ID: 967097217

View in Genome Browser
Species Human (GRCh38)
Location 3:186186961-186186983
Sequence CAGAAAGAATAGTTGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967097214_967097217 -9 Left 967097214 3:186186947-186186969 CCAGTTGTTCCAGACAGAAAGAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG 0: 1
1: 0
2: 2
3: 17
4: 259
967097210_967097217 20 Left 967097210 3:186186918-186186940 CCCAGCTGGTGGCCTCTAAAGCA 0: 1
1: 0
2: 0
3: 18
4: 149
Right 967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG 0: 1
1: 0
2: 2
3: 17
4: 259
967097211_967097217 19 Left 967097211 3:186186919-186186941 CCAGCTGGTGGCCTCTAAAGCAT 0: 1
1: 0
2: 1
3: 10
4: 114
Right 967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG 0: 1
1: 0
2: 2
3: 17
4: 259
967097213_967097217 -8 Left 967097213 3:186186946-186186968 CCCAGTTGTTCCAGACAGAAAGA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG 0: 1
1: 0
2: 2
3: 17
4: 259
967097212_967097217 8 Left 967097212 3:186186930-186186952 CCTCTAAAGCATACTACCCAGTT 0: 1
1: 0
2: 0
3: 12
4: 65
Right 967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG 0: 1
1: 0
2: 2
3: 17
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967097217 Original CRISPR CAGAAAGAATAGTTGGTTCA TGG Intronic
902973667 1:20073234-20073256 CAGAAAGGAAGGTTAGTTCATGG + Intronic
903866586 1:26403142-26403164 CTGAAAGAGTGGTTGCTTCATGG + Intergenic
904174106 1:28613782-28613804 CAGAGAGACTAATTTGTTCATGG + Intronic
904229208 1:29053536-29053558 TAAAAATAATAGTTGGGTCAAGG - Intronic
904659145 1:32071862-32071884 CAGAGGGAATAGTTAGTGCAAGG - Intergenic
905288726 1:36906764-36906786 CAGAATGAAGAGATGTTTCATGG + Intronic
909267131 1:73575105-73575127 CTGAAATAGTAGTTAGTTCAAGG - Intergenic
911359514 1:96859362-96859384 CAAAATGAAAAGTTGGTTCTTGG - Intergenic
911367683 1:96958899-96958921 GAGGAAGAATAGTTTGTCCAAGG + Intergenic
912194543 1:107382034-107382056 CTGACACAATGGTTGGTTCAAGG - Intronic
912262111 1:108120966-108120988 CACAAAAAAGACTTGGTTCAAGG + Intergenic
916434998 1:164769653-164769675 CAGTAATAAAAGTTGGCTCAAGG - Intronic
916601187 1:166295022-166295044 CAAAAAGAATGTTTGGTTAAAGG - Intergenic
917240744 1:172945788-172945810 CAGACAGAATAATTGCTTAAAGG + Intergenic
917700489 1:177575719-177575741 AAAAAAGAAAACTTGGTTCAGGG + Intergenic
917836292 1:178944000-178944022 CAGAAAGAATTATTGCTTGAGGG + Intergenic
918550131 1:185733376-185733398 CATAAAGAATCCTTAGTTCATGG + Intergenic
919401721 1:197126724-197126746 CAGAAAGAAAAGAATGTTCATGG + Intronic
919479134 1:198064731-198064753 CAGAGAGAGTAGTAGGTTCAAGG + Intergenic
919598700 1:199595994-199596016 AAGAAAGAGAAGTTGGTTAAGGG + Intergenic
919698906 1:200610989-200611011 CAGGAAGAATTGTTGATTTAAGG - Intronic
920679436 1:208061089-208061111 CAGAAAGAATACTAGACTCAAGG + Intronic
920919031 1:210282805-210282827 AAGAATGAGTAGATGGTTCAGGG - Intergenic
1064242071 10:13639959-13639981 CTGAAGGAATAGTGGGTTCCAGG + Intronic
