ID: 967100177

View in Genome Browser
Species Human (GRCh38)
Location 3:186209888-186209910
Sequence GAGGATTAGCTGGGGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967100177_967100187 25 Left 967100177 3:186209888-186209910 CCCCACTCCCCCAGCTAATCCTC 0: 1
1: 0
2: 0
3: 35
4: 351
Right 967100187 3:186209936-186209958 TATGGAGAGATAAGGAAAACAGG 0: 1
1: 0
2: 1
3: 38
4: 416
967100177_967100186 17 Left 967100177 3:186209888-186209910 CCCCACTCCCCCAGCTAATCCTC 0: 1
1: 0
2: 0
3: 35
4: 351
Right 967100186 3:186209928-186209950 AGACTCATTATGGAGAGATAAGG 0: 1
1: 0
2: 0
3: 13
4: 151
967100177_967100185 7 Left 967100177 3:186209888-186209910 CCCCACTCCCCCAGCTAATCCTC 0: 1
1: 0
2: 0
3: 35
4: 351
Right 967100185 3:186209918-186209940 AATACTAAAAAGACTCATTATGG 0: 1
1: 0
2: 1
3: 27
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967100177 Original CRISPR GAGGATTAGCTGGGGGAGTG GGG (reversed) Intronic
900009000 1:88948-88970 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
900461790 1:2805284-2805306 GAAGTTTAGCTCGGGGAGGGAGG - Intergenic
900705249 1:4076360-4076382 GGGGAGTGTCTGGGGGAGTGGGG + Intergenic
900759886 1:4463473-4463495 GAGCACTAACTGTGGGAGTGGGG - Intergenic
900928362 1:5720092-5720114 GAGGATGTGCTAGGGGAGTCTGG - Intergenic
901215149 1:7550840-7550862 GAGGGTCAGCTGGGTGGGTGTGG - Intronic
901783709 1:11610792-11610814 GAGGGTTAGGAGTGGGAGTGCGG - Intergenic
902774662 1:18666949-18666971 CAGGATAGGCTGAGGGAGTGGGG + Intronic
904345736 1:29867738-29867760 GAGGCTTAGCTGGGTGAATCTGG + Intergenic
904771644 1:32884495-32884517 GAGGCTGAACTGGGGAAGTGGGG + Intergenic
905014239 1:34766249-34766271 GGTGATTATCTGGGGGACTGTGG - Intronic
905871428 1:41406643-41406665 GAGGAGTGGCTGGGGGATTTGGG - Intergenic
906421115 1:45668089-45668111 GAGGAATAAATGGGTGAGTGAGG - Intronic
906528122 1:46508288-46508310 CAGGATCAGCTGGGGTAGTCAGG + Intronic
907539113 1:55196191-55196213 GAGGAGTGGCTGGTGGGGTGAGG - Intronic
907974830 1:59421583-59421605 GAAGAGAAGCTGGGGCAGTGGGG - Intronic
909756046 1:79227413-79227435 GAGGGGTATGTGGGGGAGTGTGG - Intergenic
909836277 1:80259503-80259525 GAGGATTTGTTTGGGGGGTGGGG + Intergenic
910417915 1:87020989-87021011 GAGGAGTAGCTGGGGTACTAAGG - Intronic
910438700 1:87230869-87230891 CAGGAGCAGCTGGTGGAGTGAGG - Intergenic
910520937 1:88121831-88121853 GAGGTTTAGCTGGGGTTGTTGGG + Intergenic
911399530 1:97357973-97357995 GAGGATGAGCTGAAGCAGTGGGG + Intronic
912559441 1:110539366-110539388 GAGGTTTAGTAGGGGGAGTGGGG + Intergenic
912989641 1:114472638-114472660 GAGGATCACCTGAGGGTGTGAGG + Intronic
914000814 1:143692657-143692679 GAGGACGAGCTGGGGGAGGGGGG + Intergenic
914899205 1:151703042-151703064 GAGGGTGAGCTGGGAGTGTGTGG + Exonic
914917578 1:151827953-151827975 GCGGGTGAGCTGGGGGAGGGGGG - Intronic
915453156 1:156020794-156020816 GGGGGTTAGCTAGGGGAGGGCGG - Intronic
915514678 1:156405971-156405993 GAGGAGGAGCTGGGGAAGGGAGG - Intronic
915839396 1:159202665-159202687 GAGGAAAAGCTGGGGGAGGGTGG - Intronic
916121277 1:161530597-161530619 AAGGATTAGTTTGGGTAGTGAGG - Intergenic
917927536 1:179801543-179801565 GAGGATTACCTGGGAAAATGGGG - Intronic
918332585 1:183473240-183473262 GGGGAATAGATGGGGAAGTGAGG + Intronic
919654745 1:200186120-200186142 GAGGATTACCTGGCCGTGTGAGG - Intergenic
920073545 1:203320957-203320979 GGGGAGGAGCTGGGGGAGGGGGG - Intergenic
920806911 1:209243361-209243383 AAGGATATGCTGGGGCAGTGAGG + Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922674912 1:227544079-227544101 GGGGCTGAGCTGGGGGAGTCAGG - Intergenic
