ID: 967088574

View in Genome Browser
Species Human (GRCh38)
Location 3:186115759-186115781
Sequence CAGCAGAGCCTCAGCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967088574_967088584 19 Left 967088574 3:186115759-186115781 CCACCTCCGCTGAGGCTCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 330
Right 967088584 3:186115801-186115823 ATTTATTTTGAGTTGGACAAAGG 0: 1
1: 0
2: 0
3: 28
4: 389
967088574_967088581 -8 Left 967088574 3:186115759-186115781 CCACCTCCGCTGAGGCTCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 330
Right 967088581 3:186115774-186115796 CTCTGCTGGGCCTGTGGAGTGGG 0: 1
1: 0
2: 2
3: 27
4: 385
967088574_967088583 12 Left 967088574 3:186115759-186115781 CCACCTCCGCTGAGGCTCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 330
Right 967088583 3:186115794-186115816 GGGCTGTATTTATTTTGAGTTGG 0: 1
1: 0
2: 1
3: 16
4: 228
967088574_967088580 -9 Left 967088574 3:186115759-186115781 CCACCTCCGCTGAGGCTCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 330
Right 967088580 3:186115773-186115795 GCTCTGCTGGGCCTGTGGAGTGG 0: 1
1: 0
2: 2
3: 53
4: 426
967088574_967088585 20 Left 967088574 3:186115759-186115781 CCACCTCCGCTGAGGCTCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 330
Right 967088585 3:186115802-186115824 TTTATTTTGAGTTGGACAAAGGG 0: 1
1: 0
2: 3
3: 35
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967088574 Original CRISPR CAGCAGAGCCTCAGCGGAGG TGG (reversed) Intronic
900095690 1:939263-939285 CAGCAGCGCCTCTGCTGGGGAGG - Exonic
900428729 1:2592284-2592306 CACCAGTGCCTCAGGGGAGGGGG - Intronic
900439543 1:2646816-2646838 CAGCAGATCCTGAGGGAAGGTGG - Intronic
900767015 1:4512598-4512620 CAGCAGGGCCTCCTGGGAGGTGG - Intergenic
901146739 1:7070012-7070034 CCGCACATCCCCAGCGGAGGAGG - Intronic
901749564 1:11397501-11397523 CAGACAAGCCTCAGAGGAGGGGG - Intergenic
902517427 1:16996897-16996919 CAGCAGGGCAGCAGCAGAGGTGG + Intronic
902802746 1:18840403-18840425 CAGCAGGGCCACAGCGATGGTGG + Exonic
905212685 1:36385561-36385583 GGGCAGAGCCCCAGCGGAGGAGG + Intronic
907267424 1:53271425-53271447 AAGCAGAGCCTCAGGGCAGTGGG + Intronic
910767813 1:90800260-90800282 CAGCAGAGCAACAGGGGAAGAGG + Intergenic
911044462 1:93617169-93617191 CAGCAGCCCCTCAGCTGAGAAGG + Intronic
911239280 1:95448316-95448338 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
912633159 1:111266947-111266969 CAGCACAGTCCCAGCGGTGGTGG - Intergenic
912859081 1:113196983-113197005 CAGCAGAGCCGCAAGGGAGCAGG - Intergenic
913030260 1:114895011-114895033 GGGCAGAGTCTCAGAGGAGGTGG + Intronic
914920069 1:151840311-151840333 CAGCCCAGCTTCAGCAGAGGAGG - Exonic
915000506 1:152585227-152585249 CAGCACAGTCTCAGGGGAGCAGG - Intronic
915146238 1:153797288-153797310 CAGCAGAGCCTATGAGGAGCTGG + Intergenic
916341725 1:163744634-163744656 CAGCATAGTCTCAGGGGTGGTGG - Intergenic
916360669 1:163963500-163963522 CAACAGAGTCCCAGTGGAGGTGG + Intergenic
916468374 1:165094933-165094955 CAGCAGCACCACAGCGTAGGAGG + Intergenic
916625504 1:166551696-166551718 CAGCAGACCTGCAGCAGAGGGGG - Intergenic
916921985 1:169478438-169478460 CACCTGAGCCTCACCTGAGGCGG - Intronic
916936130 1:169630071-169630093 CAGCAGAGTCACAGAGGAGATGG - Exonic
917122224 1:171654830-171654852 CAGCTGAGCCACAGGGGAGGTGG - Intergenic
917703948 1:177612730-177612752 CACTAGTGCCTCAGCAGAGGGGG + Intergenic
