ID: 967102570

View in Genome Browser
Species Human (GRCh38)
Location 3:186228458-186228480
Sequence CTTTTTGAACAGATTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967102570_967102571 -10 Left 967102570 3:186228458-186228480 CCTTCATTAATCTGTTCAAAAAG 0: 1
1: 0
2: 3
3: 19
4: 344
Right 967102571 3:186228471-186228493 GTTCAAAAAGCACTTACTGATGG 0: 1
1: 0
2: 5
3: 23
4: 229
967102570_967102574 22 Left 967102570 3:186228458-186228480 CCTTCATTAATCTGTTCAAAAAG 0: 1
1: 0
2: 3
3: 19
4: 344
Right 967102574 3:186228503-186228525 CTGTCCACTCACCCACTCCTAGG 0: 1
1: 0
2: 6
3: 30
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967102570 Original CRISPR CTTTTTGAACAGATTAATGA AGG (reversed) Intronic
900080217 1:851205-851227 CTTTTTAAAAAGGTTGATGAGGG - Intergenic
901282968 1:8053529-8053551 AGTTTTGAGCAGATTACTGAAGG - Intergenic
903634877 1:24805329-24805351 CTAATTGAACAAATTAATCATGG - Intronic
903690756 1:25171750-25171772 CTTGTTGAATAGATGAATGAAGG + Intergenic
904916898 1:33976800-33976822 CTGTTTGAAAAGTTAAATGAAGG + Intronic
907055254 1:51360364-51360386 CTTTTTTTACTGAATAATGATGG + Intronic
907539240 1:55197201-55197223 CTTTTTGAGTAGATTATTCAAGG - Intronic
908037998 1:60076375-60076397 TTTTTTGACCAAATGAATGAAGG + Intergenic
908443361 1:64177692-64177714 CTTTTTGAGTATATTAATCAGGG + Exonic
908590732 1:65630190-65630212 CTTTTTAAACAGATGCTTGAAGG + Intronic
908933802 1:69348781-69348803 CTTTTTTAAGAGATAATTGATGG + Intergenic
909840501 1:80315661-80315683 CTTTTTGAACAAATGAATGAAGG + Intergenic
909854469 1:80511014-80511036 CTTCTTCAACAGATTAAGAAAGG - Intergenic
910675799 1:89815457-89815479 CTTTTTTTACAGTTTATTGAAGG + Intronic
910874368 1:91864536-91864558 CTTTTTGAACAGTTACATTATGG - Intronic
911657252 1:100458975-100458997 ATTTTTGAATTGATAAATGATGG + Intronic
912169264 1:107078614-107078636 ATTTATGAACAGTTTATTGATGG + Intergenic
913097307 1:115531027-115531049 CCTTTTAAACTCATTAATGATGG - Intergenic
915188442 1:154127489-154127511 CTGTTTGAACAGCTTTATAAAGG - Intronic
915408451 1:155680869-155680891 GTTTTTGAATAAATGAATGAAGG - Intronic
915421466 1:155785783-155785805 GTTTTTGAATAAATGAATGAAGG - Intronic
917729983 1:177865425-177865447 CTTATTGAATAAATGAATGATGG - Intergenic
917914415 1:179686967-179686989 TTTTTTGAAAAGATTAACAAAGG - Intronic
918877047 1:190061182-190061204 CATGTAGAACAGAGTAATGATGG + Intergenic
918964532 1:191325018-191325040 CTTTTTTCACAAATTAAAGAGGG - Intergenic
918996662 1:191770653-191770675 GTTTTTAAGCATATTAATGAAGG + Intergenic
919237275 1:194861284-194861306 AATTTTCAAAAGATTAATGAGGG - Intergenic
919294970 1:195686131-195686153 TTTCTTGAACAGAATAATTAAGG - Intergenic
920320854 1:205121390-205121412 CTCATTGAACAGATGAATAAAGG - Intronic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
924368433 1:243321248-243321270 TTTTTTTAAAAGTTTAATGAAGG - Intronic
924553474 1:245099294-245099316 CTTTTTCAACAGATTGTTGAAGG + Intronic
1062936816 10:1396428-1396450 TTTGTTGAACAAATGAATGATGG - Intronic
1063176293 10:3553711-3553733 CTATTTTAAGAGATCAATGAAGG - Intergenic
1065398713 10:25271161-25271183 CTATTTGAGCAGATTACTGAAGG - Intronic
1066391488 10:34980488-34980510 CCTTCTGAACAGAGAAATGAAGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1068201672 10:53791392-53791414 CTTTTTGCACATAATAATGTAGG + Intergenic
