ID: 967096065

View in Genome Browser
Species Human (GRCh38)
Location 3:186178316-186178338
Sequence GCTGTGGGATGGAGCTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967096061_967096065 -8 Left 967096061 3:186178301-186178323 CCAGGACGGAGTTTTGCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG 0: 1
1: 0
2: 1
3: 24
4: 253
967096056_967096065 21 Left 967096056 3:186178272-186178294 CCAACATTCAGGCTGTGCAGAGC 0: 1
1: 0
2: 1
3: 17
4: 158
Right 967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG 0: 1
1: 0
2: 1
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967096065 Original CRISPR GCTGTGGGATGGAGCTTAGG TGG Intronic
900558663 1:3292682-3292704 CCTGTGGGGTGGAGGTTTGGGGG + Intronic
901161054 1:7177065-7177087 TCTGTGGGAAGGAGCCTTGGTGG - Intronic
901240413 1:7689796-7689818 GCTGTGGGATGGAGAAGGGGAGG - Intronic
901952886 1:12762595-12762617 GCTGTGGGATGGAGTGGAGCTGG + Exonic
902081014 1:13820724-13820746 GCTGGGGGCTGGACCTGAGGTGG - Intronic
902465409 1:16614347-16614369 GCTGACGGATGGAGTATAGGAGG - Intergenic
902880368 1:19368255-19368277 GTGGTGGGATGGAGCGCAGGCGG + Intronic
904342209 1:29843920-29843942 GCTGTGGGAGGGAGCTTGTCTGG + Intergenic
908793170 1:67803147-67803169 GATGTAGGATTGAGCTTTGGAGG - Intronic
912008590 1:104932921-104932943 GCTGTGGGAGGCAGCCTAGGAGG + Intergenic
912389571 1:109293261-109293283 TCTGTGGGAGGGAGCTGAGCAGG - Intronic
913611398 1:120512828-120512850 GCTTAGGGATGGAGTGTAGGTGG + Intergenic
913983393 1:143543994-143544016 GCTTAGGGATGGAGCGTAGGTGG - Intergenic
914579794 1:149009411-149009433 GCTTAGGGATGGAGTGTAGGTGG - Intronic
915141343 1:153770504-153770526 GCTCTGGGCTGGGGCTCAGGTGG + Intronic
915520436 1:156439361-156439383 GCTGTGGGCTGTAGCATTGGAGG + Intergenic
916709974 1:167396127-167396149 GCTTAGGGATGGAGTTTATGTGG + Intronic
918125669 1:181581226-181581248 GGTGTGGGATGGAGCTCAGTTGG - Intronic
918612975 1:186513109-186513131 GCTGTGGGGAGGAGCCTAGTTGG + Intergenic
918886719 1:190202605-190202627 GCTGTGGGAGGGACCTCATGGGG + Intronic
919765944 1:201127405-201127427 GCTCTGGGCTGGAGCCTAGGAGG + Intergenic
920254089 1:204642580-204642602 GCTGTGTGGTGGAGCATAGAGGG - Intronic
920433066 1:205931188-205931210 GCTGTGGCTTGGAGCAGAGGAGG + Intronic
920867894 1:209768552-209768574 GCTGTGGGCTGGTGCTTCTGTGG + Intronic
921001006 1:211042941-211042963 CCTGTGGGATGCAGCAAAGGTGG + Intronic
921993660 1:221394586-221394608 GATGAGGGATGGAGCTCATGAGG - Intergenic
922196368 1:223363675-223363697 GCTGGGGGATGGAGGACAGGAGG + Exonic
922211398 1:223489560-223489582 GCTCTGAGATAGAGCTTAGCGGG + Intergenic
922613039 1:226944083-226944105 GCTGGGGGAGGAAGCTGAGGAGG + Intronic
1063342634 10:5282512-5282534 GCTTTGGTCTGGAGCTCAGGGGG - Intergenic
1064229013 10:13513530-13513552 GCTGTGGGAGGGAGGGGAGGAGG - Intronic
1065107311 10:22403279-22403301 GTTGTGGGATGGGGGTTGGGGGG - Intronic