921150448 1:212397756-212397778 CAGCAAAGACTCTGTGGAGGGGG + Intronic
921217796 1:212951644-212951666 CAGCGGGGGCTCAGAGGAGGAGG + Exonic
923393402 1:233536131-233536153 AAGCAGAGCCTCAGCAGACCTGG - Intergenic
1062765800 10:64164-64186 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1062898442 10:1122796-1122818 CAGCACAGCCTCAGCTGGTGAGG + Intronic
1063921560 10:10938747-10938769 CAGCAAAGCCTGAGTGTAGGTGG + Intergenic
1065603051 10:27389213-27389235 GAGCTGGGCCTCAGCTGAGGGGG + Intergenic
1066986896 10:42475966-42475988 CAGGAGGGCCCCAGCGGTGGGGG + Intergenic
1067083883 10:43228135-43228157 GAGCAGAGCCCAAGAGGAGGTGG - Intronic
1067147031 10:43701485-43701507 CGGCAGGGCCTCAGCTGTGGAGG - Intergenic
1067222208 10:44352497-44352519 CAGCTGAGCCTCCCAGGAGGAGG - Intergenic
1067477313 10:46575629-46575651 CAGCACAGCCTCAGCCCTGGAGG + Intergenic
1067617426 10:47766152-47766174 CAGCACAGCCTCAGCCCTGGAGG - Intergenic
1069999847 10:72368128-72368150 CTGCCGAGACTCTGCGGAGGGGG + Exonic
1071997723 10:91163510-91163532 CAGCGGCGCCTCCGCCGAGGAGG + Intronic
1072744426 10:97929817-97929839 CAGCAGATCCTCAACTCAGGAGG + Intronic
1073472383 10:103730968-103730990 CAGCACAGGCTCAGGGGCGGAGG + Intronic
1074273480 10:111978478-111978500 CAGCAGAGCCTCTGAGGAAGAGG + Intergenic
1074450846 10:113558688-113558710 GAGCACAGCTTCAGCAGAGGTGG + Intronic
1076741581 10:132488352-132488374 CCGCAGAGCCTCAGGGCAGCAGG - Intergenic
1077383266 11:2257336-2257358 CAGCAGAACCACAGCGGGTGGGG - Intergenic
1079869444 11:25779171-25779193 CTGCTGAGCCACAGAGGAGGTGG + Intergenic
1080015911 11:27506686-27506708 CAGCCGAGGCTCGGCGGAGGTGG - Intronic
1080707107 11:34706860-34706882 CAGCACAGCCCCAGTGGTGGTGG - Intergenic
1081988609 11:47325454-47325476 CCGCAGACCCTCAGGGGAGGTGG + Intronic
1084189166 11:67491217-67491239 CACCAGAGCCTCAGAGCTGGTGG - Intergenic
1085266713 11:75241751-75241773 CGGCACAGCCGCAGCGCAGGGGG - Exonic
1086593595 11:88544538-88544560 CAGCAGAGCCTCACAGGAGTGGG - Intronic
1087128748 11:94651265-94651287 CAGTAGGTCCTCAGTGGAGGAGG + Intergenic
1089220681 11:116868896-116868918 CAGAAGAGCAGCAGCGGTGGAGG - Intronic
1089260072 11:117218214-117218236 CAGCAGAGCAACTGAGGAGGAGG - Intronic
1089314133 11:117579135-117579157 CTGCAGAGCCTCGGTGGGGGAGG - Intronic
1090002941 11:122977745-122977767 CAGCCGAGCCTCGGCGGCGGTGG + Exonic
1091214483 11:133892302-133892324 CAGGACAGCCACAGCAGAGGCGG - Intergenic
1091653058 12:2323891-2323913 CAGCAGAGCCTAGACGGATGGGG + Intronic
1092173024 12:6384982-6385004 CAGTAGAGCCTCAGGAGACGAGG - Intronic
1093094958 12:14961325-14961347 TAGCAGTGACTCAGGGGAGGAGG - Intronic
1095101130 12:38184752-38184774 CAGCACAGTCTCAGTGGTGGTGG + Intergenic
1101531833 12:105580563-105580585 CAGGAGAGCCTCAGAGGTCGGGG + Intergenic
1101607574 12:106259137-106259159 CAGCACAGTCTCAGTGGTGGTGG + Intronic
1101674821 12:106908141-106908163 CACCCCAGCCTCAGCTGAGGTGG + Intergenic
1103555819 12:121765891-121765913 CAGGAGAGCCTGTGTGGAGGCGG + Intronic
1104828840 12:131734119-131734141 CATCAGAGCCTCTGCTGTGGTGG + Intronic
1105327289 13:19382278-19382300 CAGCAGAGCCCGGGGGGAGGCGG - Intergenic
1108099348 13:46937100-46937122 CAGTACAGCCTCAGTGGTGGTGG + Intergenic
1109335192 13:60985379-60985401 CAGCAAACCTTCAGCAGAGGAGG + Intergenic
1110737780 13:78958249-78958271 CAGCACTGACTCAGCGGAGCTGG - Intergenic
1111673907 13:91363390-91363412 CAGCAGTGATTCAGAGGAGGCGG - Intergenic
