943755655 2:191554507-191554529 CTGAGCCAGCTCCAGGGCCCTGG - Intergenic
944510804 2:200463838-200463860 CTTCTCCAGCTCCTGGCCCCTGG + Intronic
945062881 2:205924200-205924222 GAGAGCGAGCTCCTGGGCCTGGG + Intergenic
946009803 2:216555388-216555410 CTGTGCCAACTTCTGGGCCCAGG + Intronic
946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG + Intronic
946203004 2:218082065-218082087 CTGAGCCAGAGGCTGGGCCCTGG + Intronic
946254150 2:218430908-218430930 CTGGCCCAGCTCCTGGATCCTGG - Intronic
947915328 2:233828783-233828805 CTGTGCCTGGCCCTGGGCCCAGG + Intronic
948326494 2:237126096-237126118 CTGAGACAGCGGCTGGGCCAGGG + Intergenic
948902891 2:240965138-240965160 CTGAGCCTCCTCCTTGTCCCAGG + Intronic
948946866 2:241224863-241224885 CTCTCCCAGCTCCTGGCCCCTGG + Exonic
1169076156 20:2760789-2760811 CTGGCCCTGCTCCTGGGCTCTGG + Intergenic
1170597757 20:17818356-17818378 CTGAGCCAGGGCCGGAGCCCAGG - Intergenic
1170835242 20:19878302-19878324 CAGAGTCAGCCCATGGGCCCAGG - Intergenic
1171169329 20:23001381-23001403 CTGTGCCTGCTCCTGGGCTGAGG - Intergenic
1171421484 20:25020668-25020690 CTGAGACAGCACCTGGGCCATGG + Intronic
1171424873 20:25043040-25043062 CTCCACCAGGTCCTGGGCCCTGG + Intronic
1171942639 20:31346802-31346824 CTGATTCAGTTCCTGGGCCCGGG - Intergenic
1171988092 20:31674942-31674964 CTGAGCCAGGGCCATGGCCCTGG + Intronic
1172222330 20:33282439-33282461 GTGAGCCAAGACCTGGGCCCAGG + Intronic
1172600457 20:36179427-36179449 CTGAGCCAGGTCTTGAGGCCTGG + Intronic
1172702763 20:36863170-36863192 CTGAGCCCGGGCCTGGGCCGCGG + Exonic
1172950036 20:38717295-38717317 CTGAGGCAACTCCTGGGACAGGG - Intergenic
1173252180 20:41369904-41369926 CTGAGCCAGCTCCTCATCCTAGG + Intergenic
1173514771 20:43657567-43657589 CTGAGCCCGCGCCTGGGATCAGG - Intergenic
1173584958 20:44175591-44175613 CTGACCCTGCTCCTGGGAGCTGG - Intronic
1173742703 20:45412664-45412686 CTGAGCCATCTCTTGGGCTGCGG + Intergenic
1174380659 20:50153530-50153552 CGCAGCCAGCTCGCGGGCCCCGG + Exonic
1175227368 20:57452450-57452472 ATGAGCCAGGCCCTGGGCGCAGG + Intergenic
1175545705 20:59776441-59776463 CTGAGCCAGGCCCTGTGCCAAGG - Intronic
1175553011 20:59829073-59829095 TGGAGCCAGCCCCTGAGCCCAGG + Intronic
1175889737 20:62310829-62310851 CTGACCCATCTCCTGCCCCCAGG - Exonic
1175929079 20:62485130-62485152 AAGAGCCAGCTCAGGGGCCCAGG + Intergenic
1175939401 20:62531152-62531174 CTGAGCCGGGCCCTGGGGCCGGG + Intergenic
1175944360 20:62551755-62551777 CCGAGCTGGCTCCTGTGCCCGGG - Intronic
1176118035 20:63441692-63441714 CTGAGCGTGCCCCGGGGCCCAGG - Intronic
1176120093 20:63450410-63450432 CTGGGGCAGCCCCAGGGCCCTGG - Intronic
1176299993 21:5094969-5094991 TGGAGCCAGGCCCTGGGCCCGGG - Intergenic
1176381850 21:6117699-6117721 CGGCCCCTGCTCCTGGGCCCTGG + Intronic
1177279106 21:18956038-18956060 ATGAGGCAGCACCTGGTCCCAGG + Intergenic
