ID: 967094220

View in Genome Browser
Species Human (GRCh38)
Location 3:186163410-186163432
Sequence GGCCTCTGGTCTGGGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967094220 Original CRISPR GGCCTCTGGTCTGGGTGAGC AGG Intronic
900116716 1:1032275-1032297 GGCCTCCTGTCTGGGTGATGGGG + Intronic
900659532 1:3775703-3775725 GGCCGTTGGTCTGGGTCAGGGGG - Intronic
902276711 1:15345253-15345275 GGGCTCTGGTCTGGGCCCGCCGG + Intronic
903623463 1:24714833-24714855 GGCCTCAGGTCTGAGGGAGGAGG - Intergenic
904094363 1:27965947-27965969 GGCCTCTGGTCTTGGAGGGGAGG + Intronic
904302031 1:29560451-29560473 GGCCTGAGGTTTGTGTGAGCAGG + Intergenic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
904947282 1:34208674-34208696 GGTCTATGGGCTGGCTGAGCTGG + Intronic
905178166 1:36150841-36150863 GGGCTCTTGTCTAGCTGAGCTGG - Intronic
905221341 1:36450220-36450242 GGCTGCGGGTCTGGCTGAGCGGG + Intronic
905250357 1:36644298-36644320 GTCCTCAGGTCTGTGGGAGCTGG - Intergenic
905404136 1:37721879-37721901 GGCCACTGCCCTGGCTGAGCTGG + Intronic
905805979 1:40877907-40877929 GGCCTGTGGGATGGGGGAGCTGG + Intergenic
905867816 1:41385752-41385774 GGCCGCTGGTGTGTGTGCGCAGG + Intergenic
906526689 1:46497561-46497583 GGCCTGTGGGGTGGCTGAGCAGG + Intergenic
906535952 1:46551056-46551078 CGCTGCTGTTCTGGGTGAGCAGG - Exonic
907319779 1:53594972-53594994 GGCCTGGGGTCTAGGTGACCTGG + Exonic
907775721 1:57512630-57512652 GGCCTTTTGTTTGTGTGAGCAGG - Intronic
910058148 1:83056552-83056574 AGCCTCTTGTCTGTGTAAGCTGG + Intergenic
911094005 1:94041166-94041188 GGACCCTGGCCTGGGTGAGAAGG - Intronic
912565757 1:110586080-110586102 GGACTCTGCTCTGGGTAAGGTGG - Intergenic
915088734 1:153406533-153406555 TGACTCTGTTCTGGGTGTGCAGG - Intergenic
915442315 1:155952694-155952716 GGCCCCTGGGCAGGGTGGGCAGG + Exonic
915462253 1:156077059-156077081 GGCCCCACGCCTGGGTGAGCAGG - Exonic
918091266 1:181297214-181297236 GGCCTCTGGACTGTGTAGGCAGG - Intergenic
920113059 1:203600666-203600688 GGCCTCTGGTGGGGGTGAGGTGG - Intergenic
920353141 1:205351012-205351034 GGACTCCGGTGAGGGTGAGCAGG - Intronic
921601529 1:217111332-217111354 GACCTTTTGTTTGGGTGAGCTGG - Intronic
921760987 1:218914839-218914861 GAACTCTGGCCTGGGTGCGCTGG + Intergenic
922481828 1:225944719-225944741 GGCCCCTGTTCTGGTTTAGCAGG + Intergenic
922612063 1:226938150-226938172 GGACTGTGGTCTGGGTCAGTAGG + Intronic
922810552 1:228413348-228413370 GGCCTCTGGGCTGGGGAGGCAGG - Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
923136035 1:231120218-231120240 GGCTTCTGCTCCAGGTGAGCAGG - Intergenic
923683032 1:236134555-236134577 GTTATCTGGTCTGGTTGAGCTGG + Intergenic
923988785 1:239411265-239411287 GGCCTCCTGTCTGGGTTAGGTGG + Intronic
1066180645 10:32958109-32958131 GGCCTCGGGTGTGGGAGCGCGGG - Intronic
1067033915 10:42899001-42899023 GGCCTCTGGCTTAGGTGGGCTGG + Intergenic
1067080579 10:43210171-43210193 GGCCCCTGCTCTGAGTTAGCCGG - Intronic
1067106504 10:43370611-43370633 GGTCTCTGGGCTGGGAGGGCTGG - Intergenic
1067851541 10:49758153-49758175 GGGCTCAGGTGTGGCTGAGCAGG + Intronic