1111770061 13:92585252-92585274 CAGCAAAGCCACAGGGGTGGAGG + Intronic
1111929804 13:94501978-94502000 CAGCAGAGCCTCAGAAGTAGGGG - Intergenic
1111929815 13:94502030-94502052 CAGCAGAGCCTCAGAAGTGGGGG - Intergenic
1111929827 13:94502082-94502104 CAGCAGAGCCTCAGAAGTAGGGG - Intergenic
1111929838 13:94502134-94502156 CAGCAGAGCCTCAGAAGTGGGGG - Intergenic
1111929850 13:94502186-94502208 CAGCAGAGCCTCAGAAGTAGGGG - Intergenic
1111929861 13:94502238-94502260 CAGCAGAGCCTCAGAAGTGGGGG - Intergenic
1112495258 13:99898994-99899016 CATCAGAACCTAAGTGGAGGAGG - Intergenic
1113458834 13:110467691-110467713 CAGCAGAATCGCAGCGCAGGCGG - Intronic
1113926917 13:113946848-113946870 CAGCAAAGCCACAGCAGAGCTGG + Intergenic
1114543598 14:23482404-23482426 CAGCAGAGCCTCAGGATTGGGGG + Intronic
1115657644 14:35459200-35459222 CAGCAAAGCCTCAGGGATGGAGG + Intergenic
1115786334 14:36829775-36829797 CAGCAGAGGCTGAGTGGTGGTGG + Intronic
1119172754 14:72547188-72547210 CAGCAGCACCGCAGCAGAGGGGG + Intronic
1119728499 14:76936614-76936636 CTGGGGAGCCTCAGAGGAGGTGG - Intergenic
1121320813 14:92990736-92990758 CTGCAGAGCATCAGCCGTGGAGG - Intronic
1122019895 14:98829009-98829031 CAGCAGGGCACCAGAGGAGGGGG + Intergenic
1122604532 14:102939444-102939466 GAACAGAGCTTCAGCGGAGACGG + Intronic
1122924849 14:104894834-104894856 CAGCAGGGCCTCGGCTGAGGCGG - Exonic
1123030074 14:105447435-105447457 GAGCAGAACCTCAGCCAAGGGGG - Intronic
1123091994 14:105746033-105746055 CAGAAGAGCCTCAGGTGAGAAGG - Intergenic
1124692084 15:31832197-31832219 CAAGAGAGCCCCAGCGGAGGAGG - Intronic
1126980796 15:54240591-54240613 CAGCAGAGCGTTAGTGAAGGAGG - Intronic
1127978605 15:64017430-64017452 CAGCAGAGCCACCTCGGTGGAGG - Intronic
1128088026 15:64899079-64899101 CAGCAGAGCCCCAGCTGGGAAGG + Intronic
1128765499 15:70248743-70248765 AAGCAAAGCCTCAGGGAAGGCGG - Intergenic
1131057386 15:89383733-89383755 CAGCACAGGCTGAGGGGAGGAGG - Intergenic
1131107946 15:89747426-89747448 AAGCAGAGCCCCAGAAGAGGAGG + Intergenic
1131467561 15:92667865-92667887 AAGCAGAGCCTCAGAGGAGGTGG - Intronic
1132433104 15:101776188-101776210 CAGCAGAGCAGCAGAGGATGAGG - Intergenic
1132888194 16:2191671-2191693 CAGCAGTGTCTGAGCAGAGGGGG - Intronic
1133818206 16:9214183-9214205 CAGGAGAGCTGCAGCAGAGGGGG - Intergenic
1133834055 16:9350950-9350972 CAGCACAGCCCCAGTGGTGGTGG - Intergenic
1135045699 16:19153406-19153428 CAGGAGTGACTCAGAGGAGGAGG + Intronic
1135424460 16:22325442-22325464 CAGCAGAGCCTCAGGGACGGAGG + Intronic
1136617527 16:31407740-31407762 CAGCAGAGAGACAGCCGAGGAGG - Intronic
1137665912 16:50248922-50248944 CAGCAGACACACAGCGGAAGAGG - Intronic
1139879648 16:70173136-70173158 CAGCAGAGCTTCCACGGAGTTGG + Intergenic
1140087648 16:71810884-71810906 TAGCAGAACCCCAGTGGAGGAGG - Intergenic
1140219375 16:73032917-73032939 AATCAGAGCCCCAGTGGAGGGGG + Intronic
1140372878 16:74422412-74422434 CAGCAGAGCTTCCACGGAGTTGG - Intergenic
1141627436 16:85268701-85268723 CAGCACAGCCTCAGCAGGAGGGG + Intergenic
1142348718 16:89570252-89570274 CAGAAGAGCCTCAGTGGAGCAGG + Intergenic
1145938009 17:28726333-28726355 CAGCAGCGCCTGAGGGGCGGGGG - Intronic
1146142237 17:30378404-30378426 CAGCGGGGCTCCAGCGGAGGCGG + Intergenic
1146625817 17:34434752-34434774 CAGGAGAACCTCAGCATAGGAGG - Intergenic
1146744958 17:35320217-35320239 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1148044149 17:44732175-44732197 CAGGGGAGCATCAGTGGAGGAGG + Exonic