1178439107 21:32584226-32584248 CAGCCCCAGCTCCTGGGCACGGG + Exonic
1179277357 21:39904543-39904565 CTGATCTTGCTCCTGGGCACAGG + Intronic
1179741622 21:43420540-43420562 CGGCCCCTGCTCCTGGGCCCTGG - Intronic
1179828514 21:43981773-43981795 CTGGCCCAGCTGCTGGGCCTGGG - Intronic
1179857029 21:44166942-44166964 TGGAGCCAGGCCCTGGGCCCGGG + Intergenic
1179885080 21:44310414-44310436 CCGAGGGAGCTCCTGGGTCCAGG - Intronic
1179911139 21:44449594-44449616 CTGAGCCACCTCCTCGCCCCTGG - Intergenic
1180160036 21:45994989-45995011 CTGAGACAGCTGCCGTGCCCAGG - Intronic
1180190081 21:46158776-46158798 CTGGGGCAGCACCCGGGCCCTGG - Intergenic
1180500339 22:15924102-15924124 CTGAGCCAGTCCATGGGCTCAGG + Intergenic
1180716548 22:17876493-17876515 CTCAGCCAGCTCCTTGGCCCTGG + Intronic
1180758579 22:18181124-18181146 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
1180768866 22:18364916-18364938 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
1180777446 22:18497479-18497501 CAGAGCCAGCACCAGGGCCAGGG - Intergenic
1180810166 22:18754789-18754811 CAGAGCCAGCACCAGGGCCAGGG - Intergenic
1180826741 22:18868140-18868162 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
1181178639 22:21052319-21052341 ATGCCACAGCTCCTGGGCCCCGG - Exonic
1181196310 22:21189041-21189063 CAGAGCCAGCACCAGGGCCAGGG - Intergenic
1181213217 22:21304083-21304105 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
1181363125 22:22354103-22354125 CTGAGGCTGCTCCTTGGCCATGG + Intergenic
1181453123 22:23037278-23037300 AAGAGCCAGCACCTGGGCCTAGG - Intergenic
1182357907 22:29730499-29730521 CTGTGCCAGTTTCTTGGCCCAGG - Exonic
1183493416 22:38128522-38128544 CTGTCCCAGCTCCCAGGCCCTGG + Intronic
1183587190 22:38759699-38759721 CTCAGCCAGCTACTGTGCTCAGG - Intronic
1183665596 22:39244174-39244196 CGGACCCAGGTCCTGCGCCCAGG - Exonic
1183719506 22:39554335-39554357 CTGCAGCAGCTGCTGGGCCCAGG - Intergenic
1183828649 22:40406618-40406640 CAGGGCCAGCTCCTGGGGGCCGG + Exonic
1183910588 22:41075968-41075990 CTTAGCCAGGTCCTCTGCCCAGG + Intergenic
1183986660 22:41573982-41574004 GGGAGCCAGCGGCTGGGCCCTGG + Intronic
1184225441 22:43126947-43126969 CTGAGGCCGGCCCTGGGCCCTGG - Intronic
1184409793 22:44319888-44319910 CAGACCTAGCTCCTGGCCCCAGG + Intergenic
1184414341 22:44343575-44343597 CTGAGCCAGCTCGGGGACCCTGG + Intergenic
1184556703 22:45237074-45237096 TTGGGCCTTCTCCTGGGCCCTGG - Intronic
1184608116 22:45585982-45586004 CTGCAGCAGCTCCTGGGCTCAGG + Intronic
1184776807 22:46627462-46627484 CTCAGCTAGGCCCTGGGCCCTGG + Intronic
1184808700 22:46813807-46813829 CTGAGCCACCTCCTCAGCCCAGG + Intronic
1185010564 22:48310602-48310624 CAGAACCAGCTCCTGGCCTCGGG + Intergenic
1185031246 22:48444250-48444272 GTGAGGCATCTCCTGGGCGCTGG - Intergenic
1185316546 22:50181638-50181660 CTGTGCAAGCTCCTGAGTCCAGG - Intergenic