1064734625 10:18369278-18369300 CACAAACAATATTTGATTCACGG - Intronic
1067159032 10:43807331-43807353 CAGAAACATTAGTTGGAGCACGG + Intergenic
1067800897 10:49359055-49359077 AAGAAAGAATAGTTGATTTGGGG + Intergenic
1068542448 10:58310516-58310538 CACAAAGAATAAATGCTTCAGGG + Intergenic
1068917908 10:62452562-62452584 CAGATAGAATTGTTGCTCCAGGG - Intronic
1069284646 10:66697928-66697950 CTAAAAGAATAAATGGTTCAGGG - Intronic
1069523099 10:69141840-69141862 CAGAAGGAATACCTGGGTCATGG - Intronic
1071611989 10:87040063-87040085 CAAAACAAAAAGTTGGTTCATGG - Intergenic
1071730906 10:88247495-88247517 CAGAGAGAATAGCTGGCCCAAGG - Intergenic
1072604976 10:96973259-96973281 TGGAAAGAAAAGTTTGTTCAGGG + Intronic
1073193990 10:101673074-101673096 CAGAAAGAATAATTGGTTCTTGG - Intronic
1076264105 10:129095640-129095662 CAGAATGAATTTTTGGTTAAAGG + Intergenic
1078302621 11:10148233-10148255 GAGAGAGAATACTTGGTACATGG + Intronic
1078982105 11:16547647-16547669 CAGAATGAGAAGTTGGTTAATGG + Intronic
1081148099 11:39589439-39589461 CAGAATGAAAAGTTGGTGTAGGG + Intergenic
1081305133 11:41502570-41502592 CAGAAAGAAAAGTGGGTTACAGG - Intergenic
1085891070 11:80579954-80579976 TAAAAGTAATAGTTGGTTCATGG - Intergenic
1086872676 11:92057663-92057685 CAGAAAGAATATCTGGTACAAGG + Intergenic
1088901821 11:114123973-114123995 CAGAAATAATAAGTGGTTCATGG - Intronic
1089466970 11:118691754-118691776 CAGAGAGAATATTAGGGTCAGGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1092729177 12:11512362-11512384 CAGAAAGAATAAATGATTCTAGG + Intergenic
1095550035 12:43425285-43425307 CAGAAAGAATAGCTAGCTAATGG + Intronic
1097002248 12:55886849-55886871 CAGATAGAATAGTGGGTTTTGGG + Intergenic
1097574835 12:61379248-61379270 TAGAAAAAATAGTTGATTCAGGG + Intergenic
1100250291 12:92814244-92814266 CAGAAATAATAGTTACATCAAGG + Intronic
1101583150 12:106061778-106061800 CAGAAAGAATAGCCTGTGCATGG - Intergenic
1101622963 12:106407922-106407944 AAGTCAGAATAGATGGTTCAGGG + Intronic
1106123693 13:26882816-26882838 CAGAGAGAATGGTGGGTCCAGGG - Intergenic
1106683247 13:32030057-32030079 CAGATATAATAATTGTTTCAAGG + Intergenic
1106771474 13:32964908-32964930 CAGAAAGAATGGTAGTTTCCAGG - Intergenic
1107418714 13:40225274-40225296 GAGAAAGAATAGTTAGTTAGTGG + Intergenic
1109998903 13:70168488-70168510 GATAAAGAGAAGTTGGTTCATGG - Intergenic
1111359065 13:87150200-87150222 CAGAAAGGAGAGTAGGCTCAAGG - Intergenic
1112245189 13:97726945-97726967 CAGAATGAATAATTTGTTAAGGG - Intergenic
1112940857 13:104860269-104860291 AAGAAAGCAAGGTTGGTTCAAGG + Intergenic
1113358575 13:109607142-109607164 CAGAAAAAATATTTGGTACTAGG - Intergenic
1114580505 14:23754248-23754270 TAGAAAAAATGGTTGGTTCCAGG + Intergenic
1115838197 14:37433854-37433876 CATAAAGAAGAGTGAGTTCAGGG - Intronic
1116558107 14:46338878-46338900 GAGAAAGTATGGTTGGTTTAGGG - Intergenic
1117562230 14:56952540-56952562 TAAAAGGAAAAGTTGGTTCAAGG + Intergenic
1117599061 14:57354907-57354929 CAGAAAGATTAGTGGTTGCAAGG + Intergenic