1148279594 17:46337678-46337700 CAGCGAAGCCCCAACGGAGGAGG + Exonic
1148301811 17:46555534-46555556 CAGCGAAGCCCCAACGGAGGAGG + Exonic
1148698705 17:49575933-49575955 CAGCAGAGCCACGGCGCAGCTGG + Exonic
1149607609 17:57935961-57935983 CAGGACAGCAACAGCGGAGGTGG - Intronic
1150400805 17:64854619-64854641 CAGCGAAGCCCCAACGGAGGAGG - Exonic
1150425962 17:65077284-65077306 CAGCAGACCCCCAGCTGAGTAGG + Intergenic
1151450311 17:74194709-74194731 CAGCAGCCCCTCAGCACAGGTGG - Intergenic
1151751973 17:76044400-76044422 CAGCAGAGCCTGAGCGCTGCTGG + Intronic
1151780177 17:76240350-76240372 CCGCAGCGCCGCAGCGGAGCCGG - Exonic
1152177377 17:78796711-78796733 CAGCAGAGCCACACTGAAGGAGG + Exonic
1152992368 18:375142-375164 CAGAAGAGCTTGAGCAGAGGAGG - Intronic
1153254510 18:3156979-3157001 GAGCAGAGCTGCAGAGGAGGTGG + Intronic
1153915005 18:9737582-9737604 CAGAAGAGCCGCAGGAGAGGAGG - Intronic
1156181734 18:34612495-34612517 CAGCCTACCCTCAGCGGAAGGGG + Intronic
1156462095 18:37326798-37326820 AGGCAGAGCCTGAGCGGAAGAGG - Intronic
1157471271 18:47991022-47991044 CAGCAGAGCACCAGCACAGGCGG + Intergenic
1157793036 18:50549767-50549789 CAGATGAGCCTCAGAGCAGGAGG + Intergenic
1157977201 18:52340617-52340639 CAGCAGAGGCGCAGGGGAGGTGG + Exonic
1160038450 18:75322104-75322126 CAGCTGAGCCAGAGGGGAGGAGG + Intergenic
1160128546 18:76203746-76203768 CAGCATAGCCACAGTGGAAGGGG + Intergenic
1160919238 19:1512141-1512163 CAGCAGAGCCTGAAGGCAGGTGG + Intronic
1161015103 19:1979457-1979479 CAGCGGGGCCTCGGCGGGGGTGG - Intronic
1161511809 19:4676237-4676259 CAGAAGAGACTCAGAGGAGCGGG - Exonic
1161634389 19:5378028-5378050 CAGCTGAGCCAGAGGGGAGGTGG - Intergenic
1161801077 19:6416979-6417001 CTCCAGAGCCTCAGGGTAGGTGG - Exonic
1164280415 19:23763550-23763572 CACCAGAGCCTGAGAGGCGGAGG - Intronic
1164413164 19:28022261-28022283 CATCAGGGCCTCTGCTGAGGGGG + Intergenic
1164413183 19:28022319-28022341 CATCAGGGCCTCTGCTGAGGGGG + Intergenic
1166716796 19:44973568-44973590 CAGCAGAGGCTGACAGGAGGTGG + Intronic
1166895415 19:46019228-46019250 CAGCAGGGCCTCAGGGGGAGCGG + Exonic
1167372945 19:49094938-49094960 GAGCAGAGACTCAACGGAAGTGG - Intronic
1167391275 19:49196717-49196739 CGCCAGGGCCTGAGCGGAGGCGG + Exonic
925108250 2:1311128-1311150 GAGAAGAACCTCAGCTGAGGAGG - Intronic
925506233 2:4568503-4568525 CAGCATAGTCCCAGTGGAGGTGG - Intergenic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
927142613 2:20140405-20140427 GATCAGAGCCCCTGCGGAGGGGG + Intergenic
927846549 2:26475272-26475294 GGGCACAGCCTCAGCGCAGGTGG + Intronic
927897896 2:26796647-26796669 CAGCAGAGCAGCAGTGGGGGTGG - Intronic
928911412 2:36425693-36425715 CATCAGAGGCTCAGATGAGGTGG + Intronic
929940918 2:46333458-46333480 CAGAAAAGCCTCTGTGGAGGTGG + Intronic
932056413 2:68448189-68448211 CTGCAGAGCACCAGGGGAGGGGG + Intergenic
932586375 2:73032296-73032318 CAGCAGAGGCACAGAGGAGATGG - Intronic
933341546 2:81033036-81033058 CAACAGAGTCTCAGTGGTGGTGG - Intergenic
935332595 2:101988067-101988089 AAGCACAGCCTCAGCTGTGGTGG + Intergenic
936481108 2:112885560-112885582 CACCAAAGCCACAGCAGAGGGGG + Intergenic
936500685 2:113063731-113063753 CAGCAAAGCCACTGAGGAGGAGG + Exonic
937234827 2:120424471-120424493 CAGCAGGTCCTCAGCTGAGCTGG - Intergenic
938672677 2:133600767-133600789 AAGCAGAGCCTGAGCGGGGATGG - Intergenic
