ID: 967101600

View in Genome Browser
Species Human (GRCh38)
Location 3:186220642-186220664
Sequence GGTCCCAGCCAACCTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967101600_967101606 21 Left 967101600 3:186220642-186220664 CCAGCTTGAGGTTGGCTGGGACC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 967101606 3:186220686-186220708 CATGATCTGGGCCTCCCCATTGG 0: 1
1: 0
2: 4
3: 21
4: 138
967101600_967101604 9 Left 967101600 3:186220642-186220664 CCAGCTTGAGGTTGGCTGGGACC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 967101604 3:186220674-186220696 TTTAGCAGAGTCCATGATCTGGG 0: 1
1: 0
2: 1
3: 10
4: 113
967101600_967101603 8 Left 967101600 3:186220642-186220664 CCAGCTTGAGGTTGGCTGGGACC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 967101603 3:186220673-186220695 CTTTAGCAGAGTCCATGATCTGG 0: 1
1: 0
2: 1
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967101600 Original CRISPR GGTCCCAGCCAACCTCAAGC TGG (reversed) Intronic
900941025 1:5798666-5798688 GGTCCCAACAATCCTCAGGCCGG + Intergenic
902386790 1:16080489-16080511 GGTCCAAGCCATCATCATGCTGG + Intergenic
902685879 1:18077436-18077458 GGTCCCAGCCAGCCCCAGGGAGG + Intergenic
902724063 1:18323614-18323636 GGTCCCAGGCTCCCTGAAGCGGG + Intronic
903320551 1:22540634-22540656 CCTCCCAGGCATCCTCAAGCAGG - Intergenic
903577527 1:24347931-24347953 GCCCCCAGCCAACCACAAGCAGG - Intronic
904821274 1:33246252-33246274 GGTCCCAGCCACCCTGGAGTTGG - Intergenic
905461675 1:38126433-38126455 GGTCCCAGCCAGGCTGAGGCAGG + Intergenic
906722560 1:48019789-48019811 GGGCCCAGCCAAGCCCAAGGAGG + Intergenic
915550135 1:156627578-156627600 GGCCCCACCCAACCACAAGGGGG + Intergenic
916353231 1:163875841-163875863 GGTCCCAGACAACCTCACCCAGG - Intergenic
918216911 1:182399778-182399800 GGGCCCAGTCAGCTTCAAGCTGG + Exonic
922528978 1:226328537-226328559 GGTCCCAGGCTTCCTCAACCAGG - Intergenic
922791501 1:228313716-228313738 GGTCCCATCCAGCCACCAGCGGG - Intronic
1064751837 10:18538209-18538231 GCTCACAGGCATCCTCAAGCTGG - Exonic
1065317890 10:24482477-24482499 GTTCCCACCCAACCTAAAGATGG + Intronic
1066043669 10:31578377-31578399 GCTCCCTGCCAGCCTCCAGCAGG + Intergenic
1069522694 10:69137317-69137339 GGACCCAGCTAACCTCCACCTGG - Intronic
1070421623 10:76243096-76243118 CTTCCCAGCCAAGCTCATGCTGG + Intronic
1070724946 10:78781459-78781481 GGTCCCAGCCAATGTGAACCTGG - Intergenic
1070746538 10:78937148-78937170 GGACACAGCCAGCCTCAAGGTGG - Intergenic
1076588610 10:131568255-131568277 GGTCCCATCCAACCTTCAGCAGG + Intergenic
1081851078 11:46275708-46275730 ATTTCCAGCCAACCTCAGGCGGG + Intergenic
1084463416 11:69308742-69308764 AGAGCCAGGCAACCTCAAGCAGG - Intronic
1084654153 11:70505543-70505565 GGTCCCAGCCCATCTCAAGGTGG - Intronic
1085247013 11:75110015-75110037 GGTCCCAGCCAGCTTGCAGCAGG + Intronic
1086817826 11:91394943-91394965 TGTCCAAGCCAACCTGAAACAGG + Intergenic
1096496898 12:52043851-52043873 GGTCCCAGACAACCGCACGAAGG - Intronic
1096526590 12:52213556-52213578 GGACCCAGCCAGCCTCAAGGAGG - Intergenic