1066065813 10:31760114-31760136 GCTTCGGGGTGGAGCTGAGGGGG + Intergenic
1068611155 10:59061785-59061807 GCTGTGGGAGGAAGCTCAGCAGG + Intergenic
1070289371 10:75104655-75104677 GCTGTGGCATGGAGCTCTGTGGG - Intronic
1070557943 10:77544483-77544505 GCAGTGGGATGGGGCATATGAGG - Intronic
1070763838 10:79045070-79045092 GCTGTGGGAAGGTGGTGAGGAGG + Intergenic
1071130765 10:82390904-82390926 GCTGTGGAATTCAGTTTAGGGGG + Intronic
1072853773 10:98925087-98925109 GCTAGGGGATGGAGGTGAGGTGG + Intronic
1074413539 10:113247693-113247715 GCAGTGGGCTGGAGCACAGGGGG + Intergenic
1074538454 10:114345573-114345595 GCTGTGGGAATGGGCTAAGGAGG + Intronic
1075857510 10:125642588-125642610 AGTGTGGGAGGGAGTTTAGGTGG + Intronic
1076409045 10:130232885-130232907 GCTGTGGGCAGGAGCAGAGGCGG + Intergenic
1076834313 10:133013408-133013430 GCTCTGGGATGGCGTTTAGCAGG + Intergenic
1077148410 11:1056270-1056292 GCTGTGGGAAGCAGCATCGGTGG - Intergenic
1077476968 11:2795098-2795120 GCTGTGGGGTGGAGCTGAGTGGG - Intronic
1081721111 11:45289048-45289070 GCTGAGGGATGGATCTTTGAAGG + Intergenic
1083185944 11:61018027-61018049 GCTATGGGATGGGGGTTTGGGGG - Intronic
1084033281 11:66493404-66493426 GCTGTGGGGTGGAGCACAGTTGG + Intronic
1085151416 11:74255308-74255330 GCTGTGGGATGGAAAAGAGGGGG - Intronic
1087008301 11:93490014-93490036 GCTCTGGGAAGGAGCTTTTGAGG - Intronic
1088164258 11:106913546-106913568 GCTGGGAGATGGGGCTTAGTGGG - Intronic
1089524728 11:119089483-119089505 GCTGGGGGAGGGAGGGTAGGAGG + Intronic
1090024572 11:123156732-123156754 TCTGTGGGATGGAGCAAAGCTGG - Intronic
1090501471 11:127265397-127265419 GATATGGGATGGAGCTGGGGTGG + Intergenic
1090510819 11:127373141-127373163 GCTGTGGGATGTAGACTTGGGGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1092748856 12:11699671-11699693 GCTGTAGGATGGAGGTAAAGAGG + Intronic
1092919549 12:13218875-13218897 TCTGTGGGATGTAGATGAGGTGG + Exonic
1094501567 12:31025867-31025889 GCTCTGGGATACAGCTAAGGCGG + Intergenic
1096421793 12:51464960-51464982 GCTCTGGGAGGGAGCATTGGTGG + Intronic
1101998334 12:109540939-109540961 GCGGTGGGCGGGAGCTGAGGTGG + Intergenic
1103939195 12:124492773-124492795 GCTGTGGGTTGGAGGTGAGCTGG - Intronic
1104859538 12:131917171-131917193 GCTGTGGGATGGGGGTCGGGTGG + Intronic
1104859581 12:131917287-131917309 GCTGTGGGACGGGGGTTGGGGGG + Intronic
1108134209 13:47338178-47338200 GCTGTGTGATGCAGCAGAGGTGG + Intergenic
1109194223 13:59360308-59360330 GCTGTGAGAGGCAGCTTAAGAGG + Intergenic
1110472795 13:75878881-75878903 GCTGTGGGCTAGACTTTAGGTGG + Intronic
1111218286 13:85173185-85173207 GTTGTTAGATGGAGCTTAGATGG + Intergenic
1112338299 13:98532401-98532423 GGTGTGGGATGGGTCTTTGGTGG - Intronic
1112865526 13:103891906-103891928 GACATGGGATGGAGCTCAGGTGG - Intergenic
1113602275 13:111578331-111578353 GCTGTGGGCTGGAGTTGACGGGG + Intergenic
1115667169 14:35563461-35563483 GATGGGGGATGGAGCTGGGGAGG + Intronic