1185384184 22:50524245-50524267 CAGGGCCAGCCCCAGGGCCCTGG - Exonic
1203230488 22_KI270731v1_random:105800-105822 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
1203276882 22_KI270734v1_random:94050-94072 CAGAGCCAGCACCAGGGCCAGGG + Intergenic
950443351 3:13022525-13022547 CAGGGCCAGCCCCTGGGCTCCGG - Intronic
950500938 3:13363262-13363284 CTAACCCAGCTGGTGGGCCCGGG + Intronic
950976593 3:17252655-17252677 CTGAGGCAGATCCTGATCCCTGG - Intronic
953163765 3:40445770-40445792 TGGAGCCAGCTCCTGTGTCCTGG - Intergenic
953192109 3:40697699-40697721 TTCAGCCAGGTCCTGGGGCCAGG + Intergenic
953679839 3:45030875-45030897 CAGGGCCACCTCCTGGGCCAGGG - Exonic
953826970 3:46261833-46261855 CTGGGCCAGGGCCAGGGCCCTGG + Intronic
954189272 3:48944926-48944948 GTGGGCCAGCTTCTGGGCCTGGG - Intronic
954327893 3:49873495-49873517 CTGAGACAGGAGCTGGGCCCTGG - Intergenic
954419834 3:50412951-50412973 CTGTCCCAAGTCCTGGGCCCTGG - Intronic
956253661 3:67261273-67261295 CTGGGCCAGCTCCTCCTCCCAGG + Intergenic
957740804 3:84265787-84265809 CTGAGTCAGTTCCTGGGTGCAGG + Intergenic
958566332 3:95816023-95816045 CTGAGTCAGTTCCTGGGTCAGGG + Intergenic
959582224 3:107993403-107993425 CACAGGCAGCTCCTGGCCCCTGG - Intergenic
960003348 3:112755848-112755870 CTGAGGTAGCTCCAGGGCTCTGG + Intronic
961810911 3:129521232-129521254 TGGAGGCAGCCCCTGGGCCCTGG - Intergenic
962235006 3:133700180-133700202 CTGGGAAAGTTCCTGGGCCCTGG + Intergenic
962275295 3:134008728-134008750 CTGAGCCAGCCCCTGGGAGTGGG + Intronic
966227005 3:177608665-177608687 CTGAGGCCACACCTGGGCCCAGG + Intergenic
966843777 3:184110423-184110445 CTGAGTCAGTTCCTGGGTCGGGG - Intergenic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967088124 3:186112190-186112212 CTGAGCCAGCTCCTGGGCCCAGG + Intronic
967193338 3:187004369-187004391 CAGAGCCAGCCCCAGAGCCCAGG + Intronic
967915507 3:194575362-194575384 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
968146450 3:196303134-196303156 CTGAGTCAGTTCCTGGGTCGGGG - Intronic
968151913 3:196343666-196343688 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
968163243 3:196444088-196444110 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
968210487 3:196844629-196844651 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
968290994 3:197539713-197539735 CTGAGTCAGTTCCTGGGTCGGGG - Intronic
968630760 4:1649793-1649815 CTGAGCCACCTCAGGGGTCCCGG - Intronic
968727955 4:2256900-2256922 CTGCCCCGGCTCCTGGGTCCTGG + Intronic
968979259 4:3837764-3837786 CTGAGCCAGCAGCTGACCCCAGG - Intergenic
969225993 4:5798668-5798690 CTGCCCCACCTCCTGGGCCTCGG - Exonic
969467218 4:7364909-7364931 CAGAGCCAGGTCCTGAACCCCGG - Intronic
969524385 4:7696778-7696800 TGGAGACAGCTCCTGGGCACCGG - Intronic
969663314 4:8543124-8543146 CTGTACCAGCTCCAGGGGCCTGG - Intergenic