1117632236 14:57705926-57705948 CAGAAAGAACAATGTGTTCAGGG + Intronic
1118919340 14:70135766-70135788 CATAAAGAAAAGTTGGTTAATGG + Intronic
1120115850 14:80616959-80616981 CAGAAAGAATCATTGGCTTATGG - Intronic
1122414032 14:101540274-101540296 CAGAATGAATAGACGCTTCAAGG - Intergenic
1122669055 14:103355907-103355929 CAGAATGTCTAGATGGTTCAGGG + Intergenic
1126303631 15:47228873-47228895 CAGAGAGAATAATTTATTCATGG - Intronic
1126400599 15:48265456-48265478 AAGAAAGAATATTTTATTCAAGG - Intronic
1127281166 15:57494600-57494622 CAGAAAGAACAGAAAGTTCATGG - Intronic
1127643683 15:60939248-60939270 CTGAAAGAATGCCTGGTTCATGG - Intronic
1127689009 15:61376357-61376379 CAAATAGAATAGTAGGGTCAGGG + Intergenic
1127810010 15:62557531-62557553 AAGAAAGAATAGTTGTGACAAGG - Intronic
1129803640 15:78436738-78436760 CAAAAGGAATAGTAGGTTTAAGG + Intergenic
1130035425 15:80356504-80356526 CAGTATGAATAGTTGATTTATGG - Intronic
1130123536 15:81072944-81072966 CAGAAAGAAGATTTGGACCAAGG - Intronic
1130617199 15:85422119-85422141 CAGACATACTAGTTGGTACATGG - Intronic
1131484390 15:92808372-92808394 CAGCAAGAGTAATTTGTTCATGG - Intronic
1131642516 15:94307650-94307672 CAGAAGGAATCGTTGGCACACGG + Intronic
1135172318 16:20196417-20196439 AAAAAGGAATAGTTGGGTCAGGG + Intergenic
1135899952 16:26448131-26448153 CATAAACAATAGTGGGTGCATGG - Intergenic
1135923490 16:26672151-26672173 CAGAAAGAATAATGCGTCCAGGG - Intergenic
1136015119 16:27392682-27392704 CAGAAAGAATATTTGAATAAAGG + Intergenic
1136998157 16:35205467-35205489 GAGAAAGAACAGTGGGTCCAGGG - Intergenic
1139309549 16:66016958-66016980 CTGAATGAATAGTTGGTGCATGG + Intergenic
1139322208 16:66124231-66124253 CAGAGAGAACAATTGGTTAATGG + Intergenic
1141858925 16:86703507-86703529 CAGAAAGAATGGTGGGTGCCAGG + Intergenic
1143839112 17:9717514-9717536 GAGAAAAAATAGTTGATTCCTGG + Intronic
1146066181 17:29637423-29637445 AAGGAAGAATTGTTGGTTAAAGG - Intronic
1146505980 17:33405829-33405851 CAGAAACAGAAGATGGTTCAGGG - Intronic
1147908596 17:43840494-43840516 CAGTAAGAATAGTTGTGTTAAGG + Intergenic
1148524123 17:48313473-48313495 TTGAAGGAATAGTGGGTTCAGGG - Intronic
1148801859 17:50232698-50232720 CACAAAGAAAAGTTAGTTCTAGG - Intergenic
1149370623 17:55990622-55990644 CACAAAGAACAGTTGGTACCAGG + Intergenic
1151059361 17:71073289-71073311 CAGAGAGAGTAGATGGTTTAGGG + Intergenic
1151097089 17:71510688-71510710 CAGAAAGAAGAGATAGTGCAAGG + Intergenic
1152776157 17:82203328-82203350 AAGAAAGATTAATTGGCTCACGG - Intronic
1152866809 17:82728990-82729012 AAGAAACAATAGTTGGGTCAGGG - Intronic
1153062991 18:1013295-1013317 AAGAAAAAATACGTGGTTCATGG - Intergenic
1153385816 18:4494183-4494205 CATAAAGAATAGTTTCATCATGG + Intergenic
1154530852 18:15343841-15343863 GAGAAAGAAAAGTGGGTCCAGGG + Intergenic
1155289723 18:24328615-24328637 CAGAGAGAATAGTATGTGCAAGG + Intronic
1155667287 18:28326706-28326728 AAGAAAGAATAATTGCTTGATGG + Intergenic
1155916734 18:31564863-31564885 CAGAGAGAACAGGTGGCTCAGGG + Intergenic