1096770677 12:53934207-53934229 GGTCCCATCTTCCCTCAAGCTGG + Intergenic
1102514196 12:113435440-113435462 GCTGCCAGCCCACCTCCAGCAGG - Exonic
1103848968 12:123918675-123918697 GGTCTCAGAGAAACTCAAGCTGG + Exonic
1104282456 12:127390450-127390472 GGTCCCAGCTGAGCTCAAGCTGG + Intergenic
1107016042 13:35708302-35708324 GGCCTCAGCCAACCCCACGCAGG - Intergenic
1110992263 13:82057205-82057227 GCTGCCAGCCAACATAAAGCAGG - Intergenic
1112287305 13:98115731-98115753 GGTCCGAGCAAACAACAAGCCGG + Intergenic
1113053160 13:106236895-106236917 GATCCCAGCCAACTGCAAGAGGG + Intergenic
1113935514 13:113992563-113992585 CCTCCCAGCCAACATCCAGCTGG - Exonic
1115443439 14:33462371-33462393 GGTCCCACCCGACCTCAAAGGGG - Intronic
1118856999 14:69631220-69631242 AGTCCCACCCCACCTCAAGGGGG + Intronic
1121243049 14:92443494-92443516 GGTCCCAGCCAACCTGACCTTGG - Intronic
1121351655 14:93178187-93178209 GGCCCCAGCCAAGCCAAAGCAGG - Intergenic
1122065400 14:99169929-99169951 TGACCCAGCCGACCTCAGGCCGG - Exonic
1122542012 14:102504009-102504031 GGTCCCTGCCCACCTCACCCAGG + Exonic
1126233356 15:46353831-46353853 GATCCCAGCCATCCTCACCCTGG + Intergenic
1128081169 15:64857761-64857783 TGGCCCAGCCCACCTGAAGCAGG - Intronic
1128381135 15:67113971-67113993 GGTCCCAACTAACCTCAACCTGG - Intronic
1129962406 15:79699212-79699234 GCTGCCAGCCAACATAAAGCAGG - Intergenic
1131195467 15:90351768-90351790 GGTCCCAGACCAACTCAAACTGG - Intergenic
1135769824 16:25208959-25208981 TGACCCAGCAAACCTCAAACTGG - Intergenic
1138435963 16:57000240-57000262 TGTCCCAGCCAGGCTCAGGCTGG + Intronic
1139590178 16:67928985-67929007 GGTCCCACTGAGCCTCAAGCTGG + Exonic
1141319149 16:82990410-82990432 GGTCCCAGCCCATCACAAGATGG - Intronic
1142209327 16:88800648-88800670 GGGACCAGACAACCTCCAGCAGG - Intergenic
1142957232 17:3530267-3530289 GGGCCCAGCCAGCCTCTGGCTGG - Intronic
1144178515 17:12731148-12731170 GCTCCCAGCCAGCCTCATGCTGG + Intronic
1144661521 17:17073749-17073771 GTGCCCAGCAAACCTCAAGGTGG - Intronic
1144702106 17:17346805-17346827 GGGCCGAGCCAACCCCCAGCTGG + Exonic
1144779663 17:17801433-17801455 GGCCCCAACCACCCTCAGGCAGG - Intronic
1149994847 17:61400992-61401014 GGGCCCAGCTAACCCCACGCTGG + Intronic
1150765895 17:68002014-68002036 GGTCTCAGCTCACCGCAAGCTGG + Intergenic
1152705087 17:81839244-81839266 GCTCCCAGCTCACCTCCAGCAGG - Intergenic
1155957120 18:31963480-31963502 GCTTCCAGCCAACCTCATCCAGG + Intergenic
1156883530 18:42108266-42108288 GGTCCAAGCCAGCCTGGAGCTGG - Intergenic
1161018726 19:1997559-1997581 GCTCCCTGCCAGCCTCCAGCAGG + Intronic
1161592233 19:5134082-5134104 GGTCCCAGAGAACCCCAGGCAGG + Intronic
1161759439 19:6160489-6160511 GGTTCCAGCCAACTTCATGAAGG + Intronic
1162597087 19:11638027-11638049 GGTCCCAGTGATCCTCAAGTGGG - Intergenic
1162718107 19:12646679-12646701 GGACCCGGCCAACATCACGCTGG - Exonic
1165214945 19:34264305-34264327 TGTCCCAGCCAGCCTGAGGCAGG + Intronic
1166766486 19:45254342-45254364 GGTGCCATCCCACCTCCAGCTGG + Intronic