941470915 2:165885620-165885642 TAGCACAGCCTAAGAGGAGGAGG + Intronic
941997699 2:171616431-171616453 CTGCAGAGTCTCAGAGGATGGGG - Intergenic
1168942676 20:1726822-1726844 CACCAGAGCCTGGGAGGAGGAGG + Intergenic
1169623955 20:7541192-7541214 CAGCACAGTCTCAGCAGTGGTGG + Intergenic
1170489737 20:16861049-16861071 TAGCAGAGCTTCAGAGAAGGTGG + Intergenic
1171013857 20:21522775-21522797 CCGCGCAGCCCCAGCGGAGGGGG + Intergenic
1171397870 20:24850413-24850435 CACCAGAGCCTGAGAGCAGGAGG + Intergenic
1171777840 20:29387423-29387445 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1171819598 20:29822735-29822757 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1171898225 20:30830447-30830469 CAGCACAGTCTCAGTGGTGGTGG + Intergenic
1172318195 20:33973250-33973272 CGGCAGAGAGTCAGTGGAGGGGG - Intergenic
1173169897 20:40715569-40715591 AAGCAGAGCATCAGAGGAGAAGG + Intergenic
1173338710 20:42135208-42135230 AAACAGAGGCTCAGGGGAGGTGG - Intronic
1173807435 20:45934992-45935014 CCGGAGAGCCCCAGCGGAGCGGG + Intronic
1174147918 20:48464962-48464984 CAGCAGAGACTGTGAGGAGGTGG - Intergenic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1175250840 20:57609383-57609405 CAGCAGAGACTCAGGGGAGGGGG - Intronic
1176104936 20:63381494-63381516 CAGCACAGCCTGAGAGCAGGAGG - Intergenic
1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG + Intronic
1179187793 21:39097916-39097938 AAGAAGAGCATCATCGGAGGGGG - Intergenic
1179539230 21:42073454-42073476 CAGCAGGGCCTCTGGGGATGGGG - Intronic
1179955067 21:44733976-44733998 CAGCAGAGACTCAGGGCATGGGG + Intergenic
1180064681 21:45406192-45406214 CAGCAGAGGCCCGGGGGAGGCGG + Intronic
1180323594 22:11347426-11347448 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1182945363 22:34316621-34316643 CTGCAGAGCCACAGGGGTGGAGG + Intergenic
1183100160 22:35578950-35578972 CGTCAGAGCCACAGCAGAGGAGG + Intergenic
1183379827 22:37485357-37485379 CAGCAGAGACACAGCGGCAGGGG + Intronic
1183433274 22:37778825-37778847 CAGCAGGGCCTGAGCGCCGGAGG + Intergenic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
1184877912 22:47287014-47287036 CACCAAAGCCTCACCGGAAGTGG + Intergenic
1184982639 22:48105292-48105314 CAGCAGAGCCCCAGGACAGGGGG + Intergenic
1185157401 22:49202411-49202433 CAGCTGGGCCTGAGCAGAGGTGG - Intergenic
1185399074 22:50606736-50606758 AAGCTGAGTCTGAGCGGAGGAGG + Exonic
949383256 3:3469296-3469318 CAGCAGAGCCTCACTGTAGGTGG + Intergenic
949484650 3:4526453-4526475 CAGTAGGGCCTCAGCGCTGGAGG - Intronic
950032079 3:9860020-9860042 CAGCAGCGCCTGAAGGGAGGTGG + Intergenic
950098096 3:10341772-10341794 TAGAAGAGACTCAGAGGAGGTGG - Intronic
950470431 3:13181687-13181709 CAGCAGGGCCACAAAGGAGGAGG + Intergenic
952711126 3:36433032-36433054 CAGCAGAGCCCCAGGGCAGGAGG + Intronic
952742546 3:36748471-36748493 CAGGGCAGCCTCAGCAGAGGAGG + Intergenic
952967564 3:38630726-38630748 CAGCAGAGGCTCAGCAGACCTGG + Intronic
953138258 3:40202582-40202604 CAGCAGAGCCACAAAGCAGGGGG - Intronic
953960313 3:47261333-47261355 CAGCAGAGTCTCTCTGGAGGGGG + Intronic
954244021 3:49316742-49316764 CAGCAGAGGCCCAGGGCAGGGGG - Intronic
955020999 3:55120847-55120869 CAACAGAGCCAGAGTGGAGGCGG + Intergenic
955215416 3:56981450-56981472 CAGCATAGCTTGAGCAGAGGTGG + Intronic
957087347 3:75693222-75693244 CAGCACAGTCTCAGTGGTGGTGG + Intergenic
958162230 3:89832127-89832149 CTGCAAAGCCTCAGCGAGGGTGG + Intergenic