1115931712 14:38504137-38504159 CTTGTGGGAGGGACCTTAGGGGG - Intergenic
1116351348 14:43867747-43867769 GCTGTGTGATGTAGCTTTAGAGG - Intergenic
1116944639 14:50824989-50825011 GCTATGGGATGAAACTTTGGAGG + Intronic
1117927760 14:60802114-60802136 GCTGTGGGATGGATGGTGGGTGG + Intronic
1119188870 14:72664937-72664959 GCTATGGAATGGTACTTAGGCGG + Intronic
1119614914 14:76092533-76092555 GCTGAGGGGTGGGGATTAGGGGG + Intergenic
1120700008 14:87689021-87689043 GATCTGGCATGGAGCTTAGATGG - Intergenic
1122644442 14:103184232-103184254 GCTGTGGGCTGCAGCTTGAGCGG + Intergenic
1123627926 15:22240021-22240043 CCTGAGGGATGGAGGTGAGGTGG - Intergenic
1123977994 15:25570721-25570743 GGTGTGGGTCGGAGATTAGGAGG + Intergenic
1124694024 15:31848328-31848350 GCTGTGGGATTGAGATGAGGGGG + Intronic
1126499134 15:49325192-49325214 GATGAGGGATGGAGATTATGAGG - Intronic
1128063467 15:64749632-64749654 GATGTGGGCTGGAGTTTTGGGGG - Intronic
1129387163 15:75202402-75202424 GCTGGGGGATGGCGTTGAGGAGG + Intronic
1131686987 15:94778896-94778918 GTTGCAGGATGGAGCTTGGGAGG + Intergenic
1134631309 16:15758064-15758086 GCTGTCGGGTGGAGCTTCTGTGG - Intronic
1136481781 16:30546510-30546532 GCTGTGGGGAGGAGGATAGGAGG + Intronic
1137044553 16:35643293-35643315 GGTGCGGGATTGGGCTTAGGTGG - Intergenic
1137898398 16:52238289-52238311 GCAGTGGGATGGGGCTTATAGGG + Intergenic
1139306563 16:65991335-65991357 GCAGGGGCATGGAGGTTAGGTGG - Intergenic
1142742285 17:1938062-1938084 GCTGTGGGGTGGAACTAAGGAGG - Intronic
1143255352 17:5553646-5553668 GCTGTGGCCTGGTGCTCAGGGGG - Intronic
1143697306 17:8630299-8630321 GCTGGGGGATGGAGATCTGGGGG - Intronic
1143924106 17:10354491-10354513 GCTGTGAGGTGGAGCTGAGTAGG + Intronic
1144754276 17:17669811-17669833 GCTGTGGGATGGGGGTGGGGAGG - Intergenic
1145306305 17:21677190-21677212 CCTGGGCGATGGAGCTTTGGCGG - Intergenic
1147241694 17:39094859-39094881 GCTTTGAGATCTAGCTTAGGAGG - Intronic
1147971228 17:44219903-44219925 GCTGTGGGAGGGAGCGGAGCCGG - Intronic
1148784150 17:50137194-50137216 GCTGTTGGAGGGAGCTGTGGGGG - Intronic
1150324941 17:64249334-64249356 ACTGTGGGAAGGAGCTCAGGAGG + Intronic
1150432445 17:65129229-65129251 GCTGTGTGTTGGAGGTTGGGGGG - Intergenic
1151703587 17:75755610-75755632 GCTGAGGGAGGGAGGTCAGGGGG + Intronic
1152819484 17:82429456-82429478 GCTGTGGGAAGGAACTCCGGTGG - Intronic
1153833382 18:8942997-8943019 GCTGTGTTATGGAGCTCAGTGGG - Intergenic
1156361308 18:36386826-36386848 GCTGTGGGGTCTAGCTTGGGGGG + Intronic
1157276061 18:46311868-46311890 GCTGTGGGATGTGGCGGAGGAGG + Intergenic
1158265866 18:55660092-55660114 GTTGTGGGATGGTGCTGAGATGG + Intronic
1158602249 18:58864575-58864597 GCTGTGGGGTGGAGGGGAGGGGG + Intronic
1161393975 19:4035031-4035053 GCTGTGGGGTGGGGCTTTGGAGG + Intronic
1163759856 19:19130307-19130329 GCTGGAGGCTGGAGCTAAGGAGG + Exonic
1166188879 19:41162061-41162083 GCTGTGAGCTGTAGCTGAGGTGG - Intergenic