923570608 1:235110242-235110264 GAGGGCTGGCTGGAGGAGTGAGG - Exonic
924172329 1:241356215-241356237 GGGGATGCGGTGGGGGAGTGGGG + Intronic
1062973588 10:1666399-1666421 GAGGATCACCTGGGCGAGAGAGG - Intronic
1064336627 10:14448837-14448859 GACGATCAGCTGGAGGAGAGGGG + Intronic
1065137744 10:22689163-22689185 GAGGGGCAGCTTGGGGAGTGAGG - Intronic
1066131945 10:32403052-32403074 GAAAATTAGCTGGGGGGGGGGGG + Intergenic
1066485474 10:35838807-35838829 GTGGAGTGGCGGGGGGAGTGAGG - Intergenic
1070065926 10:73034455-73034477 GAGGATTACCAGGGGTTGTGAGG - Intronic
1070606961 10:77905481-77905503 GATGATTAGCTAGGTGATTGTGG - Intronic
1071261723 10:83925633-83925655 GAGAATTGGCGGGGGAAGTGGGG + Intergenic
1071825970 10:89326443-89326465 GAGTAGTAGCGGGGGAAGTGGGG + Intronic
1073206944 10:101774584-101774606 GAGGGTCAGCTGGGGAAGAGAGG - Intronic
1075794196 10:125107194-125107216 GAGGCTGAGATGGGGCAGTGGGG - Intronic
1076667951 10:132103444-132103466 GAGGAGCAGCTGGGGGGGGGAGG + Intergenic
1077102253 11:827511-827533 GAGGATGGGCTGGTGGGGTGGGG - Intronic
1077241679 11:1513823-1513845 GGGGCTTCGCTGGGGGAGTCTGG + Intergenic
1077362207 11:2145703-2145725 GAGGAGCAGGTGGGGGAGTGGGG + Intronic
1078935701 11:15948292-15948314 GAGGCCTAGGTGGGGGAGGGTGG - Intergenic
1079102734 11:17551859-17551881 GAGGAGTGGCTGGGGCACTGAGG + Intronic
1079372679 11:19864916-19864938 CAGCATTAGCTGGGGTAGAGGGG - Intronic
1080267953 11:30421256-30421278 GAGGATTTCCTGGGGGAATATGG - Intronic
1081794977 11:45812722-45812744 GTGAATTTGCAGGGGGAGTGGGG + Exonic
1083767645 11:64849550-64849572 CAGGACTAGCTGGGGGACTGGGG - Intergenic
1083945660 11:65921235-65921257 GAGGGTCAGATGGGGGAGGGAGG + Intronic
1083998313 11:66283021-66283043 GACCACCAGCTGGGGGAGTGAGG - Exonic
1084164956 11:67371264-67371286 GAGAAGTAGCTTGGTGAGTGGGG + Intronic
1084950399 11:72662138-72662160 GAGGAGAAGCTGGGGCAGGGAGG + Intronic
1085310013 11:75510653-75510675 GAAGAAGAGATGGGGGAGTGGGG - Intronic
1085752519 11:79174172-79174194 GAGGATAAGCTGTGGGGGCGGGG - Intronic
1088863296 11:113821909-113821931 GAGGGTGGGGTGGGGGAGTGGGG + Intronic
1088975531 11:114813031-114813053 AAGGATGAGTTGAGGGAGTGTGG - Intergenic
1091204312 11:133809184-133809206 GAGGATTGGCTGGGGGAAATGGG - Intergenic
1091832087 12:3557122-3557144 GCAGATAGGCTGGGGGAGTGAGG + Intronic
1093552893 12:20436299-20436321 GGGGATTGGGTGGGGGAGAGGGG + Intronic
1096660065 12:53118753-53118775 GAGGATTATCTAGGGTGGTGGGG - Intronic
1097118747 12:56717512-56717534 GAGTTACAGCTGGGGGAGTGGGG + Intronic
1097118821 12:56717719-56717741 GAGTTGCAGCTGGGGGAGTGGGG + Intronic
1097119024 12:56718271-56718293 GAGTCGCAGCTGGGGGAGTGGGG + Intronic
1097818847 12:64106160-64106182 GAGGATTTGCTGGGAGAATGAGG + Intronic
1100910849 12:99360958-99360980 GAAGGGTAGCTGGGGGACTGCGG + Intronic
1103280916 12:119757323-119757345 GAGGATTTGCTGGGCGATTCGGG - Intronic
1103555785 12:121765774-121765796 GAGGAGGAGCTGGAGGAGGGCGG - Intronic
1106041394 13:26097015-26097037 GGGGATTTCCTGGGGGAGAGAGG + Intergenic
1107021283 13:35755068-35755090 GAAGATCAGTTGGAGGAGTGGGG - Intergenic
1108076078 13:46680930-46680952 CAGGAGTAGCTGGGGGTGTGTGG + Intronic
1108468839 13:50747696-50747718 TGGGATAGGCTGGGGGAGTGTGG - Intronic
1108719368 13:53115341-53115363 GAGGCTTAGCTAGGTGAGTTTGG + Intergenic
1109249317 13:59999795-59999817 GAGGAGGAGCTGGGGGAGGCTGG - Intronic
1109491995 13:63114081-63114103 GAGGATTAACTGGGGGACAAAGG - Intergenic
