ID: 967105757

View in Genome Browser
Species Human (GRCh38)
Location 3:186253821-186253843
Sequence ACTAGGGAATAGTGGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967105747_967105757 19 Left 967105747 3:186253779-186253801 CCAGGCAGGTATACAGATTAGTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 967105757 3:186253821-186253843 ACTAGGGAATAGTGGGACATTGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967105757 Original CRISPR ACTAGGGAATAGTGGGACAT TGG Intronic
904689461 1:32282968-32282990 ACTGGGGCATAGGAGGACATAGG - Intronic
904904132 1:33882035-33882057 ACTAGGGAATAGTGAGAGGCTGG - Intronic
907975828 1:59430604-59430626 ACTAGGGAATAGAGGCAGCTGGG - Intronic
908345908 1:63232847-63232869 ACAAGGGACTAGTGGGAGAGAGG - Intergenic
909066420 1:70940365-70940387 ACTAGGTAATAGGCGGAGATTGG - Intronic
909267714 1:73582203-73582225 ACTGGAGAATAGAGGGACAGAGG + Intergenic
909760195 1:79276875-79276897 ACCAGAAAATAGAGGGACATGGG + Intergenic
910798663 1:91123504-91123526 CCTTGGGCAGAGTGGGACATTGG - Intergenic
919275810 1:195415363-195415385 AGTAGGTAATAGTGGAAAATTGG + Intergenic
919696607 1:200582997-200583019 TCTAGGGAATACTGGAACAGAGG + Intronic
922220616 1:223555767-223555789 ACAAGGGAATTTTTGGACATTGG + Intronic
924717453 1:246590466-246590488 ACTAGGCAAAAGTGGGAGAGAGG + Intronic
1070383746 10:75904955-75904977 ACTAGGAAGTAGTGAGACAGTGG + Intronic
1071319545 10:84439932-84439954 GGTAGGGAATGGTGGGAAATAGG + Intronic
1071706412 10:88004253-88004275 AATAGGTAATTATGGGACATTGG + Intergenic
1082673920 11:56071894-56071916 TCTAGGGAATACTGGGAGTTTGG - Intergenic
1082842333 11:57699670-57699692 ACTAGAGAGTAGTAGTACATAGG + Intronic
1084497660 11:69514247-69514269 CCTGGGGAAGAGTGGGACAGAGG - Intergenic
1086908614 11:92446246-92446268 ACTAGGGAATAGTATCACCTAGG - Intronic
1087491835 11:98837877-98837899 ACTGGGGGATAGTGGTAAATAGG - Intergenic
1089301986 11:117504448-117504470 ACTGGGGAATGGAGGGACAGGGG - Intronic
1092046754 12:5436450-5436472 ACTTGGGAAAAGTGTGACTTTGG + Intronic
1098594308 12:72254324-72254346 ACCAGGGAAGAGTGGGACAAGGG - Intronic
1099158547 12:79210397-79210419 ACTTGGGAAAAGTGGGAGAGGGG - Intronic
1102710031 12:114917836-114917858 AGTGTGGAATAGTGGGACAGTGG - Intergenic
1104236483 12:126943440-126943462 ACTAGGAAATTGTGGCAAATAGG - Intergenic
1104760525 12:131295305-131295327 ACTAGGGGACAGTGGGACTCGGG - Intergenic
1104819250 12:131665480-131665502 ACTAGGGGACAGTGGGACTCGGG + Intergenic
1108078393 13:46706445-46706467 ATTACCCAATAGTGGGACATTGG + Intronic
1109187765 13:59291124-59291146 AGTGGGGAACAGTGGGGCATGGG - Intergenic
1110894372 13:80730763-80730785 ATAAGGTAATAGTGGGGCATAGG + Intergenic
1111137596 13:84068780-84068802 ACTGAGGAATAGTAGGACGTAGG - Intergenic
1111609050 13:90579583-90579605 ATTTGGGAATAGTTGGAGATAGG + Intergenic
1112288437 13:98124380-98124402 AGTAGGGAATTGTAGGACTTTGG - Intergenic
1112981767 13:105393676-105393698 CCTGGGGAATAGTGTCACATTGG + Intergenic