959300420 3:104592573-104592595 CAGAAGAGCTTCAGAGGAAGTGG + Intergenic
959860406 3:111209092-111209114 TAGCAGAGCCTCAGAGGGAGAGG + Intronic
961319410 3:126062515-126062537 CAAAAGAGCCTCTGCGGAGGAGG - Intronic
961775262 3:129279435-129279457 AGGAAGAGCCGCAGCGGAGGGGG - Intronic
961974108 3:131004760-131004782 CAGCAAAGCCTCTGCAGAGGTGG + Intronic
962199388 3:133389021-133389043 CACCAGAGCCTCTGGGGATGAGG - Intronic
962634951 3:137321066-137321088 TAGCAGAGCCAAAGAGGAGGTGG - Intergenic
963044948 3:141095458-141095480 CAGCAAAGTCTCAGGGGAGCCGG - Intronic
963547461 3:146678089-146678111 CTACAGAGGCTCAGAGGAGGAGG - Intergenic
967088574 3:186115759-186115781 CAGCAGAGCCTCAGCGGAGGTGG - Intronic
968037301 3:195558702-195558724 CAGCATAGTCTCATGGGAGGAGG + Intergenic
968546250 4:1200474-1200496 CAGGGGAGGCTCAGCGGGGGCGG + Intronic
968979880 4:3841518-3841540 CAGCTGAGTCTCAGGGCAGGTGG - Intergenic
969866433 4:10079559-10079581 CAGCAGAGGCTCTGCAGCGGGGG + Intronic
969926821 4:10593232-10593254 CTGCAGAGGCTCAGGGCAGGCGG + Intronic
970229268 4:13891905-13891927 AAGCGGAGACTCAGTGGAGGAGG - Intergenic
972579362 4:40380873-40380895 CAGCACAGCCCCAGTGGTGGTGG + Intergenic
975764787 4:77655602-77655624 CAGCAGACCTGCAGTGGAGGGGG + Intergenic
977873588 4:102123349-102123371 CAGCAGAGTCCCAGTGGAGGTGG - Intergenic
977985718 4:103380308-103380330 CAGCAGAGTCCCAGAGGTGGTGG + Intergenic
978082834 4:104615946-104615968 CAGCACAGCCCCAGTGGCGGTGG - Intergenic
979122500 4:116920927-116920949 CTGCAGAGCCACAGGGGTGGAGG + Intergenic
980541440 4:134201531-134201553 CGGCAGCGCCTCGGCGGCGGCGG - Intronic
981502195 4:145463730-145463752 CAGCAGAGTCACAGCTGAGCAGG - Intergenic
984589812 4:181604644-181604666 CAGCAGAATGTCAGCTGAGGAGG - Intergenic
985595224 5:784882-784904 CGGCGGAGCCTCAGCGGAGCCGG - Intergenic
986001362 5:3633486-3633508 CAGCACAGCCACAGGGGAGGTGG - Intergenic
986032618 5:3908541-3908563 GAGCAGAGCCTAAGAGGTGGCGG - Intergenic
986442296 5:7793029-7793051 CAGCAGGGCCACAGGGGAAGTGG - Intronic
986685409 5:10271816-10271838 CTGGGGAGCCTCAGCGGATGGGG - Intergenic
990490931 5:56302208-56302230 GAGCACAGCCTCAGAGGATGTGG + Intergenic
991671469 5:69052612-69052634 CAGCAGAGACTGAGTTGAGGAGG - Intergenic
991720833 5:69493169-69493191 TAGCAGTGCCTCAGCGGCGCGGG + Intronic
992105652 5:73447649-73447671 CAGCAGAGACTCGGCGGCCGCGG + Exonic
996667692 5:126079753-126079775 CAGCAAAGCCTCAGAGATGGAGG - Intergenic
997388855 5:133497016-133497038 CAGCAGACCCTGGGCTGAGGTGG - Intronic
997699848 5:135889217-135889239 CAGCAGAGCCTCGGGGTAGAGGG - Intergenic
1000026675 5:157364537-157364559 CAGCATAGCAGCAGCAGAGGTGG + Intronic
1000050688 5:157560357-157560379 AAGCAGAGGCTCAGGGGAGCTGG + Intronic
1000144174 5:158437109-158437131 CATCAGAGACTAAGTGGAGGTGG - Intergenic
1000297860 5:159927791-159927813 CACCAGAGCCTCAGATGGGGAGG + Intronic
1000406585 5:160893930-160893952 CAGCAGACCTGCAGCAGAGGGGG + Intergenic
1002431604 5:179207410-179207432 CGGCAGAGCCTCAGGGGACCTGG + Intronic
1002545962 5:179945334-179945356 CTGCAAAACCTCAGCGGCGGGGG + Intronic
1002931493 6:1637969-1637991 GAGAAGACCCTCAGGGGAGGTGG - Intronic
1003114365 6:3273494-3273516 CAGCAGGGCCCCTGCAGAGGTGG - Intronic
1003322772 6:5066936-5066958 GCGGAGAGCCTCAGCCGAGGAGG + Intergenic
1003343130 6:5240833-5240855 CAGCAGCGCCTCAATGGCGGGGG + Intronic
