ID: 967100113

View in Genome Browser
Species Human (GRCh38)
Location 3:186209501-186209523
Sequence TTGAAATAAAGGCTATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967100113 Original CRISPR TTGAAATAAAGGCTATGGTG GGG Intronic
904478447 1:30779151-30779173 TTCAAACAAAGGCTAATGTGTGG - Intergenic
907701627 1:56793841-56793863 TTGAACTTAATGCTATGGTATGG + Intronic
918120471 1:181534525-181534547 TTGAAATAAAGACTATGTATTGG + Intronic
919314932 1:195960317-195960339 TTGAAATAAAGGCTAGAATTTGG - Intergenic
920027764 1:203013346-203013368 TTGAAATAAGGGTTAAGGTTAGG + Intronic
920497965 1:206468865-206468887 AGGAAATAAATGCTTTGGTGGGG + Intergenic
921518821 1:216133028-216133050 TTAAAATAAGTGCAATGGTGGGG + Intronic
923871217 1:237996101-237996123 TTGAAATAAAAGCTGTGGTTTGG - Intergenic
924399989 1:243669138-243669160 TTGAAAAGAAGGATATGGGGAGG - Intronic
924815643 1:247439459-247439481 TAGAGATAAAGGCAATGGTGTGG - Intronic
1063378427 10:5568894-5568916 TTGACAAAAATGCTATGGTCAGG - Intergenic
1064751862 10:18538341-18538363 GTGAATTAGAGGCTAGGGTGGGG - Exonic
1065236127 10:23654410-23654432 TTGACATAAAGGATAAGGTCGGG + Intergenic
1067792924 10:49301335-49301357 TTGAGATAAAGACTATGGACTGG - Intronic
1067986875 10:51158666-51158688 TTGAAAGAATGGCTATGATTTGG + Intronic
1069308868 10:67007832-67007854 CTGAAATAATGGCTATTTTGAGG - Intronic
1074563118 10:114551984-114552006 TGCAAATAAAGGCTAAGGTTAGG + Intronic
1080087554 11:28302961-28302983 TTGAAAAAATGGCCATGGTCTGG + Intronic
1082831621 11:57622728-57622750 TGAAAATAAAGGCTAGAGTGGGG - Intergenic
1086197758 11:84161427-84161449 TTGACATAGAGGCTTTGGAGAGG + Intronic
1086791869 11:91049950-91049972 ATGAAATACAGATTATGGTGAGG + Intergenic
1086863529 11:91952766-91952788 TTGAATTAAAGGTTAAGATGGGG - Intergenic
1088037147 11:105331370-105331392 TTTAACTAAAGGCAATGGGGGGG + Intergenic
1090443059 11:126740223-126740245 AGGTAATAAAGGCTATAGTGGGG + Intronic
1092754419 12:11749939-11749961 TTGAAAAAGAGCTTATGGTGTGG + Intronic
1093463011 12:19423287-19423309 TTGAACTGAAGGCAATGGGGAGG - Intronic
1094383888 12:29872951-29872973 TTTAAATAAAGGGTGTGTTGTGG - Intergenic
1094775286 12:33719675-33719697 TTGAACTAAAGGCAATTGGGAGG + Intergenic
1098012552 12:66070605-66070627 TTGAAATAGAGGATATAGTTTGG + Intergenic
1098511186 12:71315740-71315762 TTCACACGAAGGCTATGGTGTGG + Intronic
1098911250 12:76211243-76211265 GAGAAATAAATGCTATGGAGAGG - Intergenic
1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG + Intronic
1101969142 12:109300592-109300614 TTTAAATAAATGATATGATGAGG - Intronic
1103661327 12:122520896-122520918 TTGAAATAAAGGTTTGAGTGAGG - Intronic
1103885609 12:124198073-124198095 TGGAATTAAAGGGCATGGTGAGG - Intronic
