ID: 967094720

View in Genome Browser
Species Human (GRCh38)
Location 3:186167929-186167951
Sequence GCAATTGAACTGCAGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967094718_967094720 0 Left 967094718 3:186167906-186167928 CCAAGTTAGGTGTAGAAAATGCT 0: 1
1: 0
2: 0
3: 6
4: 111
Right 967094720 3:186167929-186167951 GCAATTGAACTGCAGGATCAAGG 0: 1
1: 0
2: 0
3: 8
4: 114
967094716_967094720 14 Left 967094716 3:186167892-186167914 CCAAGAGGGAGAAACCAAGTTAG 0: 1
1: 1
2: 2
3: 24
4: 165
Right 967094720 3:186167929-186167951 GCAATTGAACTGCAGGATCAAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967094720 Original CRISPR GCAATTGAACTGCAGGATCA AGG Intronic
901237590 1:7675822-7675844 GTGATGGAACTGCAGGAGCAGGG + Intronic
903287001 1:22283587-22283609 GCAATTGACCAGCAGACTCAAGG - Intergenic
904361811 1:29980159-29980181 GCAAATGAAATGCAGAATAAAGG - Intergenic
905565832 1:38963932-38963954 GCAGTTGAAATGCAGTATCTTGG + Intergenic
906543637 1:46606663-46606685 GCAATGGAACTTCAGGAGCTGGG + Intronic
910115189 1:83724078-83724100 GCAGGTGAATTGCAGGATCTGGG + Intergenic
918506677 1:185262637-185262659 GAAACTGAAGTCCAGGATCAAGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921207892 1:212864870-212864892 GTAGATGAACTGCAGGATCCAGG + Intronic
921264836 1:213413875-213413897 GAAATGGATTTGCAGGATCAGGG + Intergenic
923926991 1:238641105-238641127 GCAAATGAACTGTGGAATCATGG + Intergenic
924029105 1:239868724-239868746 GAGATTGGACTGAAGGATCAGGG - Intronic
1063074007 10:2696146-2696168 GCAATTGATCTCATGGATCAAGG - Intergenic
1063352180 10:5365759-5365781 GCAAGTGAAATGCAGGTTAAGGG + Intronic
1065276057 10:24086843-24086865 GCAGTGGAACTGCTGGGTCAAGG - Intronic
1067019982 10:42786866-42786888 GCAGCTGAACAGCAGGATCATGG + Intronic
1067499608 10:46790664-46790686 GCAGCTGAACAGCAAGATCATGG + Intergenic
1067595020 10:47549660-47549682 GCAGCTGAACAGCAAGATCATGG - Intronic
1067642128 10:48057741-48057763 GCAGCTGAACAGCAAGATCATGG - Intergenic
1068502005 10:57851458-57851480 GAAATAAAACTGCTGGATCATGG - Intergenic
1070139320 10:73726309-73726331 ACAGCTGAACAGCAGGATCATGG - Intergenic
1070483867 10:76911388-76911410 GCAATTGAATTGCAGGCTAGTGG + Intronic
1071430102 10:85600731-85600753 GCAACTAAACTACAGAATCAGGG - Exonic
1072753914 10:98004540-98004562 GAAATGGAACTGCAGGGTCAGGG - Intronic
1073439302 10:103543327-103543349 CCAATAGTACTGCAGGAACAAGG + Intronic
1075487921 10:122841249-122841271 GGGATTGAGTTGCAGGATCATGG + Exonic
1075489745 10:122856525-122856547 GGGATTGAGCTGCAGAATCAGGG - Intronic
1076048646 10:127314891-127314913 GCACTTGGACTCCAAGATCAAGG + Intronic
1078313403 11:10269511-10269533 GAAATGGAACTGCCGGGTCAAGG - Intronic
1079240252 11:18717476-18717498 TAAAGTGAAGTGCAGGATCATGG + Intronic
1079277353 11:19053885-19053907 GGAATGAAATTGCAGGATCAAGG - Intergenic
1091189221 11:133676080-133676102 CCAAATGAACTGAAGGAACATGG + Intergenic
1101792085 12:107936693-107936715 GCACTTGTACAGCAGCATCAGGG - Intergenic
1104415293 12:128592784-128592806 GCCATTTAACTGCAGGGTCCTGG + Intronic
1107086592 13:36432471-36432493 GCAAGTGCACTGGAGGATCGCGG - Exonic