1004078119 6:12364041-12364063 CAGCAAGGCCTCAGCTGAGGGGG - Intergenic
1004781551 6:18914019-18914041 CTTCAGAGCCACAGCAGAGGAGG - Intergenic
1005042235 6:21609978-21610000 CACCAGAGCCCAAGGGGAGGGGG + Intergenic
1006175124 6:32116903-32116925 CAGGAGACCCCCAGTGGAGGAGG + Intronic
1006415851 6:33903484-33903506 CAGAAGAGCCTGGGTGGAGGTGG + Intergenic
1007134676 6:39509118-39509140 CAACAGACCTTCAGCTGAGGGGG + Intronic
1007744659 6:44036192-44036214 CAGCAGAACCTCAAAAGAGGAGG + Intergenic
1010083152 6:71886913-71886935 CAGCGGAGCCCTAGCGGCGGCGG - Intronic
1010521956 6:76849207-76849229 CAGCAGACCTTCAGCAGAGGGGG - Intergenic
1010681694 6:78806891-78806913 CAGCAGACCTGCAGCAGAGGGGG - Intergenic
1011174205 6:84541702-84541724 CAGCAGACCTGCAGCAGAGGGGG + Intergenic
1011386181 6:86801306-86801328 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1011791750 6:90906651-90906673 CAGCACAGCCCCAGTGGTGGTGG - Intergenic
1014650201 6:124026915-124026937 CAGCACAGCTTCAGTGGAGCAGG - Intronic
1016228383 6:141771404-141771426 CAGCAGTGTCCCAGGGGAGGTGG - Intergenic
1016616283 6:146052400-146052422 CAGCAGAGCCTCCACGGCTGGGG - Intronic
1017622185 6:156310339-156310361 TAGCAGAGCCACTGCAGAGGTGG - Intergenic
1019446306 7:1073412-1073434 AAGCAGAGCCTGAGGGGCGGCGG - Intronic
1019969155 7:4526170-4526192 CAGGAGAGCATGAGGGGAGGGGG + Intergenic
1022101750 7:27173358-27173380 CAGCAAAGCCTCGCCGGAGAAGG - Exonic
1022662332 7:32378699-32378721 CAGAAGTGCTTCAGCGCAGGAGG + Intergenic
1023093728 7:36640008-36640030 CAGCAGAGGCTGTGCTGAGGCGG + Intronic
1026231410 7:68487376-68487398 CAGCTGAGCCTGAGAGAAGGAGG - Intergenic
1026805006 7:73424042-73424064 CAGCACAGCCTCCGAGAAGGTGG + Intergenic
1027524177 7:79245853-79245875 CAGCATGGCCCCAGCGGTGGTGG + Intronic
1028022470 7:85793153-85793175 CAGCACAGCCCCAGTGGTGGTGG + Intergenic
1028378827 7:90176074-90176096 CTGCAGAGCCTCAGAGAGGGTGG + Intronic
1029284685 7:99457605-99457627 CATCAGAGCCTCATTGGGGGTGG - Intronic
1029596181 7:101538661-101538683 CAGCAGGGCCTGAGCCCAGGGGG + Intronic
1032125417 7:129189323-129189345 CCGCAGTGGCTCAGCGGCGGCGG - Exonic
1033265715 7:139884818-139884840 CAGCAGGGTCTCAGCGGTGAGGG + Intronic
1034786569 7:153931871-153931893 CAGCAGATCCTCAGCTGATCAGG - Intronic
1034831755 7:154314592-154314614 CAGCAGAGCCCCAGGGCATGGGG + Intronic
1035122214 7:156578407-156578429 CCTCAGCGCCTCAGAGGAGGAGG - Intergenic
1035587255 8:785802-785824 CAGAGGAGCCTGAGGGGAGGAGG - Intergenic
1035625632 8:1068672-1068694 CAGCAGGGGCTCAGCGCATGTGG + Intergenic
1035625643 8:1068718-1068740 CAGCAGGGGCTCAGCGCATGTGG + Intergenic
1036138499 8:6183709-6183731 CAGGAGAGACTATGCGGAGGTGG - Intergenic
1037649592 8:20824377-20824399 CAGCAGATTCTCAGCGAACGTGG + Intergenic
1037753163 8:21695770-21695792 CAGCACAGCCTCTGAGGGGGTGG - Intronic
1037957914 8:23072931-23072953 CAGCACAGCCTCTCTGGAGGAGG - Intergenic
1037962261 8:23106277-23106299 CAGCACAGCCTCTCTGGAGGAGG - Intronic
1037976936 8:23220477-23220499 CAGCAGAGTCACAGCTGAAGAGG - Intronic
1041428706 8:57753094-57753116 GAGCAGAGCCTCCCCAGAGGGGG + Intergenic
1047977088 8:130141425-130141447 CAGCACCTCCTCAGAGGAGGCGG + Intronic
1047998534 8:130358432-130358454 CGGCAGCTCCTCAGCGGCGGGGG + Intronic
1049107909 8:140625095-140625117 CAGCAGGGACTGAGCAGAGGAGG - Intronic
1049214471 8:141401493-141401515 CAGCAGAGCATCTGCTGAGATGG - Intronic