1166324739 19:42042351-42042373 GCTGTGGGATGGGACAGAGGAGG - Intronic
1166795757 19:45424413-45424435 GCCGTGGGATGGGGGTCAGGGGG + Intronic
925853282 2:8104838-8104860 GGGGTGGGATGGATCTTAGCAGG - Intergenic
926931643 2:18046970-18046992 GCGATGGGGTGGAGCTGAGGAGG + Intronic
927452615 2:23222054-23222076 GCTGTGGGCTGGGGCTCAGCTGG + Intergenic
927489707 2:23512977-23512999 GCTGTGGGATGTGGCTCAGGAGG + Intronic
927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG + Intronic
927668224 2:25046849-25046871 GCTGTGGGATCGCCCTGAGGAGG - Intronic
927893172 2:26764887-26764909 GCTGTGCTTTGAAGCTTAGGTGG + Intronic
928177951 2:29047740-29047762 GCTGTGGAATTGAGTTTGGGTGG + Intronic
929344062 2:40859152-40859174 GCAGTGGCATGTAGCTTGGGGGG + Intergenic
929596725 2:43180658-43180680 GCTTAGGGATGGAGCTGGGGTGG - Intergenic
929666968 2:43840776-43840798 GGAGTGGGATGGAGCTGAGGGGG - Intronic
930931736 2:56892990-56893012 GCTGTGGGGTGGAGGGAAGGGGG - Intergenic
932461843 2:71887280-71887302 GCTGTTGGCTGGACCTTAGCTGG + Intergenic
932574825 2:72956813-72956835 ACTGTGAGATGGAGGTTGGGGGG - Intronic
934859226 2:97749867-97749889 GCAGTGGCAAGGAGCTCAGGAGG + Intergenic
935175077 2:100642289-100642311 CCTGGGGGATGGAGGTTGGGGGG + Intergenic
935224344 2:101040092-101040114 GCTGTGAGATGGAGTGTGGGAGG - Intronic
935853513 2:107248998-107249020 GCTGTGGGATGTAGGTCAGCTGG + Intergenic
937068990 2:119047773-119047795 CCTGTGGGATACAGCTAAGGCGG - Intergenic
937151477 2:119689354-119689376 GATGTGTGAGGGAGCATAGGAGG + Intergenic
937268727 2:120633577-120633599 GCTTTGGGAGAGAGCTGAGGTGG - Intergenic
938168901 2:129057639-129057661 GCCCTGGGATGGAAGTTAGGAGG - Intergenic
939163647 2:138617230-138617252 CCTGTGGCATGGAGGTGAGGAGG - Intergenic
940186095 2:150986160-150986182 GGGGTGGGATGCAGCATAGGGGG - Intergenic
942663849 2:178295557-178295579 GATGGGGGATGGAGGGTAGGTGG - Intronic
942868414 2:180705024-180705046 CCTGTGGGTTGGAGGTTAAGAGG - Intergenic
946013413 2:216584752-216584774 GCTGTAGAGTGGAGCTTGGGTGG + Intergenic
946199668 2:218064478-218064500 GTTGTGGGATGGAGCGAGGGAGG - Intronic
946387779 2:219395712-219395734 GCTTTGTGAAGGAGCTTGGGAGG - Intronic
946511524 2:220362136-220362158 GCTGTTGGATGCAGCTAAAGTGG + Intergenic
947805111 2:232961131-232961153 GATGTGGGATGGTGCTGATGTGG - Intronic
948588552 2:239035866-239035888 GCTGTGGGAGGGGCCTTGGGTGG + Intergenic
948735161 2:239998954-239998976 GCTGTGGGTTGGAGCCTTGGGGG - Intronic
948863035 2:240762087-240762109 GCTGTGGGAGGGAGCTTCGCTGG + Intronic
948869075 2:240789312-240789334 GCTGTGGGAGGGAACACAGGTGG + Exonic
1168765559 20:379972-379994 ACTGTGGGTTGGAGCGGAGGTGG + Intronic
1168922500 20:1552243-1552265 GCTGAGGAATGGAACTGAGGAGG - Intronic
1169752924 20:9013406-9013428 GCTGTGGGCTGGAGCAGCGGGGG - Intergenic
1170959662 20:21013985-21014007 GCTGTGGGCTGGACCTCAGCTGG - Intergenic