1106967791 13:35092877-35092899 TTCACATAAAGGCTTTTGTGTGG - Intronic
1108237714 13:48426269-48426291 TAGAAATAAAGGTTATGTTGTGG + Intronic
1109775915 13:67040700-67040722 TTGAAATACAGAATGTGGTGGGG + Intronic
1111088922 13:83415864-83415886 TTGAAATCCAGGATATGGTCAGG - Intergenic
1111376467 13:87385212-87385234 CTGAAATAAATGCTATGGCCAGG - Intergenic
1112868216 13:103934860-103934882 TTGAGAGAAATGCTATGGAGAGG + Intergenic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1115245277 14:31287976-31287998 TTTAAACAGATGCTATGGTGTGG + Intergenic
1115652792 14:35415160-35415182 CTGAAATAAAGGCTATTAGGAGG + Intergenic
1116648281 14:47558141-47558163 TAGAAAAAAAGACTATGGTTGGG + Intronic
1117183382 14:53215351-53215373 TTGTAAAATAGGCTATGGTGTGG - Intergenic
1120198154 14:81509207-81509229 CTGAAATTAAGACTATTGTGAGG - Intronic
1120932094 14:89859031-89859053 TTAAAATAAGGCCTATGGTAAGG + Intronic
1121217199 14:92257665-92257687 TTGATATTATGGCTATGGTGTGG + Intergenic
1125473073 15:40023276-40023298 TAGAAATAAAGGTTATGAGGTGG - Intronic
1125844429 15:42838440-42838462 TTGGAATAATGGCTATAGTGGGG - Intronic
1125961805 15:43836275-43836297 TTGAAAAAAATGGTTTGGTGTGG + Intronic
1127701570 15:61506374-61506396 TTAAAATAAAGACTAATGTGGGG - Intergenic
1133462136 16:5996270-5996292 GTGAAATGAATGCCATGGTGCGG - Intergenic
1134304738 16:13021966-13021988 CTGAAATCAAGGCTTTGGTGGGG + Intronic
1136124242 16:28165694-28165716 TTGAAATAAAGGAGAAGATGTGG + Intronic
1140571256 16:76108730-76108752 TTGTGATAAAGTCTATGGAGAGG + Intergenic
1141823219 16:86462188-86462210 TTGAAATAAAAGCTAGGGTTGGG + Intergenic
1143539325 17:7559905-7559927 TTTAAATAATGGCTTTGGGGAGG + Intronic
1143851005 17:9812017-9812039 TTCAAAGCAAGGCTAAGGTGGGG - Intronic
1144362661 17:14509909-14509931 TTGAAATGATGGATAGGGTGGGG - Intergenic
1146958580 17:36952810-36952832 TTGAAATGAAGTCTATGGCTTGG + Intronic
1147614131 17:41818511-41818533 TGGCGAGAAAGGCTATGGTGAGG + Exonic
1147928548 17:43961417-43961439 TGGAAATAAAGAGTATGATGAGG + Intronic
1148828680 17:50414461-50414483 TTGAAATACTGGCTAAGGAGAGG + Intergenic
1149172766 17:53832582-53832604 TTAAAATAAAGGTTATGGCATGG + Intergenic
1155447752 18:25929705-25929727 GTGAAATAAAGGCTAGGCTGGGG + Intergenic
1155997138 18:32342140-32342162 TTCAAAAAAAGGTTATGGAGTGG - Intronic
1157532570 18:48433801-48433823 TGGAAATAAAGGCAAAGGTTGGG + Intergenic
1158587213 18:58751117-58751139 TTGAAATAATAGCTAGTGTGAGG + Intergenic
1158762061 18:60401637-60401659 TTGAAATAAAGGTTGGGGGGGGG + Intergenic
1158811408 18:61040711-61040733 ATGAAATATATGCTATGATGTGG - Intergenic
1159597052 18:70392612-70392634 GTGAAATGAAGGCGTTGGTGGGG + Intergenic
1166155018 19:40904534-40904556 TAGAAATGAAGGCTATTTTGAGG - Intergenic