1069121436 10:64574324-64574346 GGCTTCTGGGCTGGGTGACTTGG + Intergenic
1069983445 10:72268137-72268159 GGCCTCTGGAGTTGGTGATCAGG - Intergenic
1071525880 10:86357969-86357991 GGCCTCTTTTCTGCCTGAGCAGG - Intronic
1072710253 10:97711855-97711877 GGCCTTTGGCCTGGCTGAGCAGG - Intergenic
1074162072 10:110843690-110843712 GGCTTCTGGTCTGTGTGAACTGG + Intergenic
1075702053 10:124476179-124476201 GCCTCCTGGTCTGGGTCAGCTGG - Intronic
1076476669 10:130758442-130758464 GGACCCAGGTCTGGGTGACCTGG - Intergenic
1076882254 10:133245278-133245300 GGGATCTGGGCTGGGTGAGCTGG - Intergenic
1076908092 10:133373175-133373197 GGGATCTGGTCTGGGCGTGCAGG + Intronic
1077061934 11:621336-621358 GGCTGCTGGTGCGGGTGAGCAGG - Exonic
1077195220 11:1276459-1276481 GGCCTCTGGCCTGGCTCACCTGG - Exonic
1077239286 11:1502288-1502310 GGCCCCTGGCCTGGGTGGGCTGG - Intergenic
1077253620 11:1571418-1571440 GGCCTCTGGCCTGGGACACCCGG - Intronic
1077298858 11:1838146-1838168 GGCCTCGGGCCTGGGTGAAAAGG + Intergenic
1077397277 11:2331209-2331231 GTCCTCTTACCTGGGTGAGCTGG - Intergenic
1077524832 11:3057725-3057747 GGCCTCGGGACAGGGTGTGCTGG + Intergenic
1077527399 11:3075418-3075440 GGGCACTGGAGTGGGTGAGCAGG + Intergenic
1077612856 11:3655107-3655129 GGCCGCCGGTCTGGCTCAGCTGG + Intronic
1078108723 11:8374814-8374836 GTCCACTGCTCTGGGTGAACAGG - Intergenic
1078555380 11:12321147-12321169 GGGCTCTGTTCTGGGCCAGCAGG - Intronic
1079153947 11:17926712-17926734 GGACTCTGGTCTTGGTGAAACGG - Intronic
1079315108 11:19400912-19400934 GGCAACTGGTAGGGGTGAGCCGG + Intronic
1079387427 11:19993062-19993084 GGCCTATGCTTTGGGTGACCAGG - Intronic
1081678826 11:44987712-44987734 GGCCTTTGGTCTGGTTGGACTGG - Intergenic
1081976410 11:47238170-47238192 GGCCTCTGCAATGGGTGAGTAGG + Exonic
1082948688 11:58788129-58788151 GACTTCTGTTATGGGTGAGCAGG - Intergenic
1083593386 11:63907975-63907997 AGCCTCTGCTCTGGGGGAGGAGG - Intronic
1083644476 11:64164720-64164742 GGCCTCTGGGCTGGGCAGGCAGG - Intronic
1084325536 11:68397697-68397719 GGTCTCTGCTCTGGGAGACCAGG - Intronic
1084653736 11:70503455-70503477 GGCCTCTGGAGCGGGAGAGCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1085523877 11:77153361-77153383 GAGCTCTGGTCTGGATGTGCTGG + Intronic
1089631691 11:119788227-119788249 GGCCTCTGCTTGGGGTGAGATGG + Intergenic
1091650692 12:2306997-2307019 GGGCTCTGGTTTTGGTGAGGGGG - Intronic
1092727393 12:11499332-11499354 AAGCTCTAGTCTGGGTGAGCAGG + Intronic
1094357443 12:29593114-29593136 GGGCTCTCCTCTGGCTGAGCTGG + Intronic
1095329809 12:40945876-40945898 GGACTCTGCTCTGGATTAGCTGG - Intronic
1096189837 12:49609321-49609343 GGCTGCTGATCTGGGTGAGTGGG - Intronic
1097723149 12:63045530-63045552 GGCCTCAGGTGGGGGTGAGTGGG - Intergenic
1097861272 12:64521119-64521141 GGGCCCAGGTCTGGGTGAGGTGG - Intergenic
1098250840 12:68568166-68568188 GGCCTCTCGGCTGGGTGTGGTGG - Intergenic
1098556883 12:71829279-71829301 GCCCTCTAGCCTGGGTGAGAGGG - Intergenic
1098798518 12:74923251-74923273 GGCCTGTTATCTGGGTCAGCTGG - Intergenic