1068886324 10:62100754-62100776 GTTTTTAAATAAATTAATGAGGG + Intergenic
1069136652 10:64774918-64774940 TTTCTTGAATAGTTTAATGACGG - Intergenic
1072827195 10:98619112-98619134 CTTCTTTAATACATTAATGAAGG - Intronic
1077166412 11:1141438-1141460 CCTCTGGCACAGATTAATGAAGG - Intergenic
1078125551 11:8558245-8558267 CTCTTTGAACAAATTTATGCTGG - Intronic
1078154905 11:8791035-8791057 CTTTGGGAACAGATTCAGGAAGG - Intronic
1080280568 11:30552217-30552239 CTGTTTGACCAGATTAACGCAGG - Intronic
1080281526 11:30562984-30563006 ATTGATGAACAAATTAATGAAGG - Intronic
1080670297 11:34370402-34370424 CTATTTCAACAGATGAATGCTGG + Intergenic
1081078509 11:38708355-38708377 GTTTTTGATCAAATTAATTATGG + Intergenic
1081318837 11:41665698-41665720 TTTTTTGAACAGATGCATAAAGG - Intergenic
1081327514 11:41763685-41763707 GTTTTTCAACAGCTTACTGATGG - Intergenic
1082242272 11:49886253-49886275 CTTATTGAAAATATTAATGAAGG + Intergenic
1084801943 11:71549747-71549769 GTTGTTGAACTGATTAATGAAGG + Intronic
1086010309 11:82094950-82094972 CTTTTTGAAGAAATTTTTGAAGG - Intergenic
1087321933 11:96672929-96672951 CTTTAATAATAGATTAATGATGG - Intergenic
1087493190 11:98854181-98854203 CTTTTTGAAAACATTAGAGAAGG - Intergenic
1088089348 11:106020224-106020246 CTTATAAAACAGACTAATGAGGG + Intronic
1089096431 11:115923521-115923543 CACTTTGAACAGAGTAAGGAGGG + Intergenic
1089430987 11:118424324-118424346 CTATTTGAACAGAGTGTTGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091029552 11:132172909-132172931 CATTCTGAACAGATCAATGTAGG + Intronic
1091415003 12:275115-275137 TTTTTTGAACAGCTTTATGGAGG - Intergenic
1091479019 12:807602-807624 TTTTTTGAATAGGGTAATGAGGG - Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093558680 12:20510870-20510892 TTTTTTGAGCAAATGAATGAAGG - Intronic
1093587870 12:20863352-20863374 CTTATAGAACAAATGAATGAAGG + Intronic
1093601067 12:21023754-21023776 CTTGTAGAACAAATGAATGAAGG + Intronic
1093994433 12:25626196-25626218 CTTTTTAAAAAATTTAATGAAGG + Intronic
1094139281 12:27163992-27164014 CTATTTCATCAGATCAATGATGG + Intergenic
1094396515 12:30012803-30012825 CTCTCTGAACAAATAAATGATGG + Intergenic
1094762862 12:33555123-33555145 CTTTATGAACATTTAAATGATGG - Intergenic
1095214486 12:39531653-39531675 CTCTTTGATCAGATTATTAAGGG + Intergenic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1095769187 12:45932920-45932942 CTTGTTAAACAGATAAATTAAGG + Intronic
1097203134 12:57296536-57296558 CTTCTTGAACTGATTACTGAAGG + Exonic
1097533129 12:60831123-60831145 CTTCTGGAAGAGATTAATGTTGG - Intergenic
1098586613 12:72161928-72161950 CTTTTAAAACAGATTTATTAAGG - Intronic
1098599731 12:72316740-72316762 TTTTTTAAATAGATTAATCATGG - Intronic
1098661640 12:73101692-73101714 CTCTTTGAAAAGATTAATAGGGG + Intergenic
1099138874 12:78944201-78944223 CTTTTTAAACAGTTAAATAATGG + Intronic
1100568325 12:95820340-95820362 TTCATTGAACAGATTGATGAGGG + Intronic
1100893221 12:99149502-99149524 CATTTTGAACATTTTAATAAGGG + Intronic
1101121201 12:101582098-101582120 CATTTTGAACAAAGTTATGATGG + Intronic
1101556899 12:105818679-105818701 CTTTTTGAACATGTCAGTGATGG - Intergenic
1102334465 12:112066195-112066217 CTTTTAGATGAGATTTATGAAGG - Intronic
1102416774 12:112769757-112769779 CTTTCTGAACCCTTTAATGAAGG + Intronic