1112387105 13:98949911-98949933 GAGGAGCACCTGGGGGAGTTTGG - Intronic
1112486406 13:99824264-99824286 AAGGATTAGCTGGGGGTGGGTGG - Intronic
1113751369 13:112778645-112778667 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1113751458 13:112779257-112779279 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1113751468 13:112779311-112779333 GAGGAGTAGCCGCTGGAGTGAGG + Intronic
1113773375 13:112927106-112927128 GAAGTTTAGCTGGAGAAGTGGGG + Intronic
1114499944 14:23161271-23161293 GAGGGTTTGCTGGGGGAGGGAGG - Intronic
1117118038 14:52536450-52536472 GAGGTCTAACTGGAGGAGTGAGG - Intronic
1117473837 14:56073957-56073979 GGGGAGTGGCTGTGGGAGTGAGG - Intergenic
1119384177 14:74246820-74246842 GTAGATTAGGTGGGGGAGGGTGG + Intronic
1119837759 14:77766055-77766077 TAAGCTTAGATGGGGGAGTGTGG + Intronic
1121482437 14:94289568-94289590 GGGGATTATCTGGGGGATTTAGG - Intronic
1122009344 14:98732852-98732874 GAGGTCTAGCTGGTGGAGTCGGG + Intergenic
1122507535 14:102241259-102241281 GAGGATTAGCCTGGGGAGGAAGG - Intronic
1123054290 14:105561867-105561889 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123055480 14:105567335-105567357 GTGGATGAGCTGGAGGTGTGAGG + Intergenic
1123078874 14:105682286-105682308 GAGGCTTTCCTGGGGGAGGGCGG - Intergenic
1123079931 14:105687175-105687197 GTGGATGAGCTGGAGGTGTGCGG + Intergenic
1123111050 14:105866973-105866995 GGGGGTGAGGTGGGGGAGTGAGG + Intergenic
1123186170 14:106518849-106518871 GAGGATCAGCTGGTGGAGTCTGG - Intergenic
1124345638 15:28919765-28919787 CAGGATGACCTGGGGGAGCGGGG - Intronic
1124639868 15:31391089-31391111 GTGGATAATGTGGGGGAGTGTGG + Intronic
1125250849 15:37701376-37701398 GAGAATTAGCTTGTGGTGTGAGG - Intergenic
1126428018 15:48550418-48550440 GGTGATTAGGTGGGGGTGTGAGG - Intronic
1127840491 15:62827288-62827310 GAGGAGGAGCGGGGGCAGTGGGG + Intronic
1129265834 15:74392645-74392667 GAGGCCTGGCTGGGGGAGGGAGG - Intergenic
1129710559 15:77818649-77818671 AAGGTTCAGTTGGGGGAGTGCGG - Intronic
1130323216 15:82857133-82857155 TAGGATTAGGTGAGGGCGTGAGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132161713 15:99548805-99548827 GGGGATTGGGCGGGGGAGTGAGG + Intergenic
1132236679 15:100227346-100227368 GAGGATTGGAGGGGGTAGTGAGG - Intronic
1132320435 15:100920861-100920883 CTGGATCAGCTGGGGGTGTGAGG - Intronic
1132525303 16:411286-411308 GGGAATGAGCTGGGGGAGAGGGG + Intronic
1132684887 16:1158198-1158220 CAGGATCAGCTGTGGGGGTGGGG - Intronic
1132989835 16:2786951-2786973 GAGGATAAGGGAGGGGAGTGAGG - Intronic
1132989871 16:2787075-2787097 GAGGATGAGGGAGGGGAGTGAGG - Intronic
1132989914 16:2787209-2787231 GAGGATGAGGGAGGGGAGTGAGG - Intronic
1133580290 16:7138182-7138204 GAGGATCAGATGGGGCAATGAGG + Intronic
1134016369 16:10891263-10891285 GAGTCTTGGCAGGGGGAGTGGGG + Intronic
1134867472 16:17621094-17621116 GAAGGTAAGTTGGGGGAGTGAGG - Intergenic
1135158610 16:20074180-20074202 GAGGACACGCTGGAGGAGTGAGG - Intergenic
1135341967 16:21656181-21656203 CAGCATTAACTGGGGGGGTGGGG - Exonic
1135680344 16:24451063-24451085 GAGAATGAGATGGGGGTGTGGGG - Intergenic
1137083687 16:36097281-36097303 GAGGACTACCTGGCTGAGTGAGG + Intergenic
1139934273 16:70556970-70556992 CAGGATGAGCTGGGTGAGAGGGG + Exonic
1141432598 16:83978296-83978318 GGGGATTAGCTGGGAGGGTAGGG + Intronic
1141495499 16:84406837-84406859 GAGGATAACCAGGGGAAGTGGGG - Intronic
1142098399 16:88258416-88258438 GGGGGTAAGCTGGGGGGGTGGGG - Intergenic
1142413374 16:89927293-89927315 GAGGATCACCTGGGGGAGGTGGG + Intronic