969868631 4:10091570-10091592 CTGCGCTGGCTCCTGGGCCTTGG + Intronic
970128323 4:12839365-12839387 CAGATTCAGCTACTGGGCCCTGG - Intergenic
971589101 4:28443950-28443972 CTGGGCCAGCTTCTGCCCCCAGG - Intergenic
972137923 4:35915972-35915994 CTGGGCCATTTTCTGGGCCCAGG - Intergenic
972302121 4:37794220-37794242 CTGAGTCAGTTCCTGGAGCCGGG + Intergenic
974047383 4:56908698-56908720 TTGAGTCAGCCCCGGGGCCCGGG + Intronic
974107382 4:57485772-57485794 CTGAACCAGATCCTGGGCAGTGG + Intergenic
975094481 4:70442369-70442391 ATGAGCCAGGTCTTGGCCCCTGG + Intronic
976420048 4:84831555-84831577 CTGAGCCAGCTCCTCCGCAGGGG + Exonic
978307568 4:107348414-107348436 CTGAGTCAGTTCCTGGGTCTGGG - Intergenic
979719194 4:123879214-123879236 CTGAGTCAGTTCCTGGGCGAAGG - Intergenic
982500890 4:156153311-156153333 CTGAGTCAGCTCCTGGGTGGGGG + Intergenic
985275151 4:188231095-188231117 CTGGGCTAGCTCCAGGCCCCAGG + Intergenic
985657728 5:1140715-1140737 CTGAGCCCTCCCCGGGGCCCTGG - Intergenic
985705943 5:1401467-1401489 CTGCGGCAGCTCCTGGGGCCTGG + Intronic
986330178 5:6712264-6712286 CTAAGGCAGCTTCAGGGCCCTGG + Intergenic
987286915 5:16466065-16466087 CCGAGGCTGCTCCTGGGCCCTGG + Intergenic
987290311 5:16502408-16502430 CTGTCCCAGCTTCTGGGCCCAGG + Intronic
988124592 5:27013092-27013114 TTAAGGCAGCTCCAGGGCCCTGG + Intronic
990237810 5:53786703-53786725 CTGAGTCAGTTCCTGGGTCAGGG - Intergenic
991035695 5:62125074-62125096 CTCAGCCAGCTTGAGGGCCCTGG - Intergenic
991437701 5:66613605-66613627 CTCAGAAAGCTCCTGGGGCCTGG - Intronic
992143784 5:73824814-73824836 CTGTGCAACCTGCTGGGCCCAGG - Intronic
992963265 5:81976439-81976461 CTGAGGAAGCTCCAGTGCCCTGG + Intronic
995113478 5:108453776-108453798 GTGAGCCAGGCCCAGGGCCCTGG + Intergenic
997031761 5:130138240-130138262 CTGAGCCAGCACCAGGAGCCAGG + Intronic
997527794 5:134564631-134564653 CTCAGCCAGCTCCTGGCAGCAGG - Intronic
998231634 5:140364612-140364634 CTTACCCACCTCCTGGGCCTGGG - Exonic
998388391 5:141771734-141771756 CTGGCCCAAGTCCTGGGCCCAGG + Intergenic
998839028 5:146233625-146233647 CTGGGCCTGGACCTGGGCCCGGG - Exonic
998862634 5:146459119-146459141 CTGAGCCTGAGCCTGGGCCTGGG - Exonic
999378598 5:151104314-151104336 CTGTGCCTGCTCCTTGGGCCCGG - Intronic
1000022663 5:157332051-157332073 CTGAGGCAGCTGCTGTGCCCTGG + Intronic
1000123193 5:158217996-158218018 CAGAGCCAGCTCATGGGACTGGG - Intergenic
1000220342 5:159208928-159208950 CTGTTCCAGCTCCCGGGCCTCGG - Intronic
1000285127 5:159820073-159820095 CTGCAGCAGCTCCAGGGCCCTGG + Intergenic
1001129525 5:169052459-169052481 CTGACCCAGCTAATTGGCCCTGG - Intronic
1001288139 5:170438400-170438422 CTGGGCCAGCTCCTCAGCCTAGG - Intronic
1001826695 5:174751211-174751233 CCGAGCCGGCTCCTCCGCCCCGG - Intergenic
1002071324 5:176680356-176680378 CTGGGCCGGCTCCCGGGCGCGGG + Intergenic