1104222081 12:126794879-126794901 CTTATTGAACAGATGATGGATGG - Intergenic
1104469103 12:129014726-129014748 CATTTTTAACAAATGAATGAAGG - Intergenic
1105033467 12:132901453-132901475 CATTTTTAAAAGATTACTGATGG + Intronic
1105465649 13:20637295-20637317 CTTTTTAAAAAGTTTAACGAGGG + Intronic
1106004599 13:25757013-25757035 ATGTGTGAACATATTAATGAGGG - Intronic
1107180009 13:37448094-37448116 CTTTTTGAAGGGAAGAATGAGGG - Intergenic
1107581431 13:41792555-41792577 AATTTTGATAAGATTAATGAGGG - Intronic
1108059055 13:46515113-46515135 CTTTTTAAACAGATGCTTGAAGG - Intergenic
1109631178 13:65048775-65048797 ATTTTTGAAATGCTTAATGAAGG - Intergenic
1109774725 13:67025814-67025836 CTTTTCAAACAGATTTATTAAGG - Intronic
1109894946 13:68674601-68674623 ATTTTTGAACAGATAAAATATGG + Intergenic
1109999890 13:70182739-70182761 CTTTTTGGATACATTAAAGATGG - Intergenic
1110060112 13:71030027-71030049 ATTTATGAAAAGATTAATTAAGG - Intergenic
1110312649 13:74068856-74068878 CTATTTGAATAAAATAATGAAGG + Intronic
1110461858 13:75753875-75753897 ATTTTTAAACACATTAAAGAAGG + Intronic
1111167369 13:84477117-84477139 CTCTTTGAACACTTTAAAGACGG - Intergenic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1113157787 13:107344341-107344363 CTTTTGTATCAGAGTAATGATGG - Intronic
1113291842 13:108915724-108915746 CTTTTTGTATTGATTAATGGTGG + Intronic
1114489159 14:23086353-23086375 CTTTTTGAAAAAATTAAGGACGG + Intronic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1114873248 14:26683566-26683588 TTTTTGGAAAGGATTAATGAAGG - Intergenic
1115109504 14:29804303-29804325 CTTTTTGAACAGTTTACTCTTGG - Intronic
1117266612 14:54094367-54094389 CTCTTTGAACACATTTATAATGG - Intergenic
1120061491 14:79988655-79988677 CTTTTCTAACAGATTAAATATGG - Intergenic
1120431411 14:84420589-84420611 CTTTTTTAACAGGATAATTATGG - Intergenic
1120690506 14:87587695-87587717 CTTTTTGAACAGATAATTTCAGG - Intergenic
1121232491 14:92368002-92368024 CTTATTTAACTCATTAATGAGGG + Intronic
1121722776 14:96122501-96122523 CATTTTGGAAAGATTAATCACGG + Intergenic
1125174478 15:36804983-36805005 CATTTTGAACATATTTATAAGGG + Intronic
1126544808 15:49861768-49861790 CCTTCTGAACAGATTAAGAAGGG - Intronic
1126589814 15:50327251-50327273 TTTTTTGAGCAGAATATTGATGG - Intronic
1126881885 15:53108008-53108030 TTTTTGGAACAGATCAATGTTGG - Intergenic
1127147694 15:56041855-56041877 CTTTGAGACCATATTAATGATGG + Intergenic
1127175690 15:56353267-56353289 ATTTTTTAACAGATTAGTCATGG - Intronic
1127325720 15:57893406-57893428 ATTTTTGAACGAATAAATGAGGG - Intergenic
1128496822 15:68203485-68203507 CTTTTTGTACAGATAGATGTAGG + Intronic
1129087121 15:73106261-73106283 ATTTTAAAACACATTAATGAAGG + Intronic
1130129864 15:81131381-81131403 TTTTTTGAACATATTTATAATGG - Intronic
1131232797 15:90671823-90671845 CTTTTTGGACAGTTCAATTAGGG - Intergenic
1132632748 16:927765-927787 CTTTAAAAACAGCTTAATGAGGG - Intronic
1133522833 16:6575554-6575576 CATTTTAAAAAGATTAATAAAGG + Intronic
1133545573 16:6802978-6803000 CTTTTAGAACAGATTAGAAAAGG - Intronic
1134267941 16:12707793-12707815 TTTTTTTAACAGATTACTGGGGG - Intronic
1135241735 16:20813171-20813193 CTTTCTGCAAAGATTAATCAGGG - Exonic
1135656279 16:24253269-24253291 CTCTTTCAACAGATCAATGAGGG - Intergenic
1136927849 16:34390622-34390644 TTTTTTTAAAAGATTAGTGATGG - Intergenic