1142455335 16:90218016-90218038 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1143001534 17:3798123-3798145 GAGAGCTGGCTGGGGGAGTGTGG - Intronic
1143300127 17:5902719-5902741 CAGTATTAGGTGGAGGAGTGTGG + Intronic
1143633282 17:8150774-8150796 GAGGCTTGGCTGAGGGAGTGAGG + Exonic
1143730822 17:8881778-8881800 CAGGAGGAGCTGGGTGAGTGGGG - Exonic
1144728885 17:17515414-17515436 GAGGAGCAGCTGGGGGACTGAGG - Intronic
1145102260 17:20086846-20086868 GAGGTTTTGCTGGGTGGGTGGGG + Intronic
1145690743 17:26736471-26736493 GAGGACTACCTGGCCGAGTGAGG - Intergenic
1145738170 17:27248347-27248369 AAGGATTAGCTGCGGGGGGGTGG - Intergenic
1145831333 17:27918945-27918967 GTGGAGTAGAGGGGGGAGTGTGG - Intergenic
1146343514 17:32041694-32041716 GAGGCTTATCTGGGTGGGTGGGG + Intronic
1146765065 17:35512906-35512928 GGGGGTTGGCTGGAGGAGTGAGG - Intronic
1148131181 17:45263421-45263443 GAGGCTAAGCTGGGGCAATGGGG + Exonic
1148553904 17:48566460-48566482 GAGGAAAAGCTGGTGGAGTGGGG + Intronic
1149547605 17:57515652-57515674 GAGGAAGCGATGGGGGAGTGTGG + Intronic
1150945642 17:69743032-69743054 GAGCATCAGCTGTGGCAGTGTGG + Intergenic
1151563353 17:74882834-74882856 GCGGATTAGCTGGGGCTGTAAGG - Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1151977469 17:77490698-77490720 GAGGCTCATCTGGGGGAGCGGGG - Intronic
1156381715 18:36567819-36567841 TGGGATTACCTGGGGGAGAGGGG - Intronic
1157692032 18:49691587-49691609 GAGGGTTGGCTGGAGGGGTGTGG + Intergenic
1157748338 18:50156983-50157005 AAGGATGACCTGGGGGAGGGTGG - Intronic
1161165912 19:2787269-2787291 GACAAAGAGCTGGGGGAGTGTGG - Intronic
1161687048 19:5708084-5708106 TGGCATTGGCTGGGGGAGTGGGG - Intronic
1161746928 19:6066110-6066132 GCGGAGGAGGTGGGGGAGTGAGG + Intronic
1162184485 19:8894366-8894388 TCTGATTAGCTGGGGCAGTGGGG + Intronic
1162725412 19:12687606-12687628 GTGCCTTGGCTGGGGGAGTGAGG - Intergenic
1163467245 19:17475383-17475405 AAAAATTAGCTGGGGGAGTGGGG + Intronic
1163512038 19:17741237-17741259 GTGGAGTGTCTGGGGGAGTGTGG + Intergenic
1164039793 19:21484124-21484146 GAGGATGACCTGGGTGAGTCCGG - Intronic
1164051066 19:21586335-21586357 GAGGGTTTGCTGGGGCAGGGTGG + Intergenic
1164452961 19:28382432-28382454 GAGGCTTAGTTTGGGGTGTGGGG - Intergenic
1165914265 19:39248169-39248191 GGGGCTTTGCTGGGGGAGCGCGG - Intergenic
1166551716 19:43669977-43669999 GAGGATGAGTTGGAGGAATGCGG - Intronic
1166673937 19:44727813-44727835 CAGGATGAGCTGGGGGAGAGTGG - Intergenic
1166679741 19:44759186-44759208 GAGGAGGGGCTGGGGGTGTGAGG - Intronic
1166966473 19:46532118-46532140 GAGGACTTGCTGGTGGAGGGAGG - Intronic
1167677612 19:50897201-50897223 GAGGGTTAGCTGAGGTTGTGAGG + Intergenic
1167705154 19:51077625-51077647 GAGGAGGGGCTGGGGGACTGGGG + Intronic
1168345713 19:55649306-55649328 GAGGGTGAGCTGAGGGGGTGTGG + Exonic
1168709436 19:58490274-58490296 TATGATTATCTGGGGGTGTGGGG + Intronic
924985329 2:264669-264691 GAGGAGGAGCTGCGGGGGTGGGG - Intronic
925662847 2:6221322-6221344 TAGGAATACCTGGGGGAGAGAGG + Intergenic
926049794 2:9737535-9737557 GAGGGGTTACTGGGGGAGTGAGG - Intergenic
927236772 2:20882071-20882093 CAGGCCTTGCTGGGGGAGTGAGG + Intergenic
927877759 2:26670270-26670292 GAGGAAGGGCAGGGGGAGTGAGG + Intergenic
927909196 2:26884646-26884668 AAGGATTAGCTGTGAGAGGGTGG - Intronic
927949217 2:27156021-27156043 GAGGCTTAGATGGGGCTGTGGGG + Exonic
928636290 2:33250518-33250540 CAGGATTAGCTGGGAGCCTGGGG + Intronic
929016964 2:37507227-37507249 GAGGCTCTGCTGGGGGAATGCGG + Intergenic