1002128961 5:177067705-177067727 CTGAGTCAGCTCCTGCATCCTGG - Intronic
1002465765 5:179407691-179407713 CTGAGCCTGTGCCTCGGCCCTGG + Intergenic
1002541840 5:179911365-179911387 CTGGGCCACCTCCTGGGGACTGG + Intergenic
1003305720 6:4925764-4925786 CAGAGCCAGCTTCTGAGCCTAGG + Intronic
1003644561 6:7903994-7904016 GAGAGCCAGCTCCAGGGGCCTGG - Intronic
1003914121 6:10769642-10769664 CTGTGCCAGGTCCTGGGCAGAGG + Intronic
1005104874 6:22213711-22213733 CTCAGGCAGCTCCAGGGCTCTGG - Intergenic
1006097272 6:31663982-31664004 GTGAGCTATCTCCTGGGCCGTGG - Exonic
1006107284 6:31724162-31724184 CTGATCCCGCTGCTGGGCGCTGG + Exonic
1006516985 6:34550681-34550703 GGGAGCCAGCTAGTGGGCCCAGG + Intronic
1007207224 6:40162778-40162800 CTGAGCCACCTCCAGGCCCCTGG + Intergenic
1007380632 6:41488230-41488252 CACAGACAGCTCTTGGGCCCTGG + Intergenic
1007498349 6:42277283-42277305 CTGCTCCACCTCCAGGGCCCTGG + Intronic
1007546451 6:42698294-42698316 CTCAGCCAGCCTCTGGGGCCTGG + Exonic
1007733707 6:43967460-43967482 CTGAGGCAGATCCTGGCCACAGG + Intergenic
1007790174 6:44304242-44304264 CTGAGGCAGACCCTGGGCCCTGG - Exonic
1007935548 6:45728994-45729016 CTGAGGCAACTCCTGAGTCCAGG + Intergenic
1009194575 6:60668600-60668622 CTCAGCTTGGTCCTGGGCCCTGG + Intergenic
1009970548 6:70621134-70621156 CTGAGACAGCTCCAGTGCCTTGG - Intergenic
1010280177 6:74014206-74014228 CTGAGTGAGCTCCTGTTCCCAGG + Intergenic
1010991011 6:82479995-82480017 CTCAGCCAGCTCCAGATCCCTGG + Intergenic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1012290533 6:97450369-97450391 CTGTGTCAGCTCCAGGGCCCAGG - Intergenic
1014848613 6:126312383-126312405 CTGAACCAATTCCTGTGCCCAGG + Intergenic
1015852583 6:137589251-137589273 CAGAGCCAGCTCAGGGGACCAGG - Intergenic
1015911164 6:138168927-138168949 CTGAACCAGGTCCTGGGCTAGGG - Intronic
1016536530 6:145112762-145112784 CTGAAACAGCTCCTGGCGCCTGG + Intergenic
1016730512 6:147422948-147422970 CTGAGCCAGCCCTGGAGCCCTGG + Intergenic
1017807687 6:157960291-157960313 CTGAGGCAGTTCCTAAGCCCAGG - Intergenic
1017945672 6:159094607-159094629 CTGAGCCAGGCTCTGGGCCGCGG - Intergenic
1018182035 6:161232614-161232636 CTGAGCCAGCCACGGAGCCCTGG + Intronic
1018679633 6:166253295-166253317 CCCACCCAGCTCCTGAGCCCGGG - Intergenic
1019339854 7:503819-503841 CTGAGCTGGCTCCTGACCCCAGG - Intronic
1019425731 7:975677-975699 GTCAGCAAGCTCCTGAGCCCCGG + Intergenic
1019523934 7:1472357-1472379 CTCAGCCGGCTCCTTGCCCCTGG - Exonic
1019588412 7:1816806-1816828 CTGAGCAAGCTGCTGTGCCACGG + Intronic
1019630071 7:2044325-2044347 CACAGCCAGCACCTGGGACCAGG + Intronic
1019663500 7:2239458-2239480 GTGGGGCAGCTCCTGGGGCCTGG - Exonic
1019906258 7:4067396-4067418 GTGAGCCTGCCCCTGGGCCCAGG + Intronic
1020241999 7:6402227-6402249 GGGAGGCAGCTCCTGGGGCCCGG - Intronic