1166913310 19:46176726-46176748 GGTCCCTGCCACCCTGCAGCAGG + Intergenic
925215012 2:2086906-2086928 GCCCCCTGCCAACCTCATGCAGG + Intronic
925748128 2:7062074-7062096 GTTCCCAGCCCACCCCGAGCTGG - Intronic
927092037 2:19719541-19719563 GTTCCAAGCAAACCCCAAGCGGG - Intergenic
931542653 2:63346535-63346557 GCTCCCAGCCAATCCCCAGCAGG + Intronic
931666937 2:64616300-64616322 GGTCCCAGGCAACCCCACTCTGG - Intergenic
935112503 2:100105441-100105463 GGTCCCACCCACCCTCTAGCTGG + Intronic
935128846 2:100246332-100246354 GATCCCATCCAACCACAAGGGGG - Intergenic
937453782 2:122024251-122024273 TCACCCAGCCAACCTCAAGCAGG + Intergenic
940396856 2:153199423-153199445 GGTCCCAGACATCCTCAATGTGG - Intergenic
941027009 2:160467956-160467978 GGTACAAGAAAACCTCAAGCAGG + Intronic
944679498 2:202064269-202064291 GTTCCCAGCCAGCAACAAGCTGG - Intergenic
946179762 2:217942353-217942375 AGTCCAAGCCAACCCCAAGTTGG + Intronic
946199648 2:218064396-218064418 AGTCCAAGCCAACCCCAAGTTGG + Intronic
946326403 2:218986661-218986683 GTTTCCAGCCATCCTCAATCAGG - Intergenic
948825327 2:240571086-240571108 GGTCCCAGCCCCCCCCAAGGGGG + Intronic
1169186143 20:3618884-3618906 TGTCACAGCCAAACTCAAGGAGG + Intronic
1171426260 20:25050620-25050642 GGCCCCAGCCAAGATGAAGCAGG + Intronic
1172240593 20:33410168-33410190 GGTGACAGCCATCCACAAGCTGG + Exonic
1172933431 20:38601812-38601834 GTTCCCAGACACCCTCATGCAGG - Intergenic
1174395287 20:50243302-50243324 AGTCCCCGCCGACCACAAGCGGG - Intergenic
1174955295 20:55091178-55091200 GGTCCCAGGCAAACTCAGGTGGG - Intergenic
1178235149 21:30833436-30833458 GGTTCCAACTCACCTCAAGCTGG + Intergenic
1179883691 21:44304446-44304468 GGTCCAAGCCCACCTCTGGCAGG - Intronic
1181592368 22:23893358-23893380 GGCACCAGCCAGCCTCCAGCTGG - Intronic
1184345347 22:43909618-43909640 AGCACCAGCCAAGCTCAAGCTGG - Intergenic
1184649360 22:45912611-45912633 GGCCCCAGGCAATCTCCAGCAGG + Intergenic
1184673710 22:46028820-46028842 GGTCCTTGGCAACCTCATGCCGG - Intergenic
1185389120 22:50549345-50549367 GGCCCGAGCCCAGCTCAAGCTGG + Exonic
950464536 3:13145549-13145571 TGCCCCAGCCAGTCTCAAGCAGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953899931 3:46834136-46834158 GGTTCCAGCCAACCCCTGGCAGG - Intergenic
954434945 3:50490974-50490996 GGGCCCTGCCAACCCCAGGCAGG - Intronic
954860414 3:53683927-53683949 AGGCCCAACAAACCTCAAGCAGG + Intronic
965178229 3:165364431-165364453 TTTCCCAGCCACCCTCAAGAGGG + Intergenic
965693528 3:171382578-171382600 GGCCCCAGCCAGCTTCAAGAGGG - Intronic
966881631 3:184354108-184354130 GGCCCCAGCCGAGCTCAGGCAGG + Exonic
967101600 3:186220642-186220664 GGTCCCAGCCAACCTCAAGCTGG - Intronic
968445122 4:648572-648594 TGTCCCAGGCACCCTCCAGCTGG + Intronic
969197929 4:5577923-5577945 AGCCCCAGCCCACCTCAAGAAGG + Intronic
969358382 4:6645288-6645310 GGGCCCACCCAACCCCAAGGGGG - Intergenic
969681539 4:8645896-8645918 GGTGACAGCCACCCTCCAGCAGG + Intergenic
969726213 4:8920017-8920039 GTTCTCTGCCAACCTCAGGCAGG - Intergenic
970376192 4:15459624-15459646 GGACCCAGCCAACTTCATGACGG - Intergenic