1136976725 16:35021184-35021206 TTTTTTTAAAAGATTAGTGATGG + Intergenic
1137525050 16:49228078-49228100 CTTTTTAAAAAGATAAATGGAGG + Intergenic
1137924386 16:52526166-52526188 CTTGATGAATAGATTTATGAGGG - Intronic
1138989047 16:62368067-62368089 TTTCTTGAATAGATTAATGGGGG + Intergenic
1140199472 16:72882750-72882772 CTTGTTGAACTGAGTAATTAAGG - Intronic
1140773855 16:78231521-78231543 TTTATTGAACAGATTAACTAAGG - Intronic
1143645768 17:8229011-8229033 TTTTTTGAACGAATGAATGAGGG - Intronic
1146708860 17:35023111-35023133 CTTCTTTAAAGGATTAATGAGGG - Intronic
1147112028 17:38270174-38270196 CTTGTTCTACAGAGTAATGAAGG + Intergenic
1149734796 17:58983036-58983058 GTTTTTGATCAGAATAAAGAGGG + Exonic
1151412189 17:73938318-73938340 CTTTTTGGAGATTTTAATGAAGG - Intergenic
1153308611 18:3655487-3655509 CTTTTTGAACGTATGACTGAAGG + Intronic
1153462442 18:5351573-5351595 CTTTTTAAACAGAGTATTGTGGG + Intergenic
1155130190 18:22926658-22926680 CTATTTCAACAGATTAAAAAGGG + Intronic
1157164801 18:45348606-45348628 CTTATTTAACAGATGAATGTTGG + Intronic
1157201059 18:45660164-45660186 TTTGTTGAACACATTACTGAGGG - Intronic
1158191438 18:54833014-54833036 CTTGTAGAACAGATGAATAAAGG + Intronic
1158842148 18:61399031-61399053 CTGTATGAACAGGTAAATGAAGG - Intronic
1159472249 18:68871957-68871979 GTTTTTGATCAGAATAATGGTGG + Intronic
1159472297 18:68872607-68872629 GTTTTTGATCAGAATAATGGTGG - Intronic
1159692778 18:71510701-71510723 TATTTTTAACAGATTACTGATGG - Intergenic
1159879352 18:73843970-73843992 GTTTTTGCACAGATGAATCACGG + Intergenic
1160233121 18:77063759-77063781 CTCTTGGAAAAGATTAAGGAGGG + Intronic
1160644514 19:174468-174490 TTTTTAGAACAGAGTACTGAAGG + Intergenic
1163189561 19:15666657-15666679 CTTTGTGAACAGTTTCAGGAAGG + Intergenic
1164666067 19:30038069-30038091 CTTTTGGACCCAATTAATGATGG - Intergenic
1165989561 19:39801810-39801832 TTATTTGAACAGATTTATAATGG + Intergenic
926267231 2:11335212-11335234 CTTTTTGAAAAGATATGTGAGGG + Intronic
926788378 2:16543454-16543476 CTTTTTAAACAGATTTATTGAGG - Intergenic
926972068 2:18476159-18476181 CTTTCTGAGAAGATAAATGAAGG - Intergenic
927184001 2:20469057-20469079 TTTGTTGAACAGATTAAATAGGG + Intergenic
928332030 2:30364958-30364980 CTTTTTGAAGAGGTAAAAGAAGG + Intergenic
928392463 2:30919954-30919976 CTTTATGAAAAGATGAACGAAGG - Intronic
930311210 2:49742289-49742311 CTGTTTAAACACATTAATGGAGG + Intergenic
930710486 2:54546569-54546591 GTTTTTGAACAATTTCATGAAGG + Intronic
931755597 2:65371362-65371384 CTGTTTGAACAGATTAAACTGGG + Intronic
935468943 2:103433791-103433813 CTTATTGAATAAATGAATGAAGG - Intergenic
935795606 2:106638267-106638289 CTTTTAGAAGAGAGAAATGATGG + Intergenic
936856249 2:116961057-116961079 CTTTTTTAGCAGAATATTGAAGG + Intergenic
938419320 2:131131571-131131593 CTTTTCTTACAGATTAATAAAGG - Intronic
938673502 2:133607031-133607053 TTTTTTAAAAGGATTAATGATGG - Intergenic
939014757 2:136889689-136889711 ATCTTTGAATAAATTAATGATGG - Intronic
939381099 2:141437350-141437372 AATTTTGAAGAGATTAATAAGGG + Intronic
940094254 2:149956199-149956221 CTTCTTCAACAGAGTGATGAGGG + Intergenic
940598451 2:155825682-155825704 CTCTTTGAACATATTTATAAGGG + Intergenic
941757561 2:169204005-169204027 CCTTGTGAACAGTTTAATGGGGG - Exonic
941818223 2:169819873-169819895 CTTTTTGAAGTCATTAATGTTGG - Intronic