1156727835 18:40150441-40150463 CAGAAAGAATATTTGTTTACTGG + Intergenic
1157619123 18:49005783-49005805 CAGAAAGAAAGGTTGGTTCATGG - Intergenic
1157711538 18:49853102-49853124 CAGAAGCAACAGTTAGTTCAGGG + Intronic
1159730884 18:72026047-72026069 CAGAAAGAATAAATGTTTGAGGG - Intergenic
1163356543 19:16815649-16815671 CAGATATAATAATTGGTTTAGGG - Exonic
1165621558 19:37252488-37252510 CAGAAAGAAAAGTGGGCCCAGGG + Intergenic
1166016721 19:39986189-39986211 CAAAATGAAAAGTTGGTTCTTGG + Intronic
1167036481 19:46998123-46998145 AGAAAAGAATACTTGGTTCAGGG + Intronic
1167818669 19:51906547-51906569 GAGAAAGAAAAGTGGGTCCAGGG - Intronic
1168614906 19:57829840-57829862 GAGAAAGAATAGTGGGCCCAGGG - Intronic
925195091 2:1916467-1916489 CAGCTAGAATTGATGGTTCAGGG - Intronic
925256007 2:2488934-2488956 CAGAAAGAATAGTTTCTCAAAGG - Intergenic
927717566 2:25362317-25362339 CAGAAAGAACATTTGGGGCATGG + Intergenic
928944225 2:36757922-36757944 CAGAAAGAATAGCAGGGTCTAGG - Intronic
929277185 2:40038680-40038702 CAGAAAGAGTAATTGGCTCCCGG - Intergenic
931410982 2:62031174-62031196 CTTAAGGAATAGTTGGTTAAGGG - Intronic
932079273 2:68696733-68696755 CAGAGAGAATAGCTGGTAAACGG + Intronic
933105079 2:78314396-78314418 CAGAAAGAAAAGTTGTTTATGGG - Intergenic
933119281 2:78516062-78516084 GAGAAAGAATGGTTTCTTCAAGG + Intergenic
935023468 2:99254068-99254090 TAGAAATAATAGTTGATTAATGG + Intronic
936170232 2:110164462-110164484 CAAAAAGAATAGATAATTCATGG - Intronic
937635225 2:124147992-124148014 CAGAAGGAATGTTTGGTTGATGG + Intronic
937683995 2:124676150-124676172 CTGAAAGACTTATTGGTTCAGGG - Intronic
938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG + Intergenic
939701806 2:145401455-145401477 CAGACAGATGAGTTGATTCATGG - Intergenic
940029896 2:149250698-149250720 CAGAAAGAATGGTAGTTGCAAGG - Intergenic
941413286 2:165186997-165187019 CAGAAAGACTAAATGGATCAAGG - Intronic
941949131 2:171135049-171135071 CAGAAAGAATAGTGGTTACCAGG + Intronic
942121197 2:172779428-172779450 CAGAAGGAATAGTTGTTGCAAGG + Intronic
942383310 2:175416257-175416279 GATAAAGAAGGGTTGGTTCATGG - Intergenic
943073187 2:183165693-183165715 CAGAAAGAATAGTGGTTGCTAGG - Intergenic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
945470222 2:210220543-210220565 CAGAAAACATAGTATGTTCAGGG - Intronic
948549459 2:238760116-238760138 CAGAAAGAATAGGAGGTGAAGGG + Intergenic
1174569324 20:51490285-51490307 CAGAGAAATTAGTTTGTTCAAGG + Intronic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1177290451 21:19104212-19104234 GAGAAAGAACAGTGGGCTCAGGG - Intergenic
1178058962 21:28830905-28830927 CAGAAAGAATAGAAGGTGAAAGG + Intergenic
1178318410 21:31586194-31586216 AAGAAAGAACAGTTGGTGGAAGG - Intergenic
1180516452 22:16149122-16149144 GAGGAAGAATAGTGGGGTCAGGG + Intergenic
1182019057 22:27065618-27065640 CAGAATGAATAATTGGCTCTGGG - Intergenic
1182793825 22:32975995-32976017 CAGAAAGAATTGTGGGTTGAAGG + Intronic
1183068263 22:35378647-35378669 CTGAATGAATAGATGCTTCAAGG - Intergenic