929090337 2:38210508-38210530 GAGGTTTAGCTAGGGTAGAGTGG - Intergenic
929437672 2:41940710-41940732 GGGACTTAGCTGGGGCAGTGGGG - Intronic
930542698 2:52727261-52727283 GATGATTAGATGAGGCAGTGCGG - Intergenic
931046822 2:58363149-58363171 GAGGATGAGCTGGAGCAGGGAGG - Intergenic
931677170 2:64708912-64708934 GAGGAATACCTGAGGGAGAGGGG - Intronic
931758579 2:65396118-65396140 GAGGATTAGATGGGATAATGTGG + Intronic
932745462 2:74330268-74330290 GAGGTCTAGATGGAGGAGTGTGG + Intronic
933968465 2:87450628-87450650 AAGGATTTGCTGGGGAAGAGGGG - Intergenic
934512861 2:94961324-94961346 GAGGTTCAGCTGGTGGAGTCTGG - Intergenic
934562653 2:95321029-95321051 GAGGAGAGGCTGGGGGTGTGGGG - Intronic
935849118 2:107199482-107199504 GAGGCTGAGGTGGGGGACTGGGG - Intergenic
936325327 2:111499876-111499898 AAGGATTTGCTGGGGAAGAGGGG + Intergenic
937325021 2:120985229-120985251 GTGGGTGGGCTGGGGGAGTGAGG + Intronic
937485145 2:122308001-122308023 GAGCATGGGCAGGGGGAGTGAGG - Intergenic
938024526 2:127935038-127935060 AAAAATTAGGTGGGGGAGTGTGG - Intergenic
940674704 2:156714190-156714212 GATGAGCAGCTGGGGGTGTGTGG + Intergenic
943679779 2:190756100-190756122 GTGGCTTAGCTGGGTGATTGTGG + Intergenic
946493270 2:220170744-220170766 CAGGGTTGGCTGGGGGGGTGTGG + Intergenic
946637685 2:221747679-221747701 GAGGATTAGATGGAGTAATGTGG + Intergenic
948097475 2:235347686-235347708 GGGGATTGGCTTGAGGAGTGAGG - Intergenic
948147115 2:235716201-235716223 GAGGATCAGCTGGAGATGTGAGG + Intronic
948285612 2:236782385-236782407 GAGGATATGCCGGGTGAGTGAGG + Intergenic
949086816 2:242162742-242162764 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1169111775 20:3038779-3038801 CAGGAGGAGCTGGGGGACTGTGG - Intronic
1170029825 20:11933078-11933100 GAGGATTGGCTGGAAGAGGGAGG + Intergenic
1170458632 20:16556098-16556120 GAAGATGAGCTGGGGAGGTGGGG - Intronic
1170701292 20:18705988-18706010 GGGGATTAGCTTAGTGAGTGTGG + Intronic
1170914126 20:20606042-20606064 GAGAAAGAGCTGGGGAAGTGGGG - Intronic
1172029185 20:31969346-31969368 GACCCTTAGCTGGGGGAGAGGGG - Intronic
1172624582 20:36339953-36339975 GAGGCTGGGTTGGGGGAGTGAGG + Intronic
1173165069 20:40682416-40682438 CAGGAAGAGCTTGGGGAGTGGGG + Intergenic
1173730242 20:45323360-45323382 GAGCATTAGCTGGGCGATTCTGG - Intergenic
1174360859 20:50028097-50028119 GGGGATAATCTGGGGGAGGGAGG + Intergenic
1174526955 20:51180144-51180166 GGGGAGTAGCTGGGAGAGTGGGG - Intergenic
1177195547 21:17900695-17900717 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
1178801714 21:35801552-35801574 GAGCATCAGCTGTGGTAGTGTGG - Intronic
1179426811 21:41286597-41286619 GATGATTAACTGGGGGAGACTGG - Intergenic
1180031382 21:45210860-45210882 GGGGAGCAGCCGGGGGAGTGGGG - Intronic
1180843903 22:18971258-18971280 GAGGCTTGGCTGGGGGAATCAGG + Intergenic
1181057571 22:20267449-20267471 GAGGCTTGGCTGGGGGAATCAGG - Intronic
1181107700 22:20584670-20584692 GAGGATAGGCTGTGGGGGTGGGG + Intronic
1182133668 22:27880060-27880082 GAGCATTAACTGGGAGAATGTGG - Intronic
1182792252 22:32962566-32962588 GCGAGTTAGCTGTGGGAGTGAGG + Intronic
1183266500 22:36829615-36829637 GAGGAGTAGCTGAGGCAGAGAGG + Intergenic
1183306276 22:37084758-37084780 GAGTAGTAGCTGGGGAAGTACGG + Exonic
1183411147 22:37655621-37655643 GGGGGATAGCTGGGGGAGTGGGG - Exonic
1183759760 22:39805408-39805430 GAGAATTAGCTGAGCGAGGGTGG + Intronic
1184413500 22:44338981-44339003 GAGGAGGAGCTGGGAGACTGTGG - Intergenic
949347019 3:3085812-3085834 GAGTTTGAGCTGGTGGAGTGGGG - Intronic