1166173057 19:41045795-41045817 TAGAAATGAAGGCTATTTTGAGG + Intergenic
1166459974 19:42978501-42978523 TTGGAATAAAGGGTATGGATGGG + Intronic
1166477297 19:43138557-43138579 TTGGAATAAAGGGTATGGATGGG + Intronic
1167459579 19:49617556-49617578 ATGAGTTCAAGGCTATGGTGAGG + Intronic
1167776550 19:51561802-51561824 ATGCAATTAAAGCTATGGTGCGG + Intergenic
1167922004 19:52789677-52789699 AGGAGATCAAGGCTATGGTGAGG + Intronic
926865472 2:17352686-17352708 TTGAAAAAAAGTCTATGGCATGG - Intergenic
927030399 2:19115531-19115553 TTGAAAACAAGGATTTGGTGTGG - Intergenic
927661690 2:24998737-24998759 TAGAAATAAAGGTTAAGGTGGGG - Intergenic
928172996 2:29015352-29015374 TTGAAATTGAGACCATGGTGGGG - Intronic
929203062 2:39258225-39258247 TTAAAATAAAGGATATGGCTGGG - Intronic
929420661 2:41786381-41786403 ATGAAATAATGGCTATGGAAGGG - Intergenic
929701454 2:44166799-44166821 CTGCAATTAAGGCTATGGCGCGG - Intergenic
929763434 2:44825092-44825114 TTGTAAGAAAGGCTCAGGTGGGG + Intergenic
930184879 2:48403631-48403653 TTGAAATCAAGGTGTTGGTGAGG - Intergenic
931163418 2:59718953-59718975 TTAAAATAAAGTCTTTAGTGGGG - Intergenic
931841537 2:66155366-66155388 TGTTAATAAAGGCTATGGTGAGG + Intergenic
931880246 2:66561296-66561318 ATGAAGGAAATGCTATGGTGAGG + Intronic
935672029 2:105564177-105564199 ATGAAATAAAGCCAATTGTGAGG + Intergenic
938977276 2:136492041-136492063 TTGGAATAATGACTATGATGAGG + Intergenic
939111999 2:138019537-138019559 TTCCATTAAAGGCTATTGTGGGG - Intergenic
939358006 2:141128994-141129016 TTGAAATAAACGATTTGGTAAGG + Intronic
939576190 2:143898188-143898210 TTGAAATACATGCTACAGTGTGG + Intergenic
940893594 2:159058790-159058812 TTGAAATACTGGCTAAGGTAAGG + Intronic
942286153 2:174418929-174418951 TTGAAGTAATGGCTATATTGTGG + Intronic
942507197 2:176655799-176655821 TTCAAATGAAGGATATGTTGGGG - Intergenic
942893497 2:181020662-181020684 TTCAAATAAAAGCCATAGTGTGG + Intronic
947185379 2:227450535-227450557 GTGAAATAAAGCATAAGGTGTGG + Intergenic
947827262 2:233114808-233114830 TTGAAACAAATGCTTTGGTGTGG + Intronic
1169063668 20:2680091-2680113 TGGAGATAAAGGCTATGAGGAGG - Intergenic
1171447846 20:25217406-25217428 TTGAAAGAAAGGGGATGGTCAGG - Intronic
1171449802 20:25227291-25227313 TGGAAGTAAAGGCGCTGGTGGGG - Intergenic
1172210252 20:33192705-33192727 TTGCAATTAAGGCTTTAGTGGGG + Intergenic
1174032704 20:47643223-47643245 TTTATTTAAAGGCTATGGAGGGG + Intronic
1174895194 20:54441573-54441595 TTAAAATATAGTCTATGGTCAGG - Intergenic
1176587907 21:8607590-8607612 TTTAAATTAAGGCTATGATTTGG - Intergenic
1177408520 21:20700834-20700856 TTCAAATACAGGTTATTGTGTGG - Intergenic
1178863399 21:36307917-36307939 ATTAAATAAAGTCTATGGGGTGG + Intergenic
1180270739 22:10584589-10584611 TTTAAATTAAGGCTATGATTTGG - Intergenic