1102212243 12:111136042-111136064 AGCCTTTGCTCTGAGTGAGCTGG + Intronic
1103933660 12:124463833-124463855 GGCCTCTGGTTTGGGGGCGTGGG - Intronic
1104922200 12:132296299-132296321 GTCCGCTGGTCTGAGTGGGCTGG - Intronic
1106322824 13:28658593-28658615 GGCCTCTGGGCTAGAGGAGCAGG - Intergenic
1109309241 13:60672470-60672492 GGCTGCTGGTCTGGGCAAGCAGG + Intergenic
1111825026 13:93257042-93257064 GGCCTCTAGTCCAGGTGATCTGG + Intronic
1112406147 13:99122620-99122642 GCACTCTGGCCTGGGTGAGAGGG - Intergenic
1112656448 13:101456625-101456647 GGGCTCTGGGCTGGGTGTGGTGG + Intronic
1113119762 13:106913729-106913751 GGCTTCTGGTCAGGGTGAATGGG + Intergenic
1113185375 13:107681370-107681392 GGTCACTGGTCTGGTGGAGCTGG + Intronic
1113468587 13:110529423-110529445 GGACTCCGGTCTGGGGGAGAAGG - Intronic
1114445346 14:22783949-22783971 GGCCTCTTGACTGTGGGAGCAGG + Intronic
1116594176 14:46819285-46819307 GGCCTGTGCACTGGGTGAACCGG + Intergenic
1116891873 14:50276639-50276661 GACCTCTTGTCTGTGTGTGCCGG - Intronic
1117742440 14:58832889-58832911 GCCCTCTAGTCTAGGTGTGCAGG - Intergenic
1118333904 14:64835531-64835553 TGACTCTGGGCTGGGTGAGGTGG - Intronic
1119267508 14:73272116-73272138 TGCCTCTGGATTGGGAGAGCAGG - Intronic
1120178992 14:81324178-81324200 GTCCTCTTGTCTGGGTGGGAAGG + Intronic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1121092244 14:91190791-91190813 GGCTTTTGTTCTGGGTGAGATGG + Intronic
1121124709 14:91398802-91398824 GCCCTCTTGTCTGGCTGATCAGG + Intronic
1121581589 14:95036225-95036247 GTCCTCTGGGCTGGGTTAGAAGG - Intergenic
1121730897 14:96186301-96186323 AGCCTCTGGGCTGGATGAGATGG + Intergenic
1121752153 14:96365854-96365876 GGCCTTTACTCTGGGTGAGGTGG + Intronic
1122120968 14:99553218-99553240 GGGCTCTGGCCTGGGTGTTCTGG - Intronic
1122517884 14:102321167-102321189 GGACTTTGGTCTGGGTCAGAAGG + Intronic
1122904264 14:104794895-104794917 GGCCTCTGGGATGGGCGGGCAGG + Intronic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123684642 15:22788078-22788100 GGCCCCAGGACTGGGTGAGATGG + Intronic
1123961119 15:25402251-25402273 GGCCTGGAGTCTGGGTCAGCAGG + Intronic
1124135729 15:27034727-27034749 GGCCTCTGGACTGGATGATTGGG - Intronic
1124254655 15:28130956-28130978 GGCCTCTGCTCTGAGAGGGCTGG - Intronic
1125599193 15:40906433-40906455 GGCCACTGGTCCTGGGGAGCAGG + Intergenic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1128606931 15:69043562-69043584 GTCCTCTGGTCTGGCCAAGCAGG - Intronic
1128736341 15:70056024-70056046 GGCCACTGGGCTGGGAGAGAAGG - Intronic
1129914350 15:79255136-79255158 GGCCTCTGTTAGGGTTGAGCAGG - Intergenic
1130352395 15:83104361-83104383 GGCTTCTGGCTTGGGTGAGTGGG + Intergenic
1130928169 15:88400502-88400524 GGCCTCCAGTCTGGGTGACAGGG - Intergenic
1131662800 15:94536721-94536743 GGCCTCTGCTCTTGGTGATGAGG - Intergenic
1132460708 16:53144-53166 GGCTTTTCGTCTGCGTGAGCTGG + Intronic
1134439834 16:14292708-14292730 AGGCACTGGTCTGGGTGAGTGGG - Intergenic
1135164177 16:20124253-20124275 GGCTTTTTCTCTGGGTGAGCTGG - Intergenic