1020348408 7:7190271-7190293 CTGAGTCAGCTTCTCAGCCCAGG - Intronic
1021897370 7:25249895-25249917 GCGAGCAAGCTCCTTGGCCCCGG + Intergenic
1022112304 7:27239341-27239363 ACAAGCCAGCTCCTGGCCCCCGG + Intergenic
1022501982 7:30887524-30887546 CTCTGCCTGCTCCTGAGCCCTGG - Intronic
1022533862 7:31083839-31083861 CTGAGTCCTCCCCTGGGCCCTGG - Intronic
1023931090 7:44707156-44707178 CTGAGAGCTCTCCTGGGCCCAGG - Intronic
1023983100 7:45080921-45080943 CTGAGTCAGCACCCAGGCCCCGG - Exonic
1023987194 7:45103565-45103587 CCGACACAGCTCATGGGCCCTGG - Intronic
1024733079 7:52274158-52274180 CCAAGCCAGCTCCTGGGCTCCGG + Intergenic
1025290538 7:57717129-57717151 CAGAGCCAGGTCATGGGCACTGG + Intergenic
1026681866 7:72473009-72473031 CTGTACCATCTCCTGGGCCAGGG + Intergenic
1026925581 7:74190549-74190571 CTGAGCGAGCTCAAGGACCCAGG - Intronic
1026956085 7:74377174-74377196 CTGTGCCAGCCCCAGGGCACAGG - Intronic
1027695798 7:81408745-81408767 CTGAGGCAGCTCCGGTGCCCTGG + Intergenic
1027746567 7:82082140-82082162 CTGAGCCAGCCCCAGAGCCGTGG - Intronic
1029696120 7:102214440-102214462 CTGATTCAACTCCTGGGCTCAGG - Intronic
1030115778 7:106061223-106061245 CTGAGCGAGCCCCTGGGTCATGG + Intergenic
1031388754 7:121186980-121187002 CTGGGCCTGCCCCTGGGCTCTGG + Intronic
1032085944 7:128884031-128884053 CCCAGCCAGCTCCTGCCCCCTGG - Exonic
1032193931 7:129779357-129779379 AGGGGCCAGCTCCGGGGCCCCGG + Intergenic
1032683448 7:134208866-134208888 CTGAGCCAGCTCTTGGTTCTGGG - Intronic
1032995369 7:137440100-137440122 TGGAGCCATCTCCTGGGCCCAGG - Intronic
1033128460 7:138725188-138725210 CTGACTCACCTCCTGGGCTCAGG - Intronic
1033258073 7:139818963-139818985 CTGAACTAGCTACTGGGCCTTGG + Intronic
1033261913 7:139851278-139851300 CTGGGCCAGTTCCTGTGGCCGGG + Intronic
1033794924 7:144835727-144835749 CTCAGCTGGCTCCTGGGTCCCGG - Intronic
1034284537 7:149875832-149875854 CAGAGCCAGATCCAGAGCCCAGG - Intronic
1034393134 7:150801111-150801133 CTGTGCCAGCAGCTGCGCCCCGG - Exonic
1034467859 7:151240296-151240318 CTGCCCCAGCCCCGGGGCCCTGG - Intronic
1035397431 7:158544278-158544300 CAGAGCCATCTCGTGGGCCGTGG - Intronic
1036228085 8:6976876-6976898 CTGAGGCAGCCCAGGGGCCCAGG - Intergenic
1036229375 8:6986425-6986447 CTGAGGCAGCTCAGGGGTCCAGG - Intergenic
1036230538 8:6995993-6996015 CTGAGGCAGCCCAGGGGCCCAGG - Intergenic
1036231826 8:7005528-7005550 CTGAGGCAGCTCAGGGGTCCAGG - Intronic
1036232987 8:7015096-7015118 CTGAGGCAGCCCAGGGGCCCAGG - Intronic
1036389284 8:8310605-8310627 TGGAACCAGCTGCTGGGCCCTGG - Intergenic
1036691816 8:10949132-10949154 CAGAGGCAGCCCCGGGGCCCAGG - Intronic
1037315446 8:17595520-17595542 CTGAGAACTCTCCTGGGCCCTGG + Intronic
1037756814 8:21715594-21715616 GTATGCCACCTCCTGGGCCCAGG + Intronic
1037814119 8:22102928-22102950 CTGAGCCAGCACCAGGGCGGTGG + Exonic
1039021174 8:33208543-33208565 CTGAGACAGCTCCAAGGCCTTGG - Intergenic