1172023754 20:31934313-31934335 ACTGTGGGATGGAGCTGGGGAGG - Intronic
1172175182 20:32967900-32967922 GCTGGGTGATGGAGTTCAGGTGG - Intergenic
1172767956 20:37361119-37361141 GGTGGGTGGTGGAGCTTAGGGGG + Intronic
1173569487 20:44067266-44067288 GGTGGGGGAAGGAGCTGAGGGGG + Intronic
1173881308 20:46414513-46414535 GCAGTGGGGTGGAGGGTAGGGGG + Intronic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1174090771 20:48045131-48045153 GCTGTGGGATGGAAGGGAGGAGG - Intergenic
1176159211 20:63640153-63640175 GCTTTGGGATGGGGCTTCCGTGG + Exonic
1179789906 21:43750210-43750232 GCTGTGGCATGGGCCTTAAGTGG + Intronic
1180138367 21:45875888-45875910 GCTGTGGGCTGGAGCAGTGGGGG - Intronic
1181778718 22:25178101-25178123 GCTTTGGGATGGGGCTTCTGTGG + Intronic
1182002275 22:26929582-26929604 GCTGGGGGAAGGAGCCAAGGGGG - Intergenic
1182287753 22:29258384-29258406 GTTGGGGGAAAGAGCTTAGGAGG - Intronic
1183583763 22:38740384-38740406 GCTCTGTGAAGGAGCTGAGGCGG - Exonic
1184120418 22:42446281-42446303 CCTGTGGGAGGGAGCTGGGGGGG - Intergenic
1184132126 22:42523178-42523200 CCTGTGGGAGGGAGCTGGGGGGG - Intergenic
1184175283 22:42785559-42785581 GCTGTGGGATGGAGGTTGGAGGG - Intergenic
1184923408 22:47621415-47621437 GCTGTGGGATGGAGCTGCATGGG - Intergenic
1185016023 22:48343023-48343045 GCTGTGAGGTGGAGGTTAGCAGG - Intergenic
952490335 3:33865243-33865265 GCTGGGGGCTGGGGCTTAGTAGG - Exonic
953107016 3:39892262-39892284 GTTGTGGGATGGAGATGAGTAGG + Intronic
954417818 3:50402641-50402663 CCTGTGGGATGGGGCTGAGCAGG - Intronic
954486541 3:50858274-50858296 GTTGTGGGATGGGGGTCAGGGGG + Intronic
954646633 3:52135650-52135672 GCTGTGGTATGGAGGTGAGCTGG + Intronic
956581428 3:70818415-70818437 GATGGGGGGTGGAGCTCAGGTGG - Intergenic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
959262791 3:104102854-104102876 GCTGTGGGATTAAGCCAAGGGGG + Intergenic
959417092 3:106088554-106088576 GATGGGAGATGGAGCTTAGGTGG + Intergenic
960213009 3:114993738-114993760 CCTGTGGGATGCAGCTAAAGTGG + Intronic
962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG + Intronic
964823199 3:160796288-160796310 GCAGAGGGCTGGAGGTTAGGTGG + Intronic
965045352 3:163571272-163571294 GCTGTGGGAGGGACCCAAGGGGG + Intergenic
965502912 3:169477916-169477938 GCTGTGGCATGTAGCTTCTGTGG - Intronic
967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG + Intronic
968598248 4:1496325-1496347 GCGGTGGGGTGGAGCTGGGGGGG - Intergenic
968949757 4:3684364-3684386 GTGGTGGGATGGAGGGTAGGGGG - Intergenic
969642827 4:8409439-8409461 GCTGTGGGATATACCATAGGCGG + Intronic
969897690 4:10320610-10320632 GTTGTGGGGTGGAGGTTATGAGG + Intergenic
971170193 4:24225836-24225858 CCTGTTGACTGGAGCTTAGGTGG + Intergenic
971254874 4:25005129-25005151 GCTGTGGGATGGGGCAAATGAGG + Intronic
971384698 4:26132411-26132433 GCTCTGGAAGGGAGCTCAGGTGG - Intergenic
974979225 4:68933424-68933446 CCTGTGGGATGGAACATAGAAGG - Intronic