949914169 3:8944564-8944586 GAGGAATAGACGGGGGAGGGAGG + Intronic
950528150 3:13536596-13536618 AAGGATGGGCTGGAGGAGTGGGG - Intergenic
950540490 3:13609466-13609488 GAGGATGAGGTGGGCGACTGGGG + Intronic
951041011 3:17988958-17988980 GAGGATAGGCTGGGGGCTTGGGG - Intronic
953841813 3:46395471-46395493 GGGGATTGGCTGTGGGAGAGAGG + Intergenic
953880145 3:46687213-46687235 GGGGATTAGCTGGGGCAGGGAGG - Intronic
953912896 3:46901752-46901774 GAAGTTGAGCTGTGGGAGTGAGG - Exonic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG + Intronic
954446440 3:50549406-50549428 GGGGAGGAGCTGGGGGAGAGAGG + Intergenic
954705873 3:52480263-52480285 GAGGATGGGCTGGGGCAGGGAGG - Exonic
955107934 3:55917638-55917660 GAGGAAGGGCAGGGGGAGTGTGG + Intronic
959715703 3:109430960-109430982 GAGCATTAGCTGTGGTAGTATGG + Intergenic
960741789 3:120842410-120842432 GAGCAATAGATGGGAGAGTGAGG - Intergenic
960767965 3:121158716-121158738 GGGGGTTAGCTGGGGGTGTGTGG - Intronic
961135289 3:124504509-124504531 GTGGATTTGCTGGGGCAGAGTGG - Intronic
961191663 3:124967639-124967661 GCAGAGTAGCTGGGGGAGTCAGG + Exonic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
963138387 3:141928532-141928554 CAGGTTGAGCTGAGGGAGTGTGG + Intergenic
963768835 3:149367811-149367833 GATAAATAACTGGGGGAGTGGGG + Intergenic
963847811 3:150177765-150177787 CAGGGTTAGCTGGTGGGGTGTGG + Intergenic
964291458 3:155185627-155185649 GAGGACCAGGTGGGAGAGTGTGG - Intergenic
965061009 3:163786230-163786252 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
965483200 3:169245710-169245732 GAGGATTATGTAGGGAAGTGTGG - Intronic
967100177 3:186209888-186209910 GAGGATTAGCTGGGGGAGTGGGG - Intronic
968456407 4:702803-702825 GAGGATTGACTGGGGGTGGGGGG + Intergenic
974209174 4:58747279-58747301 GAGGAATAGTTGGGGGTGGGGGG - Intergenic
975054924 4:69918269-69918291 GAGGGTGAGCTGAGGAAGTGAGG - Intergenic
977985626 4:103379733-103379755 AAGGATGAGGTGGGGGAGGGTGG + Intergenic
978897832 4:113910980-113911002 CAGGAGTATCTGGGTGAGTGTGG + Intronic
979135256 4:117103435-117103457 TAAGATTAGATGGGGGATTGTGG - Intergenic
980679219 4:136134709-136134731 AAGGATTAGATGGGTGAGTGAGG - Intergenic
981032820 4:140142970-140142992 GAGGATTAGTTGGTGTGGTGGGG - Intronic
983364989 4:166775092-166775114 TATGACTATCTGGGGGAGTGAGG + Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983557160 4:169068824-169068846 GAGGAGGAGATGAGGGAGTGTGG + Intergenic
984541570 4:181043644-181043666 GAGGAATAGCGTGGGAAGTGTGG - Intergenic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
985217717 4:187671743-187671765 GAGCATCAGCTGTGGTAGTGTGG + Intergenic
985380384 4:189388797-189388819 GAGGATTAGATGAGGTTGTGAGG + Intergenic
985470683 5:42504-42526 CAGGATTACCTGGGAGAGGGTGG + Intergenic
985917953 5:2940829-2940851 GACTATTAGATGGGGGAGGGAGG - Intergenic
986376968 5:7142177-7142199 GAAGATTTCCTGAGGGAGTGAGG - Intergenic
988119052 5:26936086-26936108 GAGGATTTGGTGGGGAAGAGTGG + Intronic
989351077 5:40487400-40487422 GAGGATTAGGTAGTGTAGTGTGG + Intergenic
990084040 5:51952499-51952521 GAGGATTACCTGGCCGTGTGAGG - Intergenic
992141012 5:73796929-73796951 GATGAATTGCTGGGGGAGGGAGG + Intronic
992696419 5:79292786-79292808 GATGATTATCTTGGGGAGTGGGG + Intronic
993471541 5:88313376-88313398 GAGGAGTACCTGGGTGTGTGAGG + Intergenic
993538616 5:89119943-89119965 CAGGATTTGGTGGTGGAGTGTGG + Intergenic
997598235 5:135121272-135121294 GAGGATTAGAATGGGGAGTGAGG + Intronic
997712840 5:136020587-136020609 AAGGATTGGCGGGGGGAGTTTGG - Intergenic