1039259104 8:35751186-35751208 CTGAGTCAGTTCCTGGGTCGGGG + Intronic
1040991322 8:53353213-53353235 CTGAGGCAGGTCCTGGCCCTAGG + Intergenic
1041839291 8:62249403-62249425 CTCCGCCGGCTCCTGGCCCCTGG - Intronic
1042282030 8:67064973-67064995 GTCAGCCACCTCCAGGGCCCGGG + Intronic
1045011679 8:97964146-97964168 CAGGGCCAGCTCCTGGGAGCTGG + Intronic
1045875102 8:106972283-106972305 CCGAGCCATCTCCTGAGCCAGGG + Intergenic
1046654692 8:116880444-116880466 CTGGGCCCACTCCTGGCCCCTGG - Intergenic
1046933952 8:119868731-119868753 CTGAGTCAGTTCCTGGGTCGGGG - Intergenic
1048203892 8:132400512-132400534 CGGAGCCAGCTCCTAGGCCCTGG + Intronic
1049107922 8:140625145-140625167 CTCAGCCTGCACCTGGGCCCTGG + Intronic
1049427484 8:142543916-142543938 ACGAGCCTGCTCCTGGGGCCAGG + Intronic
1049575250 8:143386847-143386869 CTTAGCCACCTCCAGGGCACTGG + Intergenic
1049613375 8:143566130-143566152 CTGAGCCAGATCTTGGACCAGGG + Intergenic
1049623176 8:143608236-143608258 CTGGGCCCCCTCCTGGCCCCAGG + Intronic
1049678571 8:143904732-143904754 CTGCCCCAACTGCTGGGCCCTGG - Intergenic
1049805642 8:144537563-144537585 CTGAGCGAGCTGGAGGGCCCAGG - Intronic
1051266910 9:15318063-15318085 CTGAGTCAGTTCCTGGGTCGGGG + Intergenic
1051507929 9:17845922-17845944 CTGAGGCAGCTCCAGTGCCCTGG - Intergenic
1051672145 9:19521643-19521665 CAGAGCCAGATCTTGGACCCAGG - Intronic
1051806298 9:20996490-20996512 CTGAGCAAGTATCTGGGCCCAGG + Intergenic
1056221004 9:84450721-84450743 CTGAGTCAGTTCCTGGGTCGGGG - Intergenic
1056591561 9:87969338-87969360 CTCAGTGAGCTCCTGGGCCAGGG + Exonic
1056594945 9:87999965-87999987 ATGTGCCATCTCCTGGGCCCAGG + Intergenic
1056751746 9:89356965-89356987 CTGACCCTGCTTCTGGGCCAGGG - Intronic
1056841238 9:89999583-89999605 CTCAGCCAGCTCCTGTGCACAGG - Intergenic
1057122911 9:92593200-92593222 GTGAGCCAGCTCCTGGGCAAAGG + Intronic
1057142859 9:92738101-92738123 CAGAGCCAGGACGTGGGCCCAGG - Intronic
1057220753 9:93256504-93256526 CTGTGCTGGCCCCTGGGCCCAGG + Intronic
1057706426 9:97398333-97398355 CAGGGCCAGATCCTGGGGCCTGG - Intergenic
1058719493 9:107750832-107750854 GTGAGTCAGCTCCTAGGCCGGGG - Intergenic
1059309201 9:113376897-113376919 CCGGGCCGGTTCCTGGGCCCAGG + Intronic
1059689878 9:116674757-116674779 CTGAGTCAGTTCCTGAGTCCAGG - Intronic
1060192929 9:121604302-121604324 CTCAGCCAGCTGCTCGCCCCAGG - Intronic
1060551271 9:124486494-124486516 TTGACCCAGCTCCTGGGCAGGGG - Intronic
1060741892 9:126104240-126104262 TTTGGCCAGCCCCTGGGCCCTGG + Intergenic
1061001520 9:127905452-127905474 CTGACCCAGCCCTTGGGCCCAGG - Intergenic
1061145035 9:128792587-128792609 ATGGGCCAGCTCCCGGCCCCAGG - Intronic
1061199212 9:129126869-129126891 CTGAGCTAGCAGCTGGGGCCTGG + Intronic
1061296759 9:129681103-129681125 CTGAGCCAGTCCCCGGGCTCCGG + Intronic