942334440 2:174867588-174867610 CTTTATGAACAGAGCCATGATGG + Intronic
943524221 2:188996504-188996526 TTTATTGAAGAAATTAATGAAGG - Intronic
943552849 2:189362183-189362205 CTTTTTCAAAAGATTCAAGATGG - Intergenic
943810519 2:192182349-192182371 GTTTTTGATCTGAATAATGACGG - Intronic
943887468 2:193239959-193239981 ATGATTGAACAGATCAATGAGGG - Intergenic
943968663 2:194373873-194373895 ATTTTTGAAAAGATTACAGAGGG - Intergenic
944366108 2:198921237-198921259 TTTTTTGAACATATTTATAATGG - Intergenic
946123768 2:217540749-217540771 ATTATTGAACAAATAAATGAGGG + Intronic
946503074 2:220270404-220270426 ATTTTTAAAGAGATTAATCATGG - Intergenic
946504178 2:220281320-220281342 TTTGTTGAACAAATGAATGAAGG - Intergenic
946510729 2:220353247-220353269 CTTTCTGAACAGAATATAGAGGG + Intergenic
948703934 2:239777914-239777936 CTTACTGAACAAATGAATGAGGG + Intronic
1168943130 20:1730368-1730390 GTTTTTGGACAGTTAAATGAGGG + Intergenic
1172336846 20:34123483-34123505 TTTTATAAACAGGTTAATGAAGG + Intergenic
1177489119 21:21798887-21798909 CTTTTAGAAAATATTACTGAGGG + Intergenic
1178334117 21:31728830-31728852 ATTTTTGAACAGGTTAATTGTGG - Intronic
1179329168 21:40382050-40382072 CTTTTTCAACATCTTAGTGATGG + Intronic
1179366844 21:40766631-40766653 CTTTTTAAAAACATTAGTGATGG - Intronic
1180583588 22:16865724-16865746 TTTTTTTAACAGATTAGTGTAGG + Intergenic
1182709386 22:32311091-32311113 CTTATTGAGCAGATGATTGAAGG - Intergenic
1182912435 22:33996366-33996388 ATTTTTGAAAAGATTAAAGAAGG + Intergenic
1183146875 22:36001073-36001095 ATTTTTAAACAGAGTAAAGAAGG + Intronic
949402179 3:3677056-3677078 CAATTTTAACAGAATAATGATGG + Intergenic
949859984 3:8496199-8496221 CTTCTTTGACAGATTAATAAGGG - Intergenic
950322830 3:12072749-12072771 CTTTGTGAAGATATTAATAATGG + Intronic
951707329 3:25556494-25556516 CTTTTTCAAAAGATTAGTGTTGG - Intronic
951941820 3:28087688-28087710 CTATTTGCACACATAAATGAGGG + Intergenic
952786478 3:37160415-37160437 TTTTCTGAAGATATTAATGATGG - Intronic
955810286 3:62780816-62780838 TTTATTTAACTGATTAATGAAGG - Intronic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
958962569 3:100523854-100523876 CTTTTTGAACAGAGTTATCTGGG + Intronic
959395750 3:105836096-105836118 CTTTATCAAGAGATTAATTAAGG - Intronic
959485140 3:106920084-106920106 CTTTTTGAAAAGACTAATAAAGG + Intergenic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
962700668 3:137996779-137996801 ATTTTTTAATAGATTATTGAGGG + Intergenic
962918661 3:139932174-139932196 CTTGTTGCAAAGATTAAAGAAGG + Intergenic
963039550 3:141058724-141058746 TTTTTTGAACGAATAAATGAGGG + Intronic
963832183 3:150020243-150020265 TTGTTTCAACTGATTAATGAAGG + Intronic
965006447 3:163032402-163032424 CTTCTTGAACAGTTGATTGAGGG - Intergenic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
967503506 3:190226848-190226870 TGTTTTGAACAAAGTAATGAAGG + Intergenic
968347472 3:198022545-198022567 TTTATTGAATAGATGAATGATGG - Intronic
968855329 4:3116010-3116032 CTTTTTTAACAGATTAAGCCGGG + Intronic
969134082 4:5016049-5016071 CTTAATGAATGGATTAATGAGGG + Intronic
970321174 4:14877109-14877131 ATATTTCACCAGATTAATGAAGG + Intergenic
971970602 4:33614709-33614731 TTTTATAAACACATTAATGACGG + Intergenic
972860454 4:43162299-43162321 ATTTTTTAAAAGGTTAATGATGG + Intergenic