975369612 4:73569107-73569129 GCTGGGGGATGGAGGATGGGTGG + Intergenic
976122745 4:81800920-81800942 GATCTGAGATGGAGCTGAGGTGG - Intronic
976178950 4:82381198-82381220 GCTGTGGGTGGGAGCTAAAGGGG - Intergenic
977726820 4:100305724-100305746 GCAGTGGGATGTAGCTCCGGTGG + Intergenic
981865023 4:149407165-149407187 GCTGTGGGAGGGACCTGGGGGGG - Intergenic
983251882 4:165354757-165354779 GCTGGGGGTTGGGGCTTAGGAGG + Intergenic
985284038 4:188316200-188316222 GCTGTGGGATGCCATTTAGGAGG + Intergenic
985706967 5:1406942-1406964 GATGTGGGCCGCAGCTTAGGTGG - Intronic
987043014 5:14080512-14080534 GGTGTGGGGTGGGGATTAGGCGG - Intergenic
987241565 5:16005402-16005424 GCTGTGTGATGCAGGTAAGGAGG + Intergenic
990637761 5:57748543-57748565 GGTGTGGGGTGGAGATTGGGGGG + Intergenic
990831444 5:59963316-59963338 TCTGTGGAATGAAGCTTTGGGGG - Intronic
991124970 5:63059988-63060010 GCTGTGGAAAGGGGCTGAGGAGG + Intergenic
992531927 5:77660181-77660203 GCTGTGGGATGGGGCAGGGGTGG + Intergenic
992778752 5:80109840-80109862 GCTGGGGGAGGGAGCCTGGGAGG - Intergenic
993250090 5:85510777-85510799 GCTCTGGGATGCAGCAAAGGTGG - Intergenic
993622638 5:90186884-90186906 GCTCTGGGAAGGAATTTAGGAGG + Intergenic
995861599 5:116646896-116646918 GATCTGAGATGGAGCTGAGGTGG - Intergenic
998624330 5:143828489-143828511 TGTGTGGGATGTAGCTTAGAAGG - Intergenic
999228875 5:150049724-150049746 GTTGTGGAATGGTGCTTGGGGGG + Intronic
999241206 5:150128481-150128503 GCTATGGGATGGAGCTACAGGGG - Intronic
1002097738 5:176841393-176841415 GCTGTGAGATGCAGCATAGCAGG + Intronic
1002178174 5:177414301-177414323 GCGGTGGCATGGATATTAGGTGG + Intronic
1002831911 6:830147-830169 TGTGTGGGATGGAGCTAAGCAGG + Intergenic
1003107904 6:3229310-3229332 GCTGTGGGGTGGAGGGTGGGGGG + Intronic
1003425763 6:5997249-5997271 GCTGTGGGAGGAAGCTGCGGGGG - Intergenic
1003865028 6:10355160-10355182 GCTGTGGGATGGAACTTCCGGGG - Intergenic
1006217710 6:32459636-32459658 GCTGTGGGAGGGAACACAGGAGG - Intergenic
1007221640 6:40283557-40283579 GCTTTTGGATGCAGCTTAGCTGG + Intergenic
1015816068 6:137212108-137212130 GCTGTGTGATCTAGCTCAGGAGG - Intronic
1017005435 6:150025360-150025382 GCTGGTGGATGGAGCCTAAGCGG - Intronic
1017032750 6:150238513-150238535 GCTGTGGGAGGCAGCATGGGAGG + Intronic
1018596281 6:165484537-165484559 GATCTGAGATGGAGCTGAGGTGG + Intronic
1019276647 7:179430-179452 TCCTTGGGAAGGAGCTTAGGCGG + Intergenic
1019477230 7:1249787-1249809 GCTGTGGGAGGAAGCGGAGGGGG - Intergenic
1019923057 7:4174900-4174922 TCTGTTGGATGGAGGTTAGAGGG + Intronic
1022100942 7:27168791-27168813 GCTTTGGGAAGGAGATAAGGAGG + Intronic
1022528101 7:31051340-31051362 GCTGTGGGATGGGGGCTGGGTGG + Intergenic
1023597857 7:41851684-41851706 GCTGTAGGAGGAAGCTTAGGAGG - Intergenic
1025284242 7:57649594-57649616 CCTGGGCGATGGAGCTTTGGTGG - Intergenic
1026411477 7:70127379-70127401 GCTTTGGGAGGGGGCTGAGGAGG - Intronic