1136171656 16:28493621-28493643 GCCCTCTCGTCTGGGTGTGGTGG + Exonic
1137797830 16:51237176-51237198 GGACTCCGGTTAGGGTGAGCTGG - Intergenic
1138631191 16:58295426-58295448 GGCCTCTGGTTTGGCAGAGCTGG - Intronic
1139293275 16:65876972-65876994 GGCTTCTGCTCTGGTTGAGGTGG + Intergenic
1139923943 16:70475480-70475502 CGGCTCTGGCCTGGGTGAGCGGG + Exonic
1139958262 16:70703593-70703615 GGCCTCTGGGCTGTGTGTGAAGG - Intronic
1141891684 16:86930412-86930434 CGCCTCTGGTCTGGGTGGGGAGG + Intergenic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142265988 16:89064144-89064166 TGCCTCTGGGCTGCGGGAGCCGG + Intergenic
1142767317 17:2072170-2072192 AGCCTCTGGTGGGGGTGAGGGGG + Intronic
1142896146 17:2980417-2980439 GGCCTCTGGAATGGGGGTGCAGG + Intronic
1143371750 17:6444716-6444738 CGCGTTTGGTCTGGGCGAGCTGG + Intronic
1143513206 17:7406958-7406980 GGCCTCTGGCTTGGGAGAGGGGG - Intronic
1143615197 17:8045479-8045501 GGCCGGGGGTCTGGCTGAGCTGG - Exonic
1144099010 17:11927671-11927693 GGCTTCTCTTCTGGGAGAGCTGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144531109 17:16040075-16040097 GGTCTCTGGGCTGGGTGCGGTGG - Intronic
1144761231 17:17708717-17708739 GGCCTCTGGACAAGGTGAGGGGG + Intronic
1145389639 17:22445499-22445521 GGGCTCTGGGCTGGGTGCTCTGG + Intergenic
1145928758 17:28668666-28668688 GGCATCTGGTCTGCAGGAGCTGG + Intronic
1145978746 17:28999164-28999186 GCCATCTGGGCTGGGTGATCAGG + Intronic
1146842048 17:36163047-36163069 GGCCACGGGTCCAGGTGAGCCGG - Intergenic
1147339361 17:39744684-39744706 GGCCCCTGGCCTGGGGAAGCAGG + Intronic
1147605429 17:41771536-41771558 GGTCTCTGGTCTGAGGGAGGAGG - Intronic
1148486511 17:47994624-47994646 GGGCTCTGGTCTAGTTGAGTGGG + Intergenic
1148698325 17:49574407-49574429 AGCCTCTGGTCTGGCTGGGAGGG - Intergenic
1148733935 17:49853943-49853965 TGTCTGTGGTCTGGGAGAGCAGG + Intergenic
1150083550 17:62262073-62262095 GGCCGCGGGTCCAGGTGAGCTGG - Intergenic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1151557688 17:74854843-74854865 GGCCGCAGATCTGGGTGAGGAGG + Exonic
1152091636 17:78250723-78250745 GCACTCTGGACTGGCTGAGCTGG - Intergenic
1152160662 17:78666668-78666690 GGCCGCTGGTCTGGGAGTGAGGG + Intergenic
1152634217 17:81423849-81423871 GGCCGATGGTCCGGGAGAGCTGG + Intronic
1152690055 17:81713856-81713878 GCCCTCTGGCCTGGGAGGGCGGG + Intronic
1152845936 17:82599815-82599837 GGCCTGTGGTCTGAGAGGGCTGG + Intronic
1153281119 18:3415264-3415286 TGCCTCTGGTTTTGGTAAGCTGG - Intronic
1154163884 18:11999670-11999692 GCCCTCTGGCCTGGGCGAGGGGG - Intronic
1154935920 18:21056679-21056701 GGCTTTTGCTCTGGGTGAGATGG - Intronic
1155963906 18:32018721-32018743 GGCTTCTGGGCTGCGCGAGCTGG + Exonic
1157597110 18:48870692-48870714 GGCCTCTGTGCAGGGAGAGCTGG + Intergenic
1157614615 18:48979085-48979107 GGCCTCTGTGCAGGGAGAGCTGG - Intergenic
1158312810 18:56177116-56177138 GGCCTCAGTTCCGGCTGAGCAGG + Intergenic
1162217667 19:9149722-9149744 GGCCCTTGGTCTGAGTGAGATGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163718319 19:18885482-18885504 GGGCGCTGGGCTGGGTGAGGTGG - Intronic