976086972 4:81416879-81416901 AGGCCCAGCCCACCTCAAGATGG - Intergenic
979591764 4:122489224-122489246 GTTCCCAGACAAGCACAAGCTGG - Intergenic
979756672 4:124349276-124349298 GGTCCCAGCCAAAATGATGCTGG - Intergenic
986350813 5:6878051-6878073 GTTCCCAGCCACCCTCAGGCAGG + Intergenic
999277555 5:150341468-150341490 GCAGCCAGCCAACCTCCAGCAGG - Intergenic
1001197556 5:169687011-169687033 GGTCCCATCCATCCTCACCCAGG - Intronic
1001401049 5:171446607-171446629 GGGCCCAGACAACCCCAAGTAGG - Intronic
1002025183 5:176392087-176392109 GGTCCCAGCCAACCCTAAGGAGG + Intronic
1003254629 6:4464115-4464137 GGTTCCAGCCAACTGCTAGCAGG - Intergenic
1004981645 6:21031196-21031218 GGTCCCAGCCAGCAGCTAGCAGG - Intronic
1006147661 6:31969068-31969090 GCTCCCAAACACCCTCAAGCAGG + Exonic
1006910538 6:37560613-37560635 GGCCCCATCCAACCACAAGGGGG - Intergenic
1007418375 6:41705318-41705340 GGTCCTTGCCAACCTCAGGTGGG - Intronic
1007966512 6:46008375-46008397 GGTCCCACCCTACCCAAAGCTGG + Intronic
1007978837 6:46129935-46129957 GGTCCCAGCCAGCCCTGAGCTGG + Intergenic
1012769848 6:103418385-103418407 AGCCCCAGCCAACCTCATGGAGG - Intergenic
1013617402 6:111857996-111858018 GATCCCAGCCAGCCTCCAGCAGG + Intronic
1015933507 6:138385625-138385647 GGGCCCAGCCTGCCTTAAGCAGG - Intergenic
1016774196 6:147886511-147886533 GGTCCCACCCACACTCAAGGGGG - Intergenic
1016866447 6:148772370-148772392 AGGCCCAGCCAACCCCAAGCAGG - Intronic
1016881925 6:148920159-148920181 GGTCTCAGCCAATCACAAGCCGG - Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1023746906 7:43330333-43330355 GTTTCCAGCCATCCTCAACCAGG + Intronic
1024803646 7:53110401-53110423 GGTCCCATTCAACTGCAAGCAGG - Intergenic
1031254244 7:119428064-119428086 GGTTCCATCCAATCTCAGGCAGG - Intergenic
1032092015 7:128915853-128915875 GGACCAAGCCAGCCTCCAGCAGG + Intergenic
1032095916 7:128938440-128938462 GGTCCAAGCCAGCCTCCAGCGGG - Intronic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1044802333 8:95970396-95970418 GGTCCAAGACAAGCCCAAGCGGG - Intergenic
1050138813 9:2496126-2496148 GGGCTCTGCCAGCCTCAAGCAGG + Intergenic
1054808113 9:69412417-69412439 GGTCCCAGCCAATCTGATGGGGG - Intergenic
1059389617 9:113990732-113990754 GGCCCCACCCAACCTCAAAGAGG + Intronic
1061152301 9:128835856-128835878 GGACCCAGCCCACCTGCAGCAGG + Exonic
1061609176 9:131735005-131735027 GCTCCCAGCGAACCACAGGCTGG - Intronic
1061902451 9:133679964-133679986 GGTTCCAGCCAACCAGATGCAGG - Intronic
1061926068 9:133806645-133806667 GGTCCAAGCCAGCCTCATCCAGG + Intronic
1062406475 9:136399235-136399257 GGCCCCAGTCAGCCTCCAGCAGG - Intergenic
1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG + Intergenic
1185564082 X:1082769-1082791 AGGCACAGCCACCCTCAAGCTGG - Intergenic
1187531722 X:20103141-20103163 GGTCCCTGCCAACCTTTTGCTGG + Intronic
1192175377 X:68881671-68881693 TGTCCTGGCCAATCTCAAGCTGG + Intergenic
1197406208 X:126054372-126054394 GGCCCCATCCAACCACAAGAAGG - Intergenic
1201543081 Y:15130785-15130807 GAACCCAGCCAAGCTCTAGCTGG - Intergenic