ID: 967098266

View in Genome Browser
Species Human (GRCh38)
Location 3:186194677-186194699
Sequence AAGCCAGGACTCGGTAGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967098263_967098266 -8 Left 967098263 3:186194662-186194684 CCAGATCGGAGGTGGAAGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 967098266 3:186194677-186194699 AAGCCAGGACTCGGTAGCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 86
967098262_967098266 -3 Left 967098262 3:186194657-186194679 CCAGGCCAGATCGGAGGTGGAAG 0: 1
1: 0
2: 0
3: 17
4: 107
Right 967098266 3:186194677-186194699 AAGCCAGGACTCGGTAGCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 86
967098260_967098266 0 Left 967098260 3:186194654-186194676 CCACCAGGCCAGATCGGAGGTGG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 967098266 3:186194677-186194699 AAGCCAGGACTCGGTAGCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 86
967098258_967098266 3 Left 967098258 3:186194651-186194673 CCTCCACCAGGCCAGATCGGAGG 0: 1
1: 0
2: 2
3: 10
4: 105
Right 967098266 3:186194677-186194699 AAGCCAGGACTCGGTAGCTCCGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967098266 Original CRISPR AAGCCAGGACTCGGTAGCTC CGG Intronic