1181911842 22:26244678-26244700 CTGAAGCAAAGGCTATGTTGAGG + Intronic
949139450 3:614151-614173 TTTAAATTAAGGCTATGATTTGG + Intergenic
950332304 3:12166033-12166055 TTGAAATGAGGGGTTTGGTGAGG + Intronic
952470261 3:33641473-33641495 TTGAAAAAAAGGCTATGGCTAGG - Intronic
952818314 3:37464855-37464877 TGGAAATGAAGGGTTTGGTGTGG + Intronic
953584072 3:44184275-44184297 GTGAAATAAAAGCTATTTTGAGG - Intergenic
955859071 3:63307615-63307637 TTGACAGAAAGGCTGAGGTGAGG - Intronic
956084984 3:65598563-65598585 TTAAAATAAAGACGATGGAGTGG + Intronic
956533583 3:70250049-70250071 TTAAAATAAAGGGTGTGGTCAGG + Intergenic
957637032 3:82799757-82799779 TTAAAAGAATGGCTATGTTGAGG + Intergenic
958713462 3:97747821-97747843 TTGACATAAAGTCTATGATTTGG - Intronic
958916785 3:100059035-100059057 TTGAAATAAAGGCTACCTTTAGG + Intronic
963089333 3:141467578-141467600 TTTAAATAAAAGCTTTGTTGAGG - Intergenic
964356598 3:155856708-155856730 TTGGAATAAAGCCTGTGGTCTGG - Intergenic
967100113 3:186209501-186209523 TTGAAATAAAGGCTATGGTGGGG + Intronic
968377303 4:53935-53957 TTGAAGGAAAGGCTTTTGTGAGG + Intronic
968384637 4:125113-125135 TTGAAGGAAAGGCTTTTGTGAGG + Exonic
968393649 4:213266-213288 TTGAAGGAAAGGCTTTTGTGAGG + Intergenic
968822684 4:2867475-2867497 CTGAAATTAAGACTATGGTTTGG - Intronic
970276910 4:14410994-14411016 CTGAAATAAATGCCATAGTGTGG - Intergenic
970535361 4:17024725-17024747 TGGATCTATAGGCTATGGTGAGG - Intergenic
970709635 4:18846852-18846874 TTGAAATTAAGATTATGGAGGGG - Intergenic
974156804 4:58084009-58084031 TTGAAATAGATGCTATAGTTTGG + Intergenic
975780042 4:77829226-77829248 TTGAAAGAAAGGCAGTGGGGAGG - Intergenic
977431974 4:96941075-96941097 TTAAAATAAATGCTATGATGGGG - Intergenic
977522448 4:98101876-98101898 TTGGAATCAAGGCTAAGGTCGGG - Intronic
978331705 4:107620531-107620553 TTTAAATAAAGGCTAGAGTGTGG + Intronic
978338684 4:107698017-107698039 TTGAAATTAAGTTTGTGGTGAGG - Intronic
978636682 4:110816999-110817021 TTAAATAAAAGCCTATGGTGAGG + Intergenic
979834527 4:125346957-125346979 TTTAAATAAGGGCTATACTGTGG + Intronic
980901431 4:138908770-138908792 GGGTAATTAAGGCTATGGTGTGG - Intergenic
982604744 4:157500143-157500165 ATGAAATAAAGGCTCAGGTGAGG + Intergenic
983371733 4:166868384-166868406 CAGGAATAGAGGCTATGGTGAGG + Intronic
991381861 5:66036476-66036498 CTGAAAGAAAGTCTAAGGTGAGG - Intronic
991728239 5:69558696-69558718 ATAAAATAAAGGCAATGGAGGGG + Intergenic
991866716 5:71069179-71069201 ATAAAATAAAGGCAATGGAGGGG - Intergenic
993136863 5:83979769-83979791 CTGGAATGAAGGCTAGGGTGAGG + Intronic
993901404 5:93585934-93585956 TTTAAATAAAGGGTATGAAGAGG - Intronic
995087278 5:108127250-108127272 TAGAAATTAAGGCTATGATGAGG + Intronic