973121590 4:46526987-46527009 GTTTTTGAAGAAAATAATGAAGG + Intergenic
973958874 4:56089913-56089935 CTTTTTATACAGACTAATGATGG - Intergenic
974372129 4:61031110-61031132 CTTTTTGAACAGATTTGCAACGG - Intergenic
975652192 4:76604577-76604599 CCATTTGAACATTTTAATGAAGG - Intronic
975914147 4:79303127-79303149 CTTTTTGAAAATATTTATGTTGG - Intronic
977124316 4:93145341-93145363 TTTTTTGACTAGATAAATGAAGG + Intronic
977313999 4:95422358-95422380 GTTTTTGATTAAATTAATGATGG - Intronic
977376781 4:96215578-96215600 CATTTTGAACAAATTGATAATGG + Intergenic
977546493 4:98388124-98388146 TTTTTTGAAAAGATTAAGTAGGG - Intronic
977634315 4:99279453-99279475 CCTTTTGAAAAAATAAATGAAGG - Exonic
977636995 4:99310792-99310814 CCTTTTGAAAAAATAAATGAAGG - Exonic
977639415 4:99339604-99339626 CCTTTTGAAAAAATAAATGAAGG - Exonic
978047873 4:104154545-104154567 CCTTTTAAACACATTAACGAGGG - Intergenic
979314369 4:119243734-119243756 CTTTATAAACAGATTATAGAGGG + Intronic
979855919 4:125634393-125634415 CTTTTTGAAAAAATTTATTAAGG + Intergenic
980216978 4:129865014-129865036 ATTTTTGAAAAGATTAATCATGG - Intergenic
980727021 4:136776134-136776156 CTTTTTGAGCAGAAATATGATGG + Intergenic
980777793 4:137459127-137459149 CTTTTTGAAAGGATCATTGAAGG + Intergenic
981556054 4:145995838-145995860 GTTTTAGGACAGTTTAATGAAGG - Intergenic
983188100 4:164723904-164723926 AGTTTTGAACATATTAATGAAGG - Intergenic
983739868 4:171115880-171115902 CTTTTGGAACTGATTTATGGAGG - Intergenic
984099619 4:175469520-175469542 ATTTTTAAACATCTTAATGAAGG + Intergenic
984384758 4:179041901-179041923 CTTTTCTAAAATATTAATGAGGG + Intergenic
984984641 4:185315928-185315950 TTTTTTAAACAGCTTAATTAAGG + Intronic
986186951 5:5452380-5452402 CTTTTCTAACAGGTTAATAACGG - Intronic
986930977 5:12820733-12820755 CTTTTTGAATTCATGAATGAAGG - Intergenic
987002466 5:13673853-13673875 ATTTTTGAAGAGATTTAAGATGG - Intergenic
987267311 5:16269949-16269971 GTTTATTAACACATTAATGAGGG - Intergenic
987907443 5:24095052-24095074 TTTTTTTAATAAATTAATGATGG + Intronic
987955805 5:24738454-24738476 CCTTTTAAACAGTTTTATGAAGG - Intergenic
989116712 5:37961800-37961822 TTTTTTGAACAGTTTTATAAAGG - Intergenic
989222213 5:38980158-38980180 CTTCTTGAACAAATTAATCGGGG + Intronic
991706667 5:69365070-69365092 TTTTTGGACCCGATTAATGATGG + Exonic
992757693 5:79924095-79924117 CTGTCTGTATAGATTAATGATGG + Intergenic
993559930 5:89393715-89393737 CTTTTTAAAAAGAATAATCAGGG + Intergenic
993884102 5:93396472-93396494 CCTTCTGAAGAGAGTAATGAAGG - Intergenic
994440193 5:99792320-99792342 CTCTTGGAACAGATTTATTATGG + Intergenic
994824512 5:104696541-104696563 CTTCTTGAACACATAAATAAGGG + Intergenic
995590225 5:113692139-113692161 CTTTTTGAAAAATTTTATGAAGG - Intergenic
999454138 5:151700722-151700744 TTTTTTTAACCCATTAATGAGGG - Intergenic
999553544 5:152716748-152716770 CTTTTTGAAAAGATTTATTCTGG - Intergenic
1000629163 5:163572308-163572330 CTTTTTGAACAGATATATAGAGG + Intergenic
1000910563 5:167016788-167016810 CTTTTTAAACAGTTAGATGATGG + Intergenic
1001283841 5:170408046-170408068 CTTCTAGAACAGATTAAGGGTGG + Intronic
1004183448 6:13400548-13400570 CTTTTTGAACAATTTAATTTAGG + Intronic
1004764523 6:18710569-18710591 TTATTTGAATAGATTAATGTGGG - Intergenic
1006121826 6:31811674-31811696 CCTTTTCAAGTGATTAATGAAGG - Exonic