997919327 5:137963702-137963724 GGTGAGCAGCTGGGGGAGTGGGG + Intronic
997977135 5:138447036-138447058 AGGGTTCAGCTGGGGGAGTGGGG + Intergenic
1001129001 5:169047759-169047781 GAAGAGCAGCTGGGGAAGTGAGG - Intronic
1001548996 5:172588478-172588500 GGGGCTTAGCTGGGGGAGCAAGG + Intergenic
1001962360 5:175887246-175887268 GAAGATCAGCTGGGGCTGTGAGG + Intergenic
1002500955 5:179647350-179647372 AAAGATTATGTGGGGGAGTGGGG + Intergenic
1002541075 5:179907171-179907193 GAGGAGAAGCTGGGGGAATGGGG + Intronic
1003184003 6:3814666-3814688 GAGGCTGGGCTGGGAGAGTGGGG + Intergenic
1004831253 6:19478636-19478658 TAGAAGGAGCTGGGGGAGTGGGG - Intergenic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1005967255 6:30735512-30735534 GAGGATTACTTGGGAGGGTGAGG + Intronic
1006390276 6:33754279-33754301 GAGGATTAACTTGGGGAATGGGG + Intergenic
1006629168 6:35418922-35418944 AAGGGGAAGCTGGGGGAGTGGGG + Intronic
1006930631 6:37685896-37685918 GAGGATAGGCTGGCAGAGTGGGG + Intronic
1007016510 6:38473045-38473067 GAGGATTGGCTGGGGAGGTGAGG + Intronic
1007073596 6:39053269-39053291 GAGGATGAAATGGAGGAGTGGGG + Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1008393373 6:50978835-50978857 TAGGTGAAGCTGGGGGAGTGGGG + Intergenic
1008448255 6:51619004-51619026 GATAATAAGCTGGGGAAGTGAGG - Exonic
1008978558 6:57457160-57457182 GAGGAGTAGCTGGCTGTGTGAGG + Intronic
1010076335 6:71803216-71803238 GAGTATTAGCTGTGGTAGTATGG + Intergenic
1010427589 6:75744135-75744157 GGGGATTATCTGAGGCAGTGAGG + Intergenic
1010769593 6:79812992-79813014 GAGGATTTGTTGGTGGCGTGTGG - Intergenic
1010821598 6:80421397-80421419 GAGAATTAGCACTGGGAGTGGGG + Intergenic
1012115644 6:95294367-95294389 TAAGGTTACCTGGGGGAGTGAGG - Intergenic
1013156000 6:107491133-107491155 GAGGGTGAGCTGGGGGAGAGGGG - Intronic
1013435596 6:110102125-110102147 GTGGAGGAGGTGGGGGAGTGGGG + Exonic
1013660795 6:112294790-112294812 GAGGAGTAACTGAGGCAGTGAGG + Intergenic
1015117620 6:129666642-129666664 GAGAAGTAGCTGGGGAAGGGTGG - Intronic
1015916474 6:138222521-138222543 AAGGAGGAGCTGGGGGAATGGGG + Intronic
1018831346 6:167446051-167446073 GGGGATTAGCTGGGGGATAATGG - Intergenic
1019091350 6:169537562-169537584 GAGTATCAGATGGGGGAGAGTGG + Intronic
1019707572 7:2503822-2503844 GAGGATCAGCTGGGGGTGGATGG - Intergenic
1020072129 7:5234049-5234071 AAAAATTAGCTGGGGGGGTGGGG + Intergenic
1022371321 7:29774293-29774315 GAGGAGTTGGTGGGGGAGTGTGG - Intergenic
1022743680 7:33148320-33148342 GAGGATCAACAGGGGAAGTGTGG + Intronic
1023449175 7:40263934-40263956 GAGGTTTAGCTGGAGGTGTATGG + Intronic
1023850395 7:44146745-44146767 GTGAACCAGCTGGGGGAGTGGGG - Intronic
1023908280 7:44537042-44537064 GAGGGTGAGCTGGTGGGGTGGGG + Intronic
1024283810 7:47739953-47739975 GATGATTAACTGGGGGCGGGGGG - Intronic
1025904043 7:65770315-65770337 GAGGTCAAGCTGGGGGGGTGCGG + Intergenic
1026982428 7:74534592-74534614 GAGGCAGAGCTGGGGGAGCGAGG + Intronic
1030171771 7:106609909-106609931 GAGGATTACCTGGGCCAGGGAGG - Intergenic
1030190675 7:106807448-106807470 GAGGGTGAGCTGTGGGTGTGAGG - Intergenic
1030444987 7:109638044-109638066 GAGGAATGGTTGGGGGGGTGGGG + Intergenic
1030748969 7:113205751-113205773 TAGCATCAGCTGGGGCAGTGGGG - Intergenic
1031072680 7:117179685-117179707 GTGAGTTAGCTGGGGGTGTGGGG + Intronic
1032390742 7:131553998-131554020 GAAGGTAAGCTGGGGGAGAGGGG + Intronic
1034417357 7:150972097-150972119 GAGGCTAGACTGGGGGAGTGTGG - Intronic
1035497893 8:68527-68549 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
