ID: 967097741

View in Genome Browser
Species Human (GRCh38)
Location 3:186191446-186191468
Sequence GGCCCCTGAATGACACCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967097739_967097741 6 Left 967097739 3:186191417-186191439 CCTACTCTGTTTTCTGGATTTGT 0: 1
1: 0
2: 2
3: 55
4: 479
Right 967097741 3:186191446-186191468 GGCCCCTGAATGACACCTACAGG 0: 1
1: 0
2: 1
3: 8
4: 78
967097737_967097741 23 Left 967097737 3:186191400-186191422 CCTCTTATTGGCTAGAACCTACT 0: 1
1: 0
2: 1
3: 8
4: 84
Right 967097741 3:186191446-186191468 GGCCCCTGAATGACACCTACAGG 0: 1
1: 0
2: 1
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967097741 Original CRISPR GGCCCCTGAATGACACCTAC AGG Intronic
900733067 1:4275743-4275765 GGCCCCTTATTGACAGCTCCCGG + Intergenic
903387277 1:22935685-22935707 GGCCTCTAAATGGCACCTAGGGG + Intergenic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
910044795 1:82899424-82899446 GGACCCTGACTGACACTGACAGG + Intergenic
910104481 1:83616814-83616836 GGCCCATGATTGACAGCAACTGG + Intergenic
918197660 1:182237525-182237547 GGCCACTGACTTACACCCACTGG + Intergenic
920272909 1:204780180-204780202 TGCCCCTGAATTACCCTTACTGG - Intergenic
1067534446 10:47098833-47098855 GGCCCCTGAACTACACCAACAGG + Intergenic
1069100188 10:64310422-64310444 AAGCCCTGAAGGACACCTACAGG - Intergenic
1075635699 10:124028920-124028942 GGCTCCTCAATGACAGTTACCGG + Intronic
1076218257 10:128712877-128712899 GGCCACAGCATGACACCTACGGG + Intergenic
1079490576 11:20984648-20984670 GGCATCTGCATGACTCCTACTGG + Intronic
1083975131 11:66112413-66112435 GAGACCTGAATGACACCAACGGG - Intronic
1087540901 11:99518240-99518262 TTCCTGTGAATGACACCTACTGG - Intronic
1096076661 12:48810259-48810281 CATCCCTGAATGACACTTACCGG + Intergenic
1097079337 12:56418348-56418370 GGCCCCTGTAGGAAACCTTCTGG - Exonic
1101594542 12:106152425-106152447 GGCCCCTGAGTGAAACCTGCAGG + Intergenic
1115281188 14:31665482-31665504 TGCTCCTGAATGACTACTACTGG - Intronic
1119033473 14:71210595-71210617 GGCCCATTCATGACACCCACTGG + Intergenic
1119970734 14:78967270-78967292 GCCCCCTGAATGACAACCAGTGG + Exonic
1123932496 15:25178596-25178618 GGCACCTGGATGACAACCACTGG - Intergenic
1123934460 15:25187395-25187417 GGCACCTGGATGACAACCACTGG - Intergenic
1123934941 15:25189578-25189600 AGGCCCTGAAGGACACCTTCGGG + Intergenic
1127505751 15:59596333-59596355 GGCCCATGACTGGCTCCTACAGG + Intronic
1129878356 15:78991830-78991852 GGCCCATGACGGACACCTCCTGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1139892920 16:70265628-70265650 GGCTCCTCTATGACACCTATGGG - Exonic
1141474542 16:84263912-84263934 GGCCCCTGAATGAGCCATGCAGG + Intergenic
1159155382 18:64575401-64575423 TGCTCCTGAATGACTACTACTGG + Intergenic
1166779202 19:45331642-45331664 GGCCTCTGAAGGGCACCTAGGGG + Intergenic
1167498389 19:49832019-49832041 CGCCCCTGACTGTCACCTACAGG - Exonic
925325085 2:3012468-3012490 GGTCCCTGAATGGCACATGCAGG - Intergenic
926959367 2:18337328-18337350 GCCACCAGAATGAAACCTACAGG - Intronic
929434599 2:41918876-41918898 GGTCCCTGAATGCCACCTGCAGG - Intergenic
929628076 2:43430887-43430909 GGCCCCTGATTGAGAACCACTGG + Intronic
937889964 2:126931251-126931273 GGCCCCCCAGTGATACCTACAGG + Intergenic
942227711 2:173831650-173831672 GACCCCTCAGTGACACCCACAGG + Intergenic
946309001 2:218872512-218872534 TGCCCCTGAATGAGAGCTCCTGG - Intronic
946432087 2:219631403-219631425 GGCCCCTGATGGACTCCCACAGG - Intronic