1006686024 6:35834973-35834995 CTTTTTGAAAAGAGCTATGAAGG - Exonic
1007796688 6:44354519-44354541 CTTTTTAAAAAGATTTATTAAGG + Intronic
1008059397 6:46981337-46981359 TTTTTTAAACATATAAATGAGGG - Intergenic
1008093982 6:47320259-47320281 TTTTTTAAAAAGATTATTGAGGG + Intergenic
1008315614 6:50036432-50036454 CATATTGAACAAATTAATGTTGG + Intergenic
1009348233 6:62644151-62644173 CTTTTATAACAGACTGATGAGGG + Intergenic
1010732674 6:79407240-79407262 CTTGTTGAATGGATAAATGAAGG + Intergenic
1010904067 6:81464517-81464539 CTTTTTGGACAAATTAAAGAAGG - Intergenic
1010942566 6:81935816-81935838 CTCTTTCAACAGAATAAAGAAGG - Intergenic
1011460709 6:87600364-87600386 ATTTTTTAACATATTAAAGATGG + Intronic
1011887793 6:92119161-92119183 TTTTTTTAAAAGATTAATAATGG - Intergenic
1011898817 6:92266159-92266181 CTTTTTAAACAGATTATTTGAGG + Intergenic
1013331698 6:109108551-109108573 CTTTTTGAACAGAGGAATGTAGG - Intronic
1013515530 6:110882262-110882284 CTTTCTGATCAAATTAATGATGG - Intronic
1013581979 6:111544600-111544622 TTTTTGGAAAATATTAATGATGG - Intergenic
1014224280 6:118830115-118830137 GTTTTTAAACTAATTAATGATGG + Intronic
1014745387 6:125194414-125194436 ATTTTTGAGCAGAAGAATGATGG - Intronic
1015712039 6:136152578-136152600 CTTTTGATACAGAGTAATGATGG - Intronic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1017272604 6:152526126-152526148 CTTTTTGAAGACATGAAAGATGG - Exonic
1017657002 6:156639423-156639445 CTTTTTGAAAATTGTAATGATGG - Intergenic
1019023677 6:168940534-168940556 CTTTTTAATCAGTTTCATGATGG + Intergenic
1020571865 7:9873458-9873480 ATTTTTAAACAGCTTACTGAAGG + Intergenic
1020896805 7:13950683-13950705 CTTTTTGAAAAGATGAAAGATGG - Intronic
1021162394 7:17291532-17291554 CTTTTTAAACAGACTTATGTTGG + Intergenic
1021827800 7:24572766-24572788 CTTTGGGAAAAAATTAATGAAGG + Intergenic
1024421534 7:49172923-49172945 CTTTTTGTACAGATGCATTAAGG - Intergenic
1024820808 7:53327824-53327846 ATTTTGAAATAGATTAATGAGGG + Intergenic
1026074530 7:67154305-67154327 ATTTTGGAACAGTTTTATGATGG + Intronic
1026278186 7:68898901-68898923 GTTTTGGAACAGACTAATGCTGG + Intergenic
1026702335 7:72657868-72657890 ATTTTGGAACAGTTTTATGATGG - Intronic
1028519651 7:91716032-91716054 CTTTATGGAGAGATTAAGGAGGG + Intronic
1029050520 7:97681735-97681757 ATTGTTGGACAGATTAATGAAGG + Intergenic
1030026949 7:105333651-105333673 CATTTTGTACAGTTTTATGAGGG + Intronic
1030359800 7:108582985-108583007 CTTTTTGTACCCATGAATGATGG + Intergenic
1031558440 7:123207677-123207699 ATTTTTGAATAAATTATTGAAGG - Intergenic
1035516424 8:237061-237083 ATTTTTGTGCTGATTAATGAGGG + Intronic
1035525296 8:307708-307730 CTTTTTAAAAAGGTTGATGAGGG + Intergenic
1039598818 8:38816096-38816118 CTTTTGGAATAGTTTAATTAAGG - Intronic
1041188936 8:55333380-55333402 CAGTTTGAGCTGATTAATGAAGG - Intronic
1042569002 8:70142211-70142233 CATTTTGAAGTGTTTAATGATGG + Intronic
1043376022 8:79650761-79650783 ATTTTTGAACAAATTATTCAGGG - Intronic
1043637120 8:82399764-82399786 CTTTTTAAAGATATTAATTATGG - Intergenic
1044296450 8:90533146-90533168 TTTTCTGAACAAATTCATGAGGG - Intergenic
1044981719 8:97722915-97722937 CTTTTTGATAAGATTACAGATGG - Exonic
1045168866 8:99640936-99640958 CTTTTTCAACAGAATTATTAAGG - Intronic
1045962776 8:107988165-107988187 CATTTTGTACATAGTAATGAGGG - Intronic