995963651 5:117876708-117876730 TATAAATAAAGGTTATGGTGAGG - Intergenic
996825854 5:127680100-127680122 TTCAAATAAAGGCAATAATGAGG - Intergenic
997125366 5:131221172-131221194 TTGATTTAAAGTCTCTGGTGAGG - Intergenic
997468260 5:134102341-134102363 TGGAAATAAAAGCTTTGGGGTGG - Intergenic
998905062 5:146896080-146896102 ATTAAAGAAAGGCTATGGTCAGG + Intronic
1000900739 5:166909039-166909061 GTAAGATAAAGGCAATGGTGGGG + Intergenic
1001128256 5:169040467-169040489 TAGAGATTAAGGATATGGTGTGG + Intronic
1002994992 6:2274612-2274634 GTAAACTAAAGGCAATGGTGAGG - Intergenic
1006894422 6:37457987-37458009 TTGAAAGGCAGGATATGGTGAGG + Intronic
1008724560 6:54401033-54401055 TGACAATAAAGGCCATGGTGAGG + Intergenic
1009762696 6:68028301-68028323 TTTAAATAAAGGAGATAGTGTGG - Intergenic
1011509984 6:88089691-88089713 TTTAAATCATGGCAATGGTGAGG + Intergenic
1012265195 6:97133099-97133121 TAGAAAATAAGGCAATGGTGTGG - Intronic
1013144974 6:107380395-107380417 TAGACAGAAAGGCCATGGTGGGG + Intronic
1013529574 6:111006531-111006553 TTAAAATGAAGGCTATGGGCTGG - Intronic
1014054845 6:117001910-117001932 TAAAAATAAAGGCTTTGGTTGGG - Intergenic
1014533630 6:122590791-122590813 TGGAGATAAAGGTGATGGTGGGG + Intronic
1017667753 6:156737967-156737989 TTTAAAAAAAGGTTATGTTGTGG - Intergenic
1018058000 6:160068998-160069020 TAGAAATAATAGCCATGGTGAGG + Intronic
1020143916 7:5628149-5628171 TTGGAAGAAAGGCTCTGGGGTGG - Intronic
1021008756 7:15435650-15435672 TTAAAAAAAAGGCTATGGCCTGG - Intronic
1022827183 7:34026793-34026815 TAGAAATAAAGCCTGTTGTGTGG - Intronic
1024284896 7:47748564-47748586 TTGAAATAAAGACTAAGATGAGG + Intronic
1024431683 7:49295414-49295436 TTGAAATAAGGCCAAGGGTGTGG - Intergenic
1024462765 7:49676035-49676057 TTCAAATAAAGAGTATCGTGGGG - Intergenic
1027813622 7:82939853-82939875 ATGAAATAAAGGCCATGTTCAGG - Intronic
1028202420 7:87976972-87976994 TGGAAATGAAGGGTAAGGTGTGG + Intronic
1029566719 7:101343370-101343392 CAGAATTAAAGGCTTTGGTGGGG - Intergenic
1030260363 7:107557761-107557783 ATGAATGAAAGGCTTTGGTGAGG + Intronic
1030946047 7:115721669-115721691 TTGTAATAAAGCCTATTATGTGG + Intergenic
1031151820 7:118062586-118062608 TAGAAATAAAGGAAATGGTCAGG + Intergenic
1032763708 7:134970243-134970265 TTGAATTAAGGCCTATGGTAAGG + Intronic
1032868061 7:135949003-135949025 TGGAAATAAAGCCAATGCTGAGG + Intronic
1033596182 7:142860551-142860573 ATGAAATAAATGCTTTGGAGAGG - Intronic
1034333167 7:150300787-150300809 TTGAAATAAATACCATGTTGTGG - Intronic
1034664874 7:152809102-152809124 TTGAAATAAATACCATGTTGTGG + Intronic
1036652133 8:10651426-10651448 TAGAAATAAAAGCTATGCTCGGG + Intronic
1037066548 8:14585905-14585927 TTGAAATAAAAGCAACTGTGTGG - Intronic
1037444494 8:18951327-18951349 ATGAATTAAAGGCTACAGTGAGG + Intronic