1061478710 9:130885776-130885798 GTGAGTCAGCACCTTGGCCCAGG + Intronic
1061484399 9:130912985-130913007 CTGAGCCATCGCCTGGACTCCGG - Intronic
1061534292 9:131238202-131238224 CGGAGCCAGCACTGGGGCCCGGG + Intergenic
1061631541 9:131875171-131875193 CTGATCCAGTTCCTGGACCCAGG + Intronic
1061715007 9:132513550-132513572 CTGAGCGGGGTCCTGTGCCCTGG + Intronic
1061939228 9:133875185-133875207 CTGAGTGACCTCCTGAGCCCCGG - Intronic
1061991851 9:134163559-134163581 CTGATCCCTCTCCTGGCCCCTGG + Intergenic
1062044132 9:134417437-134417459 CTGAGGCAGCCACAGGGCCCAGG - Intronic
1062195391 9:135270705-135270727 CTGAAGCAGCGGCTGGGCCCTGG + Intergenic
1062218645 9:135402785-135402807 CACAGCCGGCTCCAGGGCCCAGG - Intergenic
1062227387 9:135460378-135460400 CTGAGCCAGATCCAGACCCCAGG + Intergenic
1062245279 9:135562904-135562926 CTGAGCCAGCCCTTGGGGCCTGG - Intronic
1062263747 9:135677124-135677146 CCATGCCAGCTCCTGGGTCCTGG - Intergenic
1062372849 9:136249109-136249131 CTGTGCCAGCCCCTGAGCACTGG + Intergenic
1062537359 9:137026894-137026916 CTCAGCCAGCTCCAGGTGCCTGG + Intronic
1062656711 9:137607363-137607385 GTGAGCAAGCTCTGGGGCCCAGG - Intronic
1062733479 9:138121709-138121731 CTCAGCCAGCCCCTGGCCCCTGG + Exonic
1186274149 X:7921800-7921822 CTGGGCCAGCTCGTGAGCGCTGG + Exonic
1186293715 X:8125882-8125904 CTGAGACAGCATCAGGGCCCTGG + Intergenic
1186529617 X:10282120-10282142 CTGCCCCAGCTCCTGGGCTCTGG + Intergenic
1186618650 X:11215066-11215088 CTGGGGCTGCTCCTGGGCCCTGG - Intronic
1186625342 X:11287364-11287386 CTGAGCCAGGGCCAGAGCCCAGG + Intronic
1188388685 X:29592856-29592878 CTCAGCCAGCTCCTTGCACCAGG + Intronic
1189327716 X:40123006-40123028 CTGACCTCGTTCCTGGGCCCTGG + Intronic
1190209483 X:48433375-48433397 CTGAGCAAGCTCCTCAGCCCAGG - Intergenic
1191211920 X:57893148-57893170 CTGAGCCAGTTTCTGGGCCTCGG - Intergenic
1191741284 X:64437855-64437877 CTGAGTCAGCTCCTGGGTGGAGG + Intergenic
1193444070 X:81577848-81577870 CTCAGCCAGTACCTGAGCCCTGG + Intergenic
1194458117 X:94129784-94129806 CTAATCCAGATCCTGGGTCCTGG + Intergenic
1195259409 X:103117465-103117487 GGGAGCCAGCTCCGGGGCCTCGG + Intergenic
1195716844 X:107826319-107826341 CGGCGCGAGCTCCCGGGCCCCGG - Exonic
1197411621 X:126123484-126123506 CTGAGCCAGTTCTTGCGCCCTGG + Intergenic
1197703242 X:129615768-129615790 GTGTGCAAGCACCTGGGCCCTGG + Intergenic
1197718990 X:129731911-129731933 CTAAGTCAGATCCTGAGCCCTGG - Intergenic
1197777739 X:130130366-130130388 CCTTGCCAGCTCCTGGGCACAGG + Intronic
1199015001 X:142804662-142804684 CTGAGCCAAGTTCTTGGCCCTGG - Intergenic
1200176121 X:154117448-154117470 CAGCTCCAGTTCCTGGGCCCTGG + Intergenic
1200247008 X:154531761-154531783 GTGACTCAGCTCCTGGGCTCAGG + Exonic
1200691265 Y:6307562-6307584 CTGAGACAGCCCCAGGCCCCAGG - Intergenic
1201044007 Y:9867154-9867176 CTGAGACAGCCCCAGGCCCCAGG + Intergenic