1047182657 8:122604310-122604332 CTTTGTGTACAGATTGATCATGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048029608 8:130618752-130618774 CTATTTGAACTGATAAATAAGGG - Intergenic
1048289275 8:133167959-133167981 CTCTGTGGTCAGATTAATGATGG - Intergenic
1049231342 8:141485471-141485493 CTTTTTGATCAGTCTAGTGAGGG + Intergenic
1050564759 9:6870613-6870635 GTTTTTGAACACTTTAGTGAAGG + Intronic
1051082290 9:13307600-13307622 CATGTTGAACAAATGAATGAGGG - Intergenic
1051432795 9:16997598-16997620 CTTTCTCATCAGAATAATGAGGG - Intergenic
1052333078 9:27291289-27291311 CTTATGTAGCAGATTAATGAAGG + Intronic
1052450329 9:28621664-28621686 GTTTTTGCACATATTAATAAAGG + Intronic
1053341985 9:37344855-37344877 TTTTTTGAACAAATTAATGAAGG + Intronic
1055485495 9:76752701-76752723 CATTTTGGACAGGTTAATAATGG + Intronic
1055510985 9:76995359-76995381 CTTTTTGACAAGAAAAATGAGGG + Intergenic
1055754579 9:79544026-79544048 CTTTTTAAACAAATTGATGCTGG - Intergenic
1058091082 9:100806162-100806184 CTTTTTGAAGGGATAAAAGATGG + Intergenic
1058515574 9:105770129-105770151 ATTATTGAACACATGAATGAGGG + Intronic
1058570137 9:106332884-106332906 TTTGTTGAACAAAATAATGAAGG + Intergenic
1058707641 9:107650384-107650406 CTTTTTGGCTAGATTACTGAGGG - Intergenic
1059184543 9:112255841-112255863 GTTTTGGAAAAGATAAATGAAGG - Intronic
1059780392 9:117519927-117519949 TTTTTTGAAAACATTAATTATGG + Intergenic
1059925154 9:119202171-119202193 CTTTATGAACAGAGAAATTAAGG - Intronic
1062230258 9:135478667-135478689 CTTTTTGAAAAAATTCACGAAGG + Intergenic
1186655814 X:11610637-11610659 TTTTGTAAACAGATTTATGAAGG + Intronic
1186742419 X:12532641-12532663 CTTGTTGAACATGTTAGTGAAGG + Intronic
1187015549 X:15324419-15324441 CTTTATGCCCAGTTTAATGAGGG + Intronic
1187067796 X:15857018-15857040 CTTTTTCAATAGATTATAGATGG + Intergenic
1189056649 X:37706341-37706363 GTTTTTGAAGAGAATAATCAAGG + Intronic
1189806699 X:44742424-44742446 GTTCTTGAACAGATCACTGAGGG + Intergenic
1190791145 X:53701525-53701547 AAATTTGAACAGATTTATGAAGG + Intergenic
1190791697 X:53706621-53706643 AAATTTGAACAGATTTATGAAGG + Intergenic
1191056687 X:56249114-56249136 CTCTTTTAACAGGTTAATGGAGG - Intronic
1192088646 X:68128772-68128794 TTTTTTAAACAGAATAATTATGG + Intronic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1193214491 X:78847299-78847321 CATTTTTAACAGATTTATTAAGG - Intergenic
1194502247 X:94696078-94696100 GTCCTTAAACAGATTAATGATGG - Intergenic
1194533804 X:95081004-95081026 TTCTTTGAAAAGATAAATGATGG + Intergenic
1195440994 X:104897585-104897607 CTTTTATAGTAGATTAATGATGG - Intronic
1196036643 X:111152180-111152202 CATTTTGCAGATATTAATGAAGG - Intronic
1196041265 X:111206801-111206823 TTTTTAGAAGAGAGTAATGAGGG - Intronic
1196310574 X:114160487-114160509 TTTTATGAACATATTAATTAGGG + Intergenic
1196405212 X:115354193-115354215 AATTTTGAACAGAGTTATGATGG - Intergenic
1196759847 X:119191221-119191243 CTTCTTGAACACATGAATGAAGG - Intergenic
1197387473 X:125819037-125819059 CATTTTTAAATGATTAATGATGG + Intergenic
1198299435 X:135320623-135320645 CTTTTTAAAATGATGAATGATGG + Intronic
1199316839 X:146389060-146389082 ATATTTGTACATATTAATGAGGG + Intergenic
1199935027 X:152564794-152564816 GTTTTTGAACAGATAACTTAAGG + Intergenic
1200492529 Y:3845080-3845102 ATTATTGAACAGAATATTGAGGG - Intergenic