1107313662 13:39107329-39107351 GGAAATGAAATGCAGCATCAGGG - Intergenic
1116442010 14:44964084-44964106 ACAGTTGAACTGCAAGATAATGG + Exonic
1117425882 14:55596384-55596406 GAACTTGAAATGTAGGATCATGG + Intronic
1117755931 14:58973992-58974014 GAATTTGAACTGCAAGATCCAGG - Intergenic
1119166112 14:72495138-72495160 GCAATTAAACTGCAGGAGGGAGG - Exonic
1129937753 15:79464801-79464823 GGGATTGACCTGAAGGATCAAGG - Intronic
1134084914 16:11349672-11349694 GGGGTTGAACAGCAGGATCAGGG + Intronic
1138349233 16:56337765-56337787 GCAGTGGACCTGCAGGCTCAGGG - Intronic
1139743117 16:69052564-69052586 TCAAGTGAACTGAAGAATCAAGG - Intronic
1145169931 17:20647118-20647140 GCAAGTGAGCAGCAGGCTCATGG - Intergenic
1145813694 17:27780832-27780854 GCCATTGGCCTGCAGGACCAGGG + Exonic
1146778771 17:35647740-35647762 GCTATTGAACTGGATGATAAGGG + Intronic
1149983145 17:61327359-61327381 GCAATTGGACTACAGAGTCAAGG + Intronic
1151282960 17:73090123-73090145 GCTCTTGATCTGCAGGCTCAGGG - Intronic
1153760325 18:8324826-8324848 GCCACTGAACTCCAGCATCAAGG + Intronic
1155339344 18:24798341-24798363 GCACATGAACTGGAGCATCATGG + Intergenic
1159420412 18:68211658-68211680 GCAATTCAATTGGAGCATCATGG - Intergenic
1159736493 18:72105450-72105472 GCAATTAATCTGCACGATAATGG + Intergenic
925524093 2:4780599-4780621 GCAAATGGAGTGCAGGAACAAGG - Intergenic
927068917 2:19504788-19504810 TCAGTTGGACTGCAGAATCAAGG - Intergenic
929175511 2:38971506-38971528 GGAAATAACCTGCAGGATCAAGG - Intronic
937761766 2:125612962-125612984 GCAATTTACCTGGAGAATCAGGG + Intergenic
937878676 2:126848758-126848780 GGAGTGGAATTGCAGGATCATGG - Intergenic
1173628228 20:44489639-44489661 GTAATTAAACTGCAGGATGGAGG + Exonic
1174591650 20:51649975-51649997 GCAATTGCACTGCAGAAGCAGGG + Intronic
1175605135 20:60306613-60306635 GAAAATGAACGGCAGGAACAGGG - Intergenic
1177780330 21:25615269-25615291 GCAATGGAACTGCTTGGTCAAGG + Intergenic
1179423268 21:41252746-41252768 GGAATTGGACTGCAGGGACAAGG + Intronic
1180248348 21:46563229-46563251 GCAATGACACTGCAGGCTCAGGG - Intronic
1180885119 22:19237524-19237546 GAAATTAAACTGCTGGGTCAGGG - Intronic
1181341375 22:22182470-22182492 GTGAGTGAGCTGCAGGATCAGGG - Intergenic
957233607 3:77554463-77554485 GTAATTCAACTGAAGGATCTGGG + Intronic
958758582 3:98279428-98279450 GATATTGAACAGAAGGATCAAGG - Intergenic
959426553 3:106196922-106196944 TCAAATTAACTGCAGGATAAAGG - Intergenic
959855886 3:111157554-111157576 GAATTTGAACTGCAAGATGAAGG + Intronic
960910879 3:122648277-122648299 GCAATGGAATTGCTGGGTCAAGG - Intergenic
960989261 3:123300233-123300255 GCAGCTGATCTGCAGGAACACGG + Exonic
961780963 3:129319828-129319850 GGAAATGAACTGCATCATCAGGG - Intergenic
962616448 3:137131402-137131424 GCAATTCAACTGTAGGCTCCCGG + Intergenic
964473205 3:157075904-157075926 GCTTTTGAAGTGCAGGATCGTGG + Intergenic
966875201 3:184317557-184317579 GCAATGGAACTGGAGGGTCAGGG - Intronic
967094720 3:186167929-186167951 GCAATTGAACTGCAGGATCAAGG + Intronic
970592170 4:17569156-17569178 GGAAATGAAATGCAGAATCAGGG - Intergenic
972316356 4:37930000-37930022 GGAATGGAACTGCCGGGTCATGG - Intronic