1164217550 19:23163038-23163060 GGCAACTGGTCTGGGTGCCCTGG + Intergenic
1165158859 19:33804197-33804219 GGCCTCTGTCCTGGGAGAGGCGG + Intronic
1166760947 19:45224272-45224294 GGCATTTGCTCTGCGTGAGCTGG + Intronic
1167334209 19:48874641-48874663 GCCCTCTGGTCCGGGTGGGAGGG - Exonic
1167721399 19:51182702-51182724 GGCGTCTGGGCTGGGCGAGGCGG - Intergenic
1167729212 19:51241078-51241100 GGGGTCTGGGCTGGGTGAGGTGG - Intronic
1167763577 19:51464068-51464090 GGCGTCTGGGCTGGGCGAGGCGG + Intergenic
1168345779 19:55649636-55649658 AGCCTTGAGTCTGGGTGAGCGGG - Intronic
925021496 2:573122-573144 GGCCTCTGGTGTGTCGGAGCAGG - Intergenic
925148620 2:1599821-1599843 GACCCCTGAGCTGGGTGAGCAGG - Intergenic
926794810 2:16610408-16610430 GGCCTCTGGTCAGGGCAAGAGGG + Intronic
927651065 2:24914057-24914079 TGCCCCTGGGCTGGGTGAGGAGG - Intronic
928374054 2:30760773-30760795 GGGCCTTGGTCTGGGGGAGCAGG + Intronic
930064981 2:47321026-47321048 GGGCTCTGGGCTGGTTGGGCTGG - Intergenic
930090801 2:47530128-47530150 GGCCGCTGGCCTGGCTGGGCAGG - Intronic
930091034 2:47531572-47531594 GGCCACTGGGCAGGGTGAGGGGG + Intronic
931913363 2:66926313-66926335 GGAATCTGGGCTGGATGAGCTGG - Intergenic
932081926 2:68723374-68723396 GGCATGTGGTTTGAGTGAGCTGG - Intronic
933407632 2:81881340-81881362 GGCCTCTGGGCTGGGTTCCCAGG + Intergenic
936241473 2:110791907-110791929 GGCTTCAGGTCTGGGTGTGCAGG + Intronic
937100124 2:119262100-119262122 GGCCTGTGGTCTGGGTGACCTGG - Intronic
938241799 2:129748031-129748053 GGCTTCTCATCTGGGTGAGCAGG - Intergenic
938257793 2:129873623-129873645 GGCCTCTGGGTTGGGTGATTAGG - Intergenic
942318640 2:174716955-174716977 GGCCTTTTGCCTGGGAGAGCAGG + Intergenic
944862008 2:203824113-203824135 GGCCTGAGGTCTGGATGAGAGGG + Intergenic
946087223 2:217186250-217186272 GGTCACTGATATGGGTGAGCAGG - Intergenic
946422910 2:219575036-219575058 GGCCTCAGGCCGGGCTGAGCAGG - Exonic
946964886 2:225027210-225027232 GGGGCCTGGTCTGGGTGTGCAGG - Intronic
947797511 2:232904265-232904287 GGTCCCTGGTCTTGGTGGGCTGG - Intronic
948888940 2:240897508-240897530 GGACTCTGGCCTGGGGGAGGTGG + Intergenic
1169077163 20:2768331-2768353 GAACTCAGTTCTGGGTGAGCGGG - Intergenic
1169318492 20:4612074-4612096 GGCCTTGAGTCTAGGTGAGCAGG + Intergenic
1170900535 20:20457982-20458004 GGCCCCTGGTGAGGGTGAGCTGG + Intronic
1171190669 20:23156916-23156938 GGACTGTGGTCAGGGTGACCCGG + Intergenic
1172099170 20:32475241-32475263 GTCCTCTGGGCTGGGGGAGTGGG - Intronic
1172853478 20:37983432-37983454 GGCCTCTGTGGTGGGGGAGCAGG + Exonic
1173603042 20:44309797-44309819 TTCCTCTGGCCTAGGTGAGCTGG - Intronic
1174166022 20:48584058-48584080 GGCTTTTGCTCTGGGTGAGGTGG + Intergenic
1174401241 20:50277106-50277128 GGCTTCTGCTCTGAGTGAGTTGG - Intergenic
1174904523 20:54536638-54536660 GTCCTCTGGCCAGGGAGAGCAGG - Intronic
1175266875 20:57708781-57708803 GGGGTCTGGTCTGGTTGGGCCGG - Intronic
1175424738 20:58856052-58856074 GGCCCTTGGCCTGGGGGAGCGGG + Intronic