1035651572 8:1269698-1269720 CAAGATTGGCTGGGGGAGGGGGG - Intergenic
1035658543 8:1330120-1330142 GAGGTGTGGCTGTGGGAGTGAGG + Intergenic
1037094606 8:14969525-14969547 GAGGCTAAGCTTGGGGACTGGGG - Intronic
1037583767 8:20262327-20262349 GAGGATCAGGTGGGGAAGAGGGG + Intronic
1039778567 8:40761046-40761068 GAGGGTGGGCTGGGGCAGTGGGG + Intronic
1040461339 8:47651943-47651965 GAGACTTAGATGGGGGAGAGTGG + Intronic
1041357246 8:57014039-57014061 CAGGATGAGCTGGGGCAGAGAGG - Intergenic
1046872194 8:119215792-119215814 GATGATGAGCTTGGGGAGGGGGG + Intronic
1048270207 8:133022225-133022247 GAGGAGGAGCAGGGGCAGTGAGG - Intronic
1048856078 8:138687672-138687694 GAGGATTAGCTGAGGAATTGGGG - Intronic
1049048462 8:140171922-140171944 GAGGAGTATCTGGCGGCGTGAGG + Intronic
1049691830 8:143964974-143964996 GGGGGTTGGTTGGGGGAGTGGGG - Intronic
1050171835 9:2827899-2827921 TAGTAATAGTTGGGGGAGTGGGG + Intronic
1050336382 9:4593941-4593963 GAGGAGTATCTGGTGGAGAGAGG - Intronic
1051826702 9:21230105-21230127 TAGGATTATTTGGGGGAGAGAGG - Intronic
1052947503 9:34179620-34179642 GAGGGTGAGCTGGGGACGTGCGG + Intronic
1053010526 9:34630338-34630360 GAGGATTCCCGGGAGGAGTGGGG - Intergenic
1053125699 9:35579164-35579186 GGGGAATTGCTGGGGGAGGGTGG - Intergenic
1056067380 9:82950904-82950926 GAAAATTTGCTGGGGGAGAGGGG - Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1057165277 9:92920724-92920746 CAGGCTTGGGTGGGGGAGTGGGG - Intergenic
1057825609 9:98370207-98370229 CAGGACTAGCTGGAGGGGTGAGG + Intronic
1057995437 9:99819163-99819185 GAGGATTAGGGGGGTGAGGGAGG + Intergenic
1059153154 9:111967121-111967143 CAGGATCTGCTGGGGGAGGGAGG - Intergenic
1060397242 9:123324857-123324879 GAGGGCAAGCTGGGGGTGTGAGG + Intergenic
1061521489 9:131120838-131120860 GGGGATCAGCTGGGGCAGCGGGG - Exonic
1061914017 9:133739684-133739706 GAGGCTTACCTGGGGTGGTGTGG + Exonic
1062446731 9:136598371-136598393 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446759 9:136598469-136598491 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446773 9:136598518-136598540 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446806 9:136598641-136598663 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1203371782 Un_KI270442v1:313625-313647 GAAGATAAGCAGGGCGAGTGTGG - Intergenic
1185480973 X:445996-446018 AGGGAGTAGCTGGGGGAGTCAGG + Intergenic
1188324536 X:28784904-28784926 GAGGATTAACTGGGGAATTCTGG - Intronic
1189316630 X:40061543-40061565 GAGGATGAGCAGGGGGGCTGGGG + Intronic
1190471251 X:50781762-50781784 CAGGATGAGGTGAGGGAGTGAGG - Intronic
1190587792 X:51964740-51964762 GAGGAGTACCTGGTGGTGTGAGG + Intergenic
1191808662 X:65163139-65163161 GAGGAATACCTGGGCGTGTGAGG + Intergenic
1192467565 X:71367990-71368012 GGGAATTATCTGAGGGAGTGAGG + Intronic
1192580815 X:72279420-72279442 GAGAAGTTGCTGTGGGAGTGGGG + Intronic
1192678449 X:73225361-73225383 GAGGGCTGGCTGGAGGAGTGAGG + Intergenic
1192743413 X:73915137-73915159 GTGGATTTGCTGGGGGAGAGAGG + Intergenic
1192931369 X:75810171-75810193 GAGGATTACCTGGCCGTGTGAGG + Intergenic
1192947933 X:75985825-75985847 GAATATTAGCTGGAGGAGAGAGG + Intergenic
1193380502 X:80810856-80810878 CAGGTTTAGGTGAGGGAGTGGGG - Intergenic
1196849060 X:119920163-119920185 GAGGATTAGTTGCTGGAGTGGGG + Intronic
1197163261 X:123347179-123347201 GTGGATGAGCTGGCAGAGTGGGG + Intronic
1199285214 X:146047175-146047197 GAGGAGTTGGTGGGGGTGTGGGG + Intergenic
1202059091 Y:20867527-20867549 GAGGAGTACCTGGGCGTGTGAGG + Intergenic