974912365 4:68138052-68138074 GAAATTGAACAGAAGGTTCAAGG - Intergenic
975100778 4:70510611-70510633 GCAATTGGACTTTAGGATAAGGG + Intergenic
976886901 4:89996311-89996333 GCAAATGAAAAGCAGGATTATGG - Intergenic
978706434 4:111718187-111718209 GCCATAGAACTACAGGATCAGGG + Intergenic
980450844 4:132969471-132969493 GCAATTGAAATGTAGGATGATGG - Intergenic
989090855 5:37729285-37729307 GCAATGGCACTGCAGTAGCAAGG - Intronic
989316570 5:40087122-40087144 GCTATTGAACTGCAGTGTGAAGG - Intergenic
990601277 5:57360865-57360887 TCACTTGAACTGCTGGATCCAGG + Intergenic
994436366 5:99738782-99738804 GTATTTGAACTGAAGAATCATGG + Intergenic
996513506 5:124344213-124344235 ACAATTTAACTGCAGGATATTGG + Intergenic
997366888 5:133331426-133331448 GCCATTGAACTGCAGTCTCCAGG + Intronic
998094779 5:139391004-139391026 GCAACTGAAGTGCAGGCTCTGGG + Exonic
999264197 5:150255833-150255855 ACAATTGAACTGCATGTTCTTGG + Intronic
1000217521 5:159176377-159176399 GCTAGTGAACAGCAGCATCAGGG + Intronic
1003363165 6:5447895-5447917 GCAAGTGGCCTGCAGAATCAGGG + Intronic
1004046897 6:12034504-12034526 CCTATTGAACTGCAGCGTCAGGG - Intronic
1004849668 6:19685674-19685696 CCAATTGAACTGCAGATCCATGG + Intergenic
1008807221 6:55444515-55444537 GCTATTTAACTGCATGATTAAGG + Intronic
1015793531 6:136988065-136988087 GAATTTGTACTGCAGGATGATGG + Intergenic
1016862964 6:148739814-148739836 GAAATTGGACTGCAGAATGATGG - Intergenic
1021579955 7:22141955-22141977 GCAAGTGAACAGCAGGATGAAGG - Intronic
1027504735 7:79002032-79002054 GTAATTGAACTTCAGGAGAAGGG - Intronic
1033425277 7:141238511-141238533 GCAGTTGAACTACAGTATCAGGG + Intronic
1035821866 8:2601579-2601601 GCACTGGGACTGCAAGATCATGG - Intergenic
1035980993 8:4371810-4371832 GCAATTGTAGTGGAGGAACAGGG + Intronic
1037634481 8:20689093-20689115 AGAACTGGACTGCAGGATCAGGG + Intergenic
1041756011 8:61313788-61313810 GCAATTGAACTTGAGAATGAGGG + Intronic
1043520146 8:81036032-81036054 GCAATTTAACTGGGGGAGCAGGG + Intronic
1044176596 8:89132208-89132230 GCACATGAACAGCAGGGTCAGGG + Intergenic
1046420092 8:113970229-113970251 GTGATTGAACAGCAGTATCATGG - Intergenic
1046986846 8:120397749-120397771 TCAAATGAACTGCAGAAACAGGG - Intronic
1051686380 9:19662634-19662656 GCAATGGAACTCCAGGTTTAGGG - Intronic
1058954368 9:109931797-109931819 GCCACTGAACAGGAGGATCAGGG - Intronic
1059866553 9:118521011-118521033 ACAAAAGAACTGCTGGATCAAGG - Intergenic
1060986142 9:127820016-127820038 GCATTTGAAGTGCACCATCACGG - Exonic
1062278314 9:135740918-135740940 CCAAGTGAACTGCAGGGTGAGGG - Intronic
1187061303 X:15789799-15789821 GCGACTCAACTGCAGTATCAGGG - Intergenic
1188329724 X:28854339-28854361 TCAATTGGACTTCAGGATGAAGG + Intronic
1192488922 X:71556716-71556738 GCAAGTGTACTGCAGCAGCAGGG + Exonic
1192499386 X:71639519-71639541 GCAAATGAAATGTAAGATCATGG - Intergenic
1193794279 X:85853988-85854010 GCCATTGAACTCCAGCCTCAGGG + Intergenic
1197530910 X:127625195-127625217 ACAATTGAATAGCAGCATCAAGG + Intergenic
1198728461 X:139701598-139701620 GAAATTGATTTTCAGGATCATGG - Intronic
1200864255 Y:8025871-8025893 GCACTGTAACTGCAGGGTCAAGG - Intergenic