1049334585 8:142076435-142076457 GAGCAGGGCCTCATCAGAGGAGG - Intergenic
1049403310 8:142440559-142440581 CAGCAGGGCCTCAGCGGAGGTGG - Intergenic
1049711059 8:144063533-144063555 GAGCAGAGCCTGAGCGGGCGAGG - Intronic
1049731320 8:144180018-144180040 CAGCAGCCCCTCAGCAGAGGAGG + Intronic
1049989264 9:976709-976731 CCGCAGCGCCTCCGCGAAGGAGG + Intergenic
1050852161 9:10301153-10301175 CAGCAGACCTACAGCAGAGGGGG + Intronic
1051469616 9:17423137-17423159 TAGCACAGCCTCAGCAGTGGTGG - Intronic
1052941499 9:34134752-34134774 CAGCAGCGCGGCAGCGGCGGCGG - Intergenic
1056717302 9:89042755-89042777 CATCACTGCCTCAGCAGAGGGGG - Intronic
1057216271 9:93230531-93230553 CAGCAGATGCTCAGGTGAGGGGG - Intronic
1057314168 9:93958384-93958406 CGGCAGTGCCTGAGCAGAGGAGG - Intergenic
1057406164 9:94772679-94772701 CACCAGGGCCTGAGGGGAGGGGG + Intronic
1057721479 9:97535375-97535397 CAGCAGAGGCCCAGCAGATGAGG - Intronic
1060419487 9:123457660-123457682 CAAAAGAGGCTCAGGGGAGGGGG - Intronic
1060757455 9:126223724-126223746 CATCAGAGCCTCTGGGGAGTGGG - Intergenic
1061005244 9:127925244-127925266 CGGCAGGGCCCCAGCGGAGCTGG - Exonic
1061867311 9:133499479-133499501 CGGCAGAGCTGCAGAGGAGGGGG - Intergenic
1062004391 9:134231970-134231992 CAGCAGGGCCTCAGTGGAGGTGG + Intergenic
1062250858 9:135592852-135592874 CAGCACAGACTCAGGGGACGGGG - Intergenic
1203371269 Un_KI270442v1:308001-308023 CAGCACAGTCTCAGTGGTGGTGG - Intergenic
1185889478 X:3811514-3811536 CAGCAGAGCCTCGGGAGGGGAGG + Intergenic
1186193185 X:7086080-7086102 CAGCAGGGGCTCAGCAGAGTTGG - Intronic
1186911568 X:14173612-14173634 CAGCATAGTCTCAGTGGTGGTGG - Intergenic
1187310267 X:18135089-18135111 CAACAGAGTCTCAGAGGAGCAGG - Intergenic
1188998991 X:36922925-36922947 CAGCACAGTCCCAGCGGTGGTGG - Intergenic
1189379886 X:40495084-40495106 CAGCAAAGCCTCATCAGATGTGG - Intergenic
1192483308 X:71503543-71503565 CAGCAGAGACTCTGAGGAAGGGG - Intronic
1196951053 X:120875676-120875698 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196951884 X:120932048-120932070 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196952568 X:120936909-120936931 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196953253 X:120941770-120941792 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196953938 X:120946630-120946652 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196954623 X:120951491-120951513 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196955306 X:120956351-120956373 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196955993 X:120961234-120961256 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196956675 X:120966095-120966117 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196957357 X:120970955-120970977 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196958039 X:120975815-120975837 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196958721 X:120980675-120980697 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1196959402 X:120985535-120985557 CAGCAGCGCCTCAACTGGGGTGG + Exonic
1197524830 X:127548098-127548120 CTGCAGAGCCACAGGGGTGGAGG + Intergenic
1199040984 X:143115557-143115579 CAGCACAGTCTTAGCGGTGGTGG - Intergenic
1199455204 X:148020480-148020502 CAGCACATCCTCAGCTGTGGTGG - Intronic
1200080739 X:153575244-153575266 CAGCAGGGGCTCAGTGGACGGGG - Intronic
1201067076 Y:10107083-10107105 CAGCACAGTCTCAGTGGTGGTGG + Intergenic