1184962550 22:47941994-47942016 CAGAAAGGATGGCTGGTTTAAGG + Intergenic
950082997 3:10236710-10236732 CTGAAAGAATAATTGGTTGAAGG - Intronic
951019677 3:17768640-17768662 CACAAAAAATAGATGCTTCAGGG + Intronic
951765692 3:26195868-26195890 GAGAAAAAATAATTTGTTCAAGG + Intergenic
952567813 3:34679976-34679998 CAGAAAGAAAAACTGTTTCAGGG + Intergenic
952813039 3:37422249-37422271 CAGAAAAAATAGGATGTTCAAGG - Intronic
953087829 3:39689399-39689421 CACAAAGAATAAATGGTTGAGGG + Intergenic
957698152 3:83671297-83671319 CAGAATGATTAATTTGTTCACGG + Intergenic
957731749 3:84147710-84147732 CAAATAGTATAGTGGGTTCAAGG - Intergenic
959831401 3:110867250-110867272 CATAAGGAAGAGTTGCTTCAAGG - Intergenic
963300608 3:143593170-143593192 CAGAAGGAGGAGTTGGTACAAGG + Intronic
963627841 3:147695418-147695440 GAGACAGAATAGTGAGTTCATGG + Intergenic
964728718 3:159842664-159842686 CAGAAGGAATAGCAGGTGCAGGG - Intronic
965410153 3:168320248-168320270 CAGAAAGAATGTTTGGTCAAAGG + Intergenic
966442294 3:179959165-179959187 CTCAAAGAGTGGTTGGTTCATGG - Intronic
967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG + Intronic
967558621 3:190891740-190891762 CAGAAAGCATAAGTGGTTGAGGG + Intronic
967729729 3:192896230-192896252 CAGAAAGGATAGTTTGCCCAAGG + Intronic
968392970 4:207893-207915 GAGAAAGAAAAGTGGGCTCAGGG + Intergenic
970552042 4:17191855-17191877 CAGAAATAATAGTTGTATAAAGG + Intergenic
970894734 4:21088876-21088898 AAGCAATAATAGTTGCTTCATGG - Intronic
971510623 4:27418775-27418797 CCGATGGAATAGGTGGTTCAGGG - Intergenic
972978069 4:44661906-44661928 CAGATAGAGTTCTTGGTTCAAGG + Intronic
973919432 4:55670051-55670073 CAGAAAGAATAGGGGGTTGGGGG - Intergenic
973949615 4:55998465-55998487 CAGATTGAAGACTTGGTTCAGGG - Intronic
974991596 4:69098019-69098041 CTAAAAGAGTAGTTGGTACAAGG + Intronic
975507219 4:75150791-75150813 CATAAAGAGTTGTTGGTTAATGG - Intergenic
975839306 4:78456768-78456790 CAGAACAATTATTTGGTTCAGGG - Intronic
977656480 4:99527348-99527370 CAGAGTGAATATTTGTTTCATGG - Intronic
979429112 4:120605461-120605483 AATAAAGAAAAGTTGGTTTAGGG + Intergenic
979969138 4:127113281-127113303 CAGAAAGCATAGTGGCTTCCGGG - Intergenic
980498884 4:133622585-133622607 CAGAAAGAATATTAAGTTAACGG + Intergenic
981264102 4:142760739-142760761 GAGAAAGCATGGTTTGTTCAGGG - Intronic
981403269 4:144339002-144339024 CAGGTAGAATAGTTGTTACAAGG - Intergenic
981459208 4:144992273-144992295 CAGAATGACTGCTTGGTTCATGG - Intronic
983515763 4:168655053-168655075 TAGCCAGAATAGTTGGTGCAAGG + Intronic
985460950 4:190106352-190106374 GAGAAAGAATAGTGGGCCCAGGG + Intergenic
986720140 5:10555180-10555202 CAGAAAGTATAGTCTGTTGAGGG - Intergenic
986920900 5:12678500-12678522 CAGAAACAATAGTAGATTCAAGG + Intergenic
987453461 5:18114715-18114737 CAGAATGAATTGTTCTTTCAGGG - Intergenic
988050528 5:26023957-26023979 CAGAGAGCATAGTTGATTCAGGG + Intergenic
989389732 5:40887427-40887449 GAGAGAGAATAGTTAGGTCAGGG + Intergenic