1175925814 20:62470842-62470864 GGCCTCTGGTCTTGGCAAGATGG + Intronic
1177662927 21:24110975-24110997 GGCCTATGGGCTGGGTTAGATGG - Intergenic
1179445482 21:41427279-41427301 AGCCCCTGAGCTGGGTGAGCAGG - Exonic
1180086253 21:45509266-45509288 CTCCTCTGGGCTGGGTGAGAGGG - Intronic
1180615086 22:17121283-17121305 AGCCACTGGACTGGGCGAGCCGG + Intronic
1180871609 22:19150016-19150038 GGCCGCCGGGCTGGGTGAGTGGG - Exonic
1181086107 22:20440117-20440139 GGCCTCTGGTCTGCAGGGGCAGG - Intronic
1181782081 22:25200850-25200872 AGGCTCTGGGCTGGGTGACCAGG - Intronic
1182333932 22:29570605-29570627 GGTCACTGGTCTAGGGGAGCAGG - Intronic
1182357173 22:29727466-29727488 GACCTCTGGGCAGGCTGAGCAGG - Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1182712187 22:32330031-32330053 GGGCTCTGGTCTGTGTGTGTTGG + Intergenic
1183323915 22:37181109-37181131 GGCCTGTGTTCTGGGTGTTCAGG - Exonic
1183584197 22:38742720-38742742 GACCTCTGAGCTGGGTGTGCTGG + Intronic
1184688172 22:46105714-46105736 CGACTCTGGTCTGGGCGGGCAGG - Exonic
1184798287 22:46744671-46744693 GGCCTCTGCCCTGGCTGTGCTGG - Intergenic
1185258476 22:49849211-49849233 GGGCGCTGTTCTGGGGGAGCAGG + Intergenic
1185310167 22:50149976-50149998 GGTCCCTGCTCTGGGTGAGCCGG + Intronic
1185316075 22:50179659-50179681 TGGCTCTGGGCTGGGGGAGCTGG - Exonic
949920607 3:8997263-8997285 GGGCATTGGCCTGGGTGAGCAGG - Intronic
954467742 3:50666470-50666492 GGACGCTGGTCTGAGTGTGCAGG + Intergenic
955060012 3:55486153-55486175 GGCCTCCGCTTTGGGAGAGCAGG - Intronic
956750972 3:72343736-72343758 GGTCTTTGCTCTGGGAGAGCAGG + Intergenic
957507165 3:81136826-81136848 GGCCTGTGGTGGGGGTGAGGGGG - Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959531546 3:107439628-107439650 GGCCTTGGTTCTGGGTGAGATGG + Intergenic
961531894 3:127545020-127545042 GAGCTGGGGTCTGGGTGAGCAGG + Intergenic
961664861 3:128488723-128488745 GGCCTCTGGTGAGGGGGAGGCGG + Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
964386829 3:156156317-156156339 GGCTTCTAGTCTGAGTGAGATGG + Intronic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
968501463 4:952072-952094 GGCCGCTAGTCTGAGTGTGCGGG + Intronic
968938692 4:3626731-3626753 GGCTTCTCTTCTGGGTGAGGCGG - Intergenic
969534425 4:7747151-7747173 GCGCTGTGGTCAGGGTGAGCGGG + Intergenic
969713947 4:8859593-8859615 CACCCCTGGTCTGGGTGAGTGGG - Intronic
969905991 4:10396424-10396446 GGCTTCCAGTCTGGCTGAGCAGG + Intergenic
970486314 4:16528473-16528495 GGCCTTTGGTCTGAGAGAGTTGG + Intronic
971424611 4:26503462-26503484 GGGCACTGGGCTGGCTGAGCTGG - Intergenic
973635863 4:52861920-52861942 GGCGTCTGCTCTGGGCGGGCCGG - Intergenic
981526786 4:145714934-145714956 GGCATCTGGTCTGGCTCTGCAGG - Intronic
985213940 4:187628997-187629019 GGCCTGGGGACTGGGTCAGCTGG - Intergenic
986571162 5:9167634-9167656 GGCCTCTGGTCCGGGTGGAGTGG + Intronic
988434566 5:31158855-31158877 GGACTCTGGTGTGGGCTAGCTGG - Intergenic
988828692 5:34967231-34967253 GGTGGCTGGTCTGGGTGGGCTGG + Intergenic
991976062 5:72184627-72184649 CTCCTCTGGCCTGGGTGACCAGG - Intronic