1038185102 8:25266095-25266117 TTAAAATAAAGGGAATCGTGAGG - Intronic
1040492482 8:47937504-47937526 CTGAAAAAATGGCTCTGGTGTGG - Intronic
1040884508 8:52245438-52245460 CTGAAAAAAAGGATGTGGTGAGG + Intronic
1042011352 8:64248656-64248678 TTGAAAGAAAGACTATGGGAAGG - Intergenic
1042841488 8:73128537-73128559 TTGAAAGAAATTCTATTGTGGGG + Intergenic
1043108904 8:76152465-76152487 GTGAACTAAAGGATATGGGGCGG - Intergenic
1045198098 8:99950368-99950390 TTCCAATGAAGGCTATGGTTAGG + Intergenic
1046638408 8:116698682-116698704 TTGAAATAGAGGCTATGGCATGG - Intronic
1047750743 8:127878659-127878681 TTAAAAAGAAGGCTATCGTGAGG + Intergenic
1048313787 8:133347238-133347260 TTGAAATGAAGGCTTTGGCAGGG - Intergenic
1048542526 8:135355493-135355515 TTGAACTGAAGGCTATTGGGAGG + Intergenic
1048637410 8:136312116-136312138 TTGTAATAAATGTTGTGGTGTGG + Intergenic
1050053948 9:1632398-1632420 TAGAAATTAAGGCAATGGTTAGG - Intergenic
1051136161 9:13924026-13924048 TAAAAATAAAGGCAATGTTGAGG + Intergenic
1051406010 9:16738442-16738464 TTGTAATTAAGGCTATGTGGAGG + Exonic
1051466810 9:17387683-17387705 TTGAAAAAAAGGTTGTGGTAGGG + Intronic
1052095823 9:24382710-24382732 TTGTTATTAAGGCTCTGGTGAGG + Intergenic
1053176683 9:35930477-35930499 CTGAAATTAAGGATATGGTAAGG + Intergenic
1054817028 9:69485248-69485270 TTGACATTTAGGCAATGGTGTGG - Intronic
1056367108 9:85916713-85916735 TTGAAATAAAGCCTGTGGTGAGG + Intergenic
1058884743 9:109314640-109314662 TTAAAAGAAAGGCTGAGGTGGGG - Intronic
1061470128 9:130817904-130817926 TTCACATAGAGGCTTTGGTGTGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1203571933 Un_KI270744v1:140311-140333 TTGAAGGAAAGGCTTTTGTGAGG - Intergenic
1203617911 Un_KI270749v1:86178-86200 TTTAAATTAAGGCTATGATTTGG - Intergenic
1186187356 X:7034157-7034179 TTGGAATAAAGGGTATGGATGGG + Intergenic
1187998340 X:24953676-24953698 TTGAAAGAAGGGCTTTGGTAAGG + Intronic
1188795952 X:34465284-34465306 TTGAAAAAAAGTCTGTTGTGAGG - Intergenic
1191769223 X:64737812-64737834 TTGAAATAAAGACAATGATAAGG + Intergenic
1193776672 X:85650768-85650790 TTGAAATAAAGGTCATAATGAGG - Intergenic
1194140479 X:90202993-90203015 TTGAAATAAAGGCAATAGCAAGG + Intergenic
1194585608 X:95730494-95730516 TTGCAAAAAAGACTTTGGTGGGG - Intergenic
1195170097 X:102259196-102259218 TGAAACTAAAGGCCATGGTGAGG + Intergenic
1195188760 X:102427904-102427926 TGAAACTAAAGGCCATGGTGAGG - Intronic
1197743605 X:129915227-129915249 TAAAAATAAAGGCTATGGGCCGG + Intronic
1199846572 X:151695892-151695914 TGGAAATAAAGTCTAGGGTTTGG + Intronic
1200486224 Y:3771960-3771982 TTGAAATAAAGGCAATAGCAAGG + Intergenic
1202182582 Y:22152155-22152177 TTGAACAATAGGCCATGGTGTGG + Intergenic
1202208778 Y:22434247-22434269 TTGAACAATAGGCCATGGTGTGG - Intergenic