ID: 967102739

View in Genome Browser
Species Human (GRCh38)
Location 3:186229674-186229696
Sequence CAGGAGTTCGTGGGTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967102739_967102745 -6 Left 967102739 3:186229674-186229696 CCAGTTATACCCACGAACTCCTG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 967102745 3:186229691-186229713 CTCCTGAAAAGCAGGGGCTGTGG 0: 1
1: 0
2: 7
3: 46
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967102739 Original CRISPR CAGGAGTTCGTGGGTATAAC TGG (reversed) Intronic
905923005 1:41731513-41731535 CAGGATGTCGTGGGAATGACAGG + Intronic
907429372 1:54403220-54403242 CAGGAGATTCTGGATATAACAGG + Intronic
913515373 1:119601005-119601027 CAGGAGTTCAAGGGGATAAGGGG + Intergenic
917408192 1:174731580-174731602 TTGGAGTTCCAGGGTATAACAGG - Intronic
1065816156 10:29484647-29484669 CAGGAGTACCTGGGGATAAGCGG + Exonic
1069851430 10:71407629-71407651 CAGGAGCTCTTGGGTATTTCTGG + Intronic
1073091772 10:100947073-100947095 CAGGAGGTTGTGGGGATGACTGG - Exonic
1077695112 11:4386436-4386458 CAGGAGTTCCTGGTTATAGGAGG + Intronic
1078639653 11:13082881-13082903 CAGTGGTTCCTGGGTCTAACTGG + Intergenic
1079135597 11:17774585-17774607 CAGGAGTGCATGGGTTTTACAGG - Intronic
1079163910 11:18019555-18019577 CAGGAGTTCGTTGGAATTAAGGG + Exonic
1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG + Intergenic
1097791327 12:63818295-63818317 ATGTAGTACGTGGGTATAACTGG - Intergenic
1101140551 12:101791318-101791340 CAGGAGTTCATGTGTACATCTGG + Intronic
1115875205 14:37853633-37853655 CAGGAGGTCCTGGGTAGACCTGG + Intronic
1120944838 14:89984528-89984550 CAGCAATTCGTGGGTATAAGGGG - Exonic
1125997888 15:44181827-44181849 CAGGAGTTCGAGGGTAAAGTGGG + Intronic
1130205373 15:81870512-81870534 CAGGACTTACTGGGTATAAAGGG - Intergenic
1134451355 16:14365660-14365682 CAGGAGTTTGAGGGTATAGTGGG + Intergenic
1138066725 16:53949180-53949202 CAGGAGCTCAAGGGTGTAACAGG - Intronic
1140096583 16:71881243-71881265 GAGGAGTTAGTTGGCATAACAGG - Intronic
1144703554 17:17353400-17353422 CAGGTGTTCCTGGGTAAAGCAGG + Intergenic
1147544826 17:41393265-41393287 GAGGAATTCCTGGGTATAGCAGG + Intronic
1147984423 17:44296928-44296950 CTAGAGTCAGTGGGTATAACAGG - Intergenic
1155201741 18:23523647-23523669 AAGGAGTTCGTGGTTATAGTGGG + Intronic
1156683949 18:39621824-39621846 CAGGAGTACGAGGGAATCACAGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1159714509 18:71804970-71804992 CAGGAGTTCGAGGCTGTAGCAGG + Intergenic
1202677357 1_KI270711v1_random:19854-19876 CAGGAGTTCCTGGGTAAGAACGG - Intergenic
928338966 2:30424886-30424908 AAGGACTTTGTGGCTATAACTGG + Intergenic
934884022 2:98008601-98008623 CAGGAGTTCATGGGTCGAGCTGG + Intergenic
937354369 2:121188704-121188726 AAGCAGATTGTGGGTATAACAGG - Intergenic
1173235611 20:41242980-41243002 CAGGAAGTCGTGGGTCTAAGTGG + Intronic
1173607721 20:44343496-44343518 GAGGAGTACCTGGGTATAATGGG - Exonic
1175061820 20:56250233-56250255 CAGGAGGTCGTAGCTGTAACAGG - Intergenic
1175094555 20:56531145-56531167 TAGGAGTTGGTGGGTAAAATGGG - Intergenic
1178989953 21:37344652-37344674 CAGGATTTCTTGGGTAGAAGTGG + Intergenic
1179280738 21:39931729-39931751 CAGGAGTTCCTGGGTAAATAAGG + Intergenic
951166893 3:19493339-19493361 CAGGTGTTCATGGGGAGAACTGG + Intronic
954357937 3:50098339-50098361 CAGGAGTTCGAGGTTACAATGGG - Intronic
954624931 3:52017204-52017226 CAGGAGTTCTTGGGTAGAGGCGG + Intergenic
959320754 3:104871720-104871742 CAGGAGTAGGTGGGAATAAGAGG + Intergenic
966310617 3:178589550-178589572 CAGGAGTTCGAGGGTACAGTGGG - Intronic
967102739 3:186229674-186229696 CAGGAGTTCGTGGGTATAACTGG - Intronic
990245489 5:53859677-53859699 CACGAGTTCTTGGGTGTGACCGG - Intergenic
1003159275 6:3621520-3621542 CATGAGTTCCTGGATATAGCAGG - Intergenic
1018762974 6:166906915-166906937 CAGGAGTTGGTGGGGAGAGCGGG - Intronic
1018968987 6:168512237-168512259 CAGGAAGTCGTGGGCAGAACAGG + Intronic
1031397189 7:121287236-121287258 CAGGAGGTTGGGGGTATAAAAGG - Intronic
1032505778 7:132433720-132433742 CAGGAGGTCGCGGATATCACAGG - Intronic
1039086771 8:33788042-33788064 CAGGAGTTCCAGGTTATAGCAGG - Intergenic
1046668312 8:117030127-117030149 CAGTCGTTCATGGGTATATCAGG + Intronic
1048896940 8:139000726-139000748 CATGAGGTCCTGGGTCTAACTGG - Intergenic
1186167325 X:6840583-6840605 CAGGAGTTAGTGGGGAGAAAAGG + Intergenic