995209803 5:109524723-109524745 GGCCTCTGGATTGTGTGGGCTGG - Intergenic
998022992 5:138787141-138787163 GGGCTCTGGGCTGGGTGCGATGG + Intronic
998869652 5:146539518-146539540 TGCCTCTTGGCTGGGTGAGGTGG + Intergenic
999230959 5:150061527-150061549 GGCCTTTGGTCTGGGCAAGGAGG - Exonic
1000994547 5:167945784-167945806 GCCCTCTGTTCAGGCTGAGCGGG + Intronic
1001403438 5:171460022-171460044 GGCCTCTGTCCTGGGTCTGCAGG + Intergenic
1003541175 6:7019360-7019382 GGACTCTAGTCTGGGTAAACGGG - Intergenic
1004311678 6:14551616-14551638 GGTCTCTGGGCTGGGTGCGATGG + Intergenic
1004426059 6:15507928-15507950 GGCCTCTGAGCAGGGTGAGTAGG - Intronic
1006173039 6:32106381-32106403 AGCCTCTGGTCTGGAAGAGCTGG - Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006445965 6:34079963-34079985 GGCTTTTGTTCTGGGTGAGCTGG - Intronic
1006470721 6:34227242-34227264 GACCTGAGGACTGGGTGAGCAGG + Intergenic
1006673527 6:35745460-35745482 GGGCTTTGGGCTGGGGGAGCAGG + Intronic
1006728267 6:36215686-36215708 GGCCTCAGGCCTGGGTGTGTGGG + Intronic
1007227297 6:40324284-40324306 GGACTCTGGGCTGGGGGAGAGGG - Intergenic
1007258104 6:40542600-40542622 GGCCTCTGAGCTGGGTGGGGTGG + Intronic
1007394424 6:41569588-41569610 GGGGGCTGGTCTGGGTGCGCTGG + Intronic
1007575978 6:42925459-42925481 AGGCTGGGGTCTGGGTGAGCTGG - Exonic
1009949663 6:70380977-70380999 GTCTTCTGTTCTGGGTGAGATGG - Intergenic
1009985674 6:70778863-70778885 GGTCTCTGGGCTGGGTGTGTGGG + Intronic
1011596128 6:89018348-89018370 GGTCTCTGCTCTGGCTGAGACGG - Intergenic
1012676110 6:102115128-102115150 GGCTTCTAGTCTGGGTAAGCAGG + Intergenic
1016335535 6:143001081-143001103 TGCATCTGGCCTGGGTCAGCTGG + Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017398606 6:154032717-154032739 GAACTCTGGACTGGGTGAGGTGG - Intronic
1018948948 6:168365887-168365909 GACCACTGGGCGGGGTGAGCGGG + Intergenic
1018962714 6:168459630-168459652 GGGCCCTGGGGTGGGTGAGCTGG + Intronic
1019061786 6:169262595-169262617 GGCCTCTGTTCCTGGGGAGCGGG - Intergenic
1019341861 7:512232-512254 GGCCACTGCGCTGGGAGAGCGGG + Intronic
1019904253 7:4048643-4048665 TGCCTCTGGCCTGGGAGGGCTGG - Intronic
1021372649 7:19868960-19868982 AGCCTCTGTTCTGAGTGATCAGG + Intergenic
1023577254 7:41641719-41641741 TGCTTCTGGTTTGGGAGAGCAGG + Intergenic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1026522170 7:71127069-71127091 GGCCGCTGGTCTGGGGAAGCGGG - Intergenic
1027223247 7:76227411-76227433 GGTCTCTGGCCTGGGTGACCAGG - Intronic
1027726381 7:81811144-81811166 TGCCTCAGGTCTTGGTGATCTGG - Intergenic
1029351436 7:100015742-100015764 GGCCTCTGGGGTGGGAGGGCGGG + Intronic
1029609003 7:101616678-101616700 GACCAGTGGTCTGGGTGAGGGGG + Intronic
1031971199 7:128066261-128066283 GGCCTGTGCTGTGGGTGAGCTGG - Intronic
1032908929 7:136406937-136406959 AGCCTCTGATTTAGGTGAGCTGG - Intergenic
1033181082 7:139179090-139179112 GTGCTCTGGGCTGGGCGAGCTGG + Intronic
1034070132 7:148176504-148176526 GGGCTCTGGGCTGGGTGTGGTGG - Intronic
1035050738 7:155997870-155997892 GGCCTCTGTTCTGGGGGTGCTGG + Intergenic