947734697 2:232448555-232448577 AGCACCTGAATGACAGCGACTGG + Intergenic
948461145 2:238130582-238130604 GGCCCCTGCAGGACACCTGCAGG + Exonic
1180747730 22:18102741-18102763 GTATCCTGAAGGACACCTACTGG - Exonic
1181177499 22:21046048-21046070 GACCCCTGAAAGACGCCCACAGG - Exonic
1181469519 22:23129130-23129152 GGCCCATGAAGGACACCACCTGG + Intronic
1183751923 22:39725821-39725843 GGACCCTGAGTCACACCTCCAGG + Intergenic
950366461 3:12488663-12488685 GGCCCCAGAGGGACACGTACTGG + Intronic
956049154 3:65228959-65228981 GGCCCCTAAATGGCACATAAAGG + Intergenic
957882699 3:86241104-86241126 GGTCCCTGACTGAGACCCACTGG - Intergenic
962519810 3:136188023-136188045 GGCCCCTGAATAACCACTATAGG + Intronic
964642208 3:158920962-158920984 GGCCCCTCAATCTCACCCACTGG - Intergenic
967097741 3:186191446-186191468 GGCCCCTGAATGACACCTACAGG + Intronic
967310779 3:188104132-188104154 GACTCCAGAATGACACCTCCAGG + Intergenic
970917733 4:21355033-21355055 TGCTCCTGAATGACGACTACTGG + Intronic
973634073 4:52845809-52845831 GGCTCCTGGAGGCCACCTACAGG + Intergenic
976371118 4:84289288-84289310 TGCTCCTGAATGACTGCTACTGG + Intergenic
978626924 4:110696561-110696583 GGCACCTGAATCTCAGCTACTGG - Intergenic
981142927 4:141291602-141291624 GGCCCCAGAGTGACATATACTGG + Intergenic
982843813 4:160224434-160224456 GGACCCAGAATGACACATGCAGG + Intergenic
984615533 4:181892785-181892807 TGCCTCTGAATGACACATACAGG + Intergenic
985816527 5:2132026-2132048 GGCCCCTGAATGCCACTTACAGG + Intergenic
988155767 5:27447710-27447732 GGCCCCTCAATGACACACATGGG + Intergenic
1001722056 5:173864887-173864909 AGCCCCTGACTGACACCTCCAGG + Intergenic
1004249985 6:14015822-14015844 GGACCCTGAATGACACGGCCAGG - Intergenic
1005254084 6:23981368-23981390 GGCCCCTGAATGGCAGCAGCAGG - Intergenic
1005589987 6:27312857-27312879 GGCAAATGACTGACACCTACTGG - Intergenic
1006813571 6:36836566-36836588 GGCATCTGAGTGACACCTGCTGG - Intronic
1019809723 7:3156445-3156467 GGCCTCTGAATGACACTGAGCGG + Intronic
1019826173 7:3286189-3286211 GGCCCCAGAATGAAGCCAACTGG + Intergenic
1019991814 7:4697095-4697117 GGTCCCTGAATCACACCTTAAGG - Intronic
1024559138 7:50628692-50628714 GCCCCCTGCCTGCCACCTACGGG + Intronic
1026238853 7:68554349-68554371 GCCTCCTGATTGACACCAACAGG + Intergenic
1027977032 7:85171611-85171633 GTCCCTTGAATAACACCTAAAGG + Intronic
1032899881 7:136295171-136295193 GGCACCTGCCTGCCACCTACAGG - Intergenic
1032981642 7:137290727-137290749 AGCCCTTGAATGTCATCTACTGG - Intronic
1035729175 8:1842507-1842529 GGTCCCTGAGTGTCACCCACAGG - Intronic
1047921313 8:129637298-129637320 TGCCCCTGAATGGAACCAACTGG + Intergenic
1059477555 9:114559980-114560002 GCCTCTTGAATGACACCAACTGG + Intergenic
1059637765 9:116187466-116187488 GTGCCCTGAATCACAACTACCGG + Exonic
1062443794 9:136584974-136584996 GGTCCCTGGATGACAGCTTCAGG - Intergenic
1188723779 X:33554894-33554916 TTCCCCTGAATGACACCCTCAGG + Intergenic
1190855426 X:54289716-54289738 GGCCCCTGAATGCCCCCCAATGG + Intronic
1191122238 X:56918392-56918414 TGCTCCTGAATGACTGCTACTGG - Intergenic
1193291902 X:79783565-79783587 GGGCCTTGAATGACACCCAATGG - Intergenic
1194325863 X:92515429-92515451 AGAACCTGAATGACGCCTACCGG - Intronic
1195502163 X:105613866-105613888 GGCTTCTGAATGACACCTCTGGG + Intronic
1195658009 X:107351625-107351647 GGCCAGTGAATAACACCCACTGG - Intergenic
1199748522 X:150792436-150792458 AGCCTCTAAATGAAACCTACAGG - Intronic
1200634585 Y:5634587-5634609 AGAACCTGAATGACGCCTACCGG - Intronic