990874664 5:60470887-60470909 CAGAATGAATATTTTGTTAAAGG - Intronic
992991759 5:82291041-82291063 CAGAGAGAATAGTATGTGCAAGG + Intronic
993429102 5:87809895-87809917 CAGAAAGAGAAGTTGGTTAATGG - Intergenic
994305430 5:98197894-98197916 CAGAAAAAAGGGTTGATTCAAGG - Intergenic
994607981 5:101995026-101995048 CAGAAACAATAGTGGGTTGGAGG + Intergenic
996882771 5:128319259-128319281 CTTAAAGAAGAGTTGGCTCAAGG + Intronic
996977087 5:129447963-129447985 CAGAAAAAATAGGTGGCTCTAGG + Intergenic
999451878 5:151684810-151684832 CAGAAAGAAGTATTAGTTCAAGG + Intronic
1000436685 5:161219456-161219478 TAGAAATAATAGTTTGTTAAAGG + Intergenic
1000612199 5:163386513-163386535 CAGAAATAAAATTGGGTTCAGGG + Intergenic
1000734592 5:164883081-164883103 AATAAAGATTAGTTGGTTCTGGG - Intergenic
1001383960 5:171323124-171323146 CAGAAAAATAAGTTGGTTAATGG - Intergenic
1002294243 5:178221165-178221187 TAGATAGAATCCTTGGTTCATGG - Intronic
1003945981 6:11076368-11076390 CAGGTAGAATATTTGGTTCTAGG - Intergenic
1004392430 6:15220909-15220931 CAGAAAGAATAATTTGTTGGTGG + Intergenic
1004604155 6:17178054-17178076 CAGAAAGAATAGTTGGGAAGTGG + Intergenic
1004790223 6:19017355-19017377 CAGAATGAATAGTCGGTTTGGGG - Intergenic
1006344119 6:33466258-33466280 CAGAAGGAAAAAGTGGTTCATGG + Intergenic
1007495040 6:42253999-42254021 CAGAAGGAACAGTTAGTGCATGG + Intronic
1008565363 6:52762683-52762705 GAGAAAGAAAAGTGGGTCCAGGG - Intronic
1008687265 6:53939522-53939544 AAGAAAGAAGAATTGGATCAGGG - Intronic
1012427064 6:99126623-99126645 TAGAAAAAATATTTGCTTCAGGG + Intergenic
1012636249 6:101546549-101546571 TAGAAAGATTAATTTGTTCAAGG - Intronic
1012779201 6:103535187-103535209 CATAAATTATAGTTGGTACACGG - Intergenic
1013233012 6:108174350-108174372 CAGAAAGAATCGTTGGTGGGAGG + Intronic
1014537897 6:122638405-122638427 CAGAAAGACTAGAAAGTTCACGG - Intronic
1015394711 6:132720898-132720920 GAGAAAGAATAGTGGGCCCAGGG + Intergenic
1016632825 6:146251822-146251844 AAGAAAGAGTAATTGATTCAAGG - Intronic
1016676730 6:146778957-146778979 CAGCAAAAAAAGTTTGTTCAAGG + Intronic
1017045365 6:150342244-150342266 CAGAAGGCACAGTTGGGTCAGGG + Intergenic
1018246803 6:161831766-161831788 CAGAAAAAATAAGAGGTTCAGGG + Intronic
1020895923 7:13939893-13939915 CATATAGAATAATTGTTTCATGG - Intronic
1021603009 7:22383093-22383115 CAGAAAGATTATTTGCTTAAGGG + Intergenic
1021739736 7:23674262-23674284 GAGAAAGAAAAGTTGGTTAATGG - Intergenic
1022332229 7:29390851-29390873 CAGAAAGAATAGGTGGCTGGGGG - Intronic
1022616960 7:31941317-31941339 CAGGAAGATTAGCTGGTTCTAGG - Intronic
1022982974 7:35622053-35622075 CAGGAAGAGAAGTTGGTTAATGG + Intergenic
1023473816 7:40554947-40554969 CAGAAGGAATAGCAGTTTCATGG - Intronic
1024688625 7:51775583-51775605 CAGGAAGAATAGTTGATGGATGG - Intergenic
1024845850 7:53641527-53641549 AAGGAAGAATTGTTGGTTCTGGG + Intergenic
1026011012 7:66636121-66636143 CAGATAAAATAGGCGGTTCAGGG + Intronic
1026016275 7:66673228-66673250 CAGATAAAATAGGTGGTTCAGGG + Intronic