1035059963 7:156062032-156062054 GGCCTGTGGTCTGGCTGGACAGG + Intergenic
1035102711 7:156414726-156414748 GGCCTCTGTGCTGGGGGACCTGG + Intergenic
1035159091 7:156938173-156938195 GGCCTCTTGCCTGGGGAAGCAGG + Intergenic
1035162035 7:156958290-156958312 GGTTTCTGGTCTGGGTAACCAGG - Intronic
1035482448 7:159198208-159198230 GACCTCGGGCCTGGGGGAGCTGG + Intergenic
1036658098 8:10690690-10690712 GGAGTCTGGGCTGGGCGAGCCGG - Intronic
1036767013 8:11555709-11555731 GACTTCGGGGCTGGGTGAGCTGG - Intronic
1037931964 8:22886641-22886663 GGCCACTGCTCTGGGGCAGCAGG - Intronic
1038043404 8:23746007-23746029 GGTCTCTGGCCTGGGTAACCGGG + Intergenic
1038312691 8:26456691-26456713 GGAGTCTGGGCTGGGTGAGGTGG + Intronic
1038441742 8:27575422-27575444 GGACTCTGGTCAGGCTGAGAGGG + Intergenic
1041001977 8:53462725-53462747 GGCTTCTGGTCTGGGGGCTCTGG - Intergenic
1043171523 8:76972519-76972541 GGCCGCTGGTTCAGGTGAGCAGG - Intergenic
1043284105 8:78508300-78508322 GGACTCTGATCTGGGTAAACAGG - Intergenic
1043531982 8:81161200-81161222 AGCCTGTGTTCTGGGTGAGGAGG + Intergenic
1043655737 8:82662969-82662991 GGCTGCTGATCTGGATGAGCAGG + Intergenic
1045584217 8:103513150-103513172 GGCAAGTGCTCTGGGTGAGCTGG + Intronic
1048222117 8:132551704-132551726 TACCTCTGGTCTGGGATAGCTGG + Intergenic
1049425094 8:142534394-142534416 GGGCTCTGGCCTGGGGCAGCTGG + Intronic
1049452554 8:142669932-142669954 GGCGGCTGCTCCGGGTGAGCAGG - Exonic
1049497869 8:142945122-142945144 TGCCTCTCCTCTGGGTGGGCAGG - Intergenic
1049526655 8:143130202-143130224 GGCCCCAGGTCTGGGAGAGGTGG - Intergenic
1053584004 9:39436971-39436993 GGCCTGTGCTCTAGGTAAGCAGG + Intergenic
1054105585 9:60995715-60995737 GGCCTGTGCTCTAGGTAAGCAGG + Intergenic
1056154590 9:83821843-83821865 GCACTCTGGTCTGGTTGACCGGG - Intronic
1056155105 9:83826300-83826322 GCACTCTGGTCTGGTTGACCGGG + Intronic
1056969101 9:91187738-91187760 GGCCTCTGTTCCTGGTGGGCAGG - Intergenic
1057110602 9:92467025-92467047 GGCCTCTGTTCTGGGAGAAATGG - Intronic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1060134497 9:121139339-121139361 GGCCTCTTGGCTGGCTGAGATGG + Intronic
1060759659 9:126236457-126236479 GGCCCCGGGCCTGGCTGAGCTGG - Intergenic
1060765285 9:126291144-126291166 GTCCCCTCGTCTGGCTGAGCTGG - Intergenic
1060828684 9:126700649-126700671 GGCCTGGGGACTGGGGGAGCAGG + Exonic
1061213072 9:129204525-129204547 GGCCTCTGATCTGGGGGATGAGG - Intergenic
1062163391 9:135092579-135092601 GGCCTCTGGGCTGTGGGGGCCGG + Intronic
1062636141 9:137492735-137492757 GGGCTATGGGCTGGGTGGGCCGG + Intronic
1185642820 X:1597890-1597912 GGCCTGTTGTCTGGGGGAGCTGG + Intronic
1185731887 X:2468178-2468200 AACCTCTGATCTGGGTGGGCTGG + Intronic
1186527774 X:10265244-10265266 GGTGTCTGGGCTGGGTGAGAAGG - Intergenic
1186770236 X:12811102-12811124 GGCATCGGGTCAGGTTGAGCAGG - Intronic
1193069657 X:77294777-77294799 GGGAACTGGTCTGGGTGACCTGG - Intergenic
1195926044 X:110025752-110025774 GGCCTCTGGTCTCAGTAAGAAGG + Intronic
1201018441 Y:9626866-9626888 GGCCTCTCGTCTGGAGGAGTGGG - Intergenic