1028086870 7:86646012-86646034 GGGGTGGGAGGGAGTTTAGGGGG + Intronic
1029206755 7:98873907-98873929 GCTATGGGATGGAGCAGAGATGG - Intergenic
1029232188 7:99079382-99079404 GCTGTGGGGAGGAGCTGGGGAGG - Intronic
1030624475 7:111829467-111829489 GCTGTGGGATGGGGTTGAGGAGG + Intronic
1033232249 7:139609186-139609208 GCTGTGGCATGGGGCTTGGGAGG + Intronic
1034470876 7:151253760-151253782 GCTGTGGGATGGTGTTTACATGG + Intronic
1036295722 8:7535367-7535389 GCTGTGGAATAGAGCTTTTGTGG + Intergenic
1036326845 8:7785653-7785675 GCTGTGGAATAGAGCTTTTGTGG - Intergenic
1036615675 8:10385586-10385608 TCTGTGGTAAGGAGATTAGGAGG + Intronic
1036769025 8:11566093-11566115 CCTGTGGGGTGGGGCTGAGGAGG + Intergenic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1037855213 8:22366987-22367009 GGTGTGGGGTGGAGGCTAGGCGG + Intergenic
1040913408 8:52543963-52543985 GCTATGGGGTGGAGATGAGGAGG - Intronic
1041405693 8:57496929-57496951 GGTGTGAGATGAAGCTTAGCAGG - Intergenic
1041900349 8:62975845-62975867 TCTCTGGGATAGAGCTTAGAGGG - Intronic
1044549695 8:93498025-93498047 TCTGTGGGTTGAAGCCTAGGTGG - Intergenic
1047169938 8:122483026-122483048 GATTTGTGATGAAGCTTAGGGGG + Intergenic
1048580958 8:135729467-135729489 GCTGTGGGGTGGAGCCAGGGTGG + Intergenic
1049262458 8:141646859-141646881 GGTGTGGGATGGATAGTAGGGGG - Intergenic
1049295244 8:141829791-141829813 ACTGTGGGAATGAACTTAGGAGG + Intergenic
1050123937 9:2337059-2337081 GCTGTGGCTTGTAGCATAGGAGG + Intergenic
1057581545 9:96291434-96291456 GCTGTGGGAGGGAGAGGAGGGGG - Intronic
1060183945 9:121552512-121552534 GCTGTGATATGGGGCTCAGGAGG - Intergenic
1061093005 9:128437196-128437218 GCTGGGGGAGGGTGCTGAGGTGG - Exonic
1061392487 9:130325597-130325619 GCAGTGGGATGGATTCTAGGTGG - Intronic
1062137862 9:134939132-134939154 GCCGTGAGATGGAGCATAAGGGG + Intergenic
1062255594 9:135619290-135619312 GCTGCGGGCAGGAGCTCAGGGGG - Intergenic
1062267192 9:135692582-135692604 GCCGTGGGCAGGAGGTTAGGAGG - Intergenic
1062359210 9:136179506-136179528 ACTGGGGTATGGAGGTTAGGGGG - Intergenic
1185458590 X:323031-323053 GGTGTGGGATGGACCTTCTGTGG + Intergenic
1186511870 X:10135548-10135570 ACTGTGGGAGGGGGCCTAGGTGG + Intronic
1188112514 X:26208811-26208833 GTTGGGAGATGGAGCTTAGGGGG + Intergenic
1188533462 X:31168055-31168077 GCAGTGTGATGGAGGATAGGTGG + Intronic
1189259745 X:39669933-39669955 GTAGTGGGATGGGGCTTGGGAGG - Intergenic
1190286051 X:48962161-48962183 GCTGGGATATGGAGCTTTGGAGG - Exonic
1190745493 X:53319937-53319959 GGTAAGGGATGGAGCTGAGGCGG + Intronic
1192849181 X:74935996-74936018 GTTATGGGATGGAGCTCAGGTGG + Intergenic
1196070269 X:111513180-111513202 GATGTGGGATGGAGATAAGATGG - Intergenic
1198278248 X:135117693-135117715 GCTGTGAGGTGGAGAATAGGTGG - Intergenic
1198292714 X:135254823-135254845 GCTGTGAGGTGGAGAATAGGTGG + Intronic
1199302351 X:146228068-146228090 GTTGTGGGATGGGGGTTTGGGGG - Intergenic