1028828994 7:95306053-95306075 CAGAAAGAATGCAAGGTTCACGG + Intronic
1031564276 7:123275959-123275981 CAGAAAGAATAATCTGCTCAAGG + Intergenic
1035945631 8:3958400-3958422 CAGAAAAAATGGTGAGTTCATGG + Intronic
1037503831 8:19511105-19511127 CAGAAAGGACAGTGGCTTCATGG + Intronic
1039444206 8:37617916-37617938 GACAAAGAGAAGTTGGTTCAGGG + Intergenic
1041827360 8:62110883-62110905 CAGAAAGATTAGTTCATTAATGG - Intergenic
1042670387 8:71256510-71256532 CAGAAAGAATAGATGTTGCCAGG + Intronic
1042957537 8:74267728-74267750 CAGAAGGATTAGCTGGGTCAAGG + Intronic
1044255541 8:90056285-90056307 CCAAAAGAATAGAAGGTTCACGG - Intergenic
1044834820 8:96285800-96285822 CAGAAAGAATCTGTGGTGCAGGG - Intronic
1045437307 8:102176454-102176476 CAGAGAGATTAATTTGTTCAAGG - Intergenic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1050501697 9:6304938-6304960 AAGAAAGAAAAGTGGATTCAAGG - Intergenic
1050800195 9:9601520-9601542 CAAAAATAATAGATTGTTCATGG - Intronic
1055227851 9:74022303-74022325 CAGGAAGAAGACTTTGTTCATGG - Intergenic
1055590687 9:77810381-77810403 CAGACTGAATAATTTGTTCAAGG - Intronic
1056634163 9:88317947-88317969 AGGAAGGAATAGTTGGTGCAAGG + Intergenic
1057891161 9:98871029-98871051 GAGAAAGAATAGTAGGTTAGGGG - Intergenic
1058587571 9:106527010-106527032 AAGAAAGAAAAGCTGCTTCAGGG + Intergenic
1185682439 X:1899572-1899594 GAGAAAGAATAGTGAGTCCAGGG + Intergenic
1185919773 X:4078139-4078161 AAGAAATAAAAGTTGGTTCCAGG + Intergenic
1186279804 X:7979358-7979380 TAGAAAGAATAGTTGTATTATGG + Intergenic
1186842929 X:13503256-13503278 CACAAAGAATAAATGCTTCAGGG - Intergenic
1188034309 X:25299472-25299494 CAGAAAGATTAGTTGGTTGTCGG + Intergenic
1188263742 X:28044898-28044920 CACAAAGAATAAATGCTTCAGGG - Intergenic
1188762335 X:34048185-34048207 CAGAAAATAGAGTTGGTTAATGG + Intergenic
1191158516 X:57301684-57301706 CATATAGAATACTTGTTTCAGGG + Intronic
1191210662 X:57881834-57881856 AATAAAGAATGGTTGGTTTATGG + Intergenic
1192112226 X:68376724-68376746 CACAAAGCACAGTTGGTACAAGG - Intronic
1192659516 X:73027421-73027443 CAGAAAGAATAGAAGTTTCCAGG - Intergenic
1193378379 X:80788910-80788932 CAGAAAGATTAGTGGTTTCCAGG + Intronic
1194256614 X:91643198-91643220 CAGAAAGAATAGCTAGTAAAAGG - Intergenic
1194472983 X:94320385-94320407 CTGGAAGAATAATTGGTTCTGGG - Intergenic
1195281918 X:103344349-103344371 CAGAATGAATATTTGATTAAGGG - Intergenic
1195745487 X:108113275-108113297 TAGAAAGAATAGTTGGTGACAGG + Intronic
1195866043 X:109433992-109434014 AAGAAAGAAAAGATGGTTGACGG + Intronic
1197914226 X:131517719-131517741 CAGAAAGAGTAGTTACATCAGGG + Intergenic
1198734580 X:139772048-139772070 CAGGAAGAAAAGTGGTTTCATGG + Intronic
1199218704 X:145291697-145291719 CAGAAAAAATAATTGGTACTAGG + Intergenic
1200357438 X:155566559-155566581 CAGACAGCAAAGTTGGTTCCTGG + Intronic
1200575331 Y:4882460-4882482 CAGAAAGAATAGCTAGTAAAAGG - Intergenic
1200833689 Y:7712189-7712211 AAGAAAGAAAAGTGGGTCCAGGG - Intergenic
1202016041 Y:20407759-20407781 CAGAAAAAAGAGTTAGTCCAAGG + Intergenic