1114353982 14:21887185-21887207 ACCAGGGAATAGAGGGGCTTGGG - Intergenic
1116484230 14:45427651-45427673 ACCAGGGAAAAGAGGGACCTGGG + Intergenic
1117873859 14:60229873-60229895 ACTAGGGAATAGAAGAACAAAGG - Intergenic
1119908179 14:78324325-78324347 ACTAGGACATAGTGGAGCATAGG + Intronic
1120841442 14:89088982-89089004 ATCAGGGAAGAGTTGGACATGGG + Intergenic
1126145418 15:45469044-45469066 AATAGGGAACAGTGGGAAAGGGG - Intergenic
1126705763 15:51403344-51403366 ACTAGAGAATAGTGAGGCTTGGG - Intronic
1129432548 15:75510874-75510896 ACTAGGGACTAGGGGGAGAAGGG - Intronic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1135169074 16:20167081-20167103 ACTAGGGAGCAGTGTGGCATGGG + Intergenic
1135422074 16:22312090-22312112 ACCAGGGACTAGTGGGAGAGTGG + Intronic
1136747313 16:32602217-32602239 ACTAGGGATTAGAGGCACAGTGG + Intergenic
1203049448 16_KI270728v1_random:861423-861445 ACTAGGGATTAGAGGCACAGTGG + Intergenic
1149422329 17:56522494-56522516 ACCTGGGAAAACTGGGACATAGG + Intergenic
1153378572 18:4410148-4410170 ACTTGGGAAGAGTGGGAGAGGGG + Intronic
1156196750 18:34782723-34782745 GCTGGAGAATAGTGGGAGATGGG + Intronic
1157052113 18:44178512-44178534 GCCAGGGAAGAGTGGGACACAGG + Intergenic
1162935660 19:13980320-13980342 ACTGGGGCGTAGTGGGCCATGGG - Intronic
1163784210 19:19266344-19266366 ACTAGGGAATCCTGGGATATTGG + Intronic
1164319257 19:24125939-24125961 ACTATGGTATAGTGGGAAACAGG + Intronic
1165483897 19:36083682-36083704 AGTAGGTGCTAGTGGGACATAGG + Intronic
927263513 2:21118345-21118367 ACTTGGTGATAATGGGACATGGG - Intergenic
928768719 2:34679321-34679343 AGTGGGGAATAGTGGGTCAGTGG - Intergenic
930934629 2:56932984-56933006 TGTAGGGATTTGTGGGACATAGG - Intergenic
937462027 2:122097699-122097721 ACTAGGAGATAATGGGAAATGGG - Intergenic
937482436 2:122276493-122276515 ATTAGGGAATGGTGGGAGTTTGG + Intergenic
942759104 2:179377531-179377553 CCTAGGAAATATTTGGACATTGG - Intergenic
943345352 2:186732356-186732378 ACTATGGAACAGTGGGGCTTGGG - Intronic
945700235 2:213160559-213160581 AAGAGGGAATAGTGAGAGATAGG + Intergenic
948469707 2:238169134-238169156 TCTCGGGAACAGTGGGACATAGG + Intergenic
1169103721 20:2975747-2975769 ACTAGAGAGTAGGGGGACATGGG + Intronic
1170397125 20:15938568-15938590 ACAGGGGAATAGTGGGTCAGTGG - Intronic
1173442830 20:43093758-43093780 TCAAGGGAAGAGTGGGACAGGGG - Intronic
1174220276 20:48948866-48948888 CCTGGGGGATAGTGGGAGATAGG + Intronic
1177725649 21:24963526-24963548 ACTGGGGACTAGTGGGAGACGGG - Intergenic
1181927350 22:26370619-26370641 ACTAGGGAAAGGTGTGACACTGG - Intronic
1182645432 22:31805155-31805177 AGTTGGGAATAGAAGGACATGGG - Intronic
1184591669 22:45488286-45488308 ACCAGGGACTGGTGGGACAATGG - Intergenic
950884089 3:16347685-16347707 ACTAGGGAATTGAGGGTCAGAGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953399261 3:42598727-42598749 ACTTGGGAAAAGAGGGAAATGGG + Intronic
954542295 3:51401812-51401834 ACGTGTGAATAGTGAGACATGGG - Intronic
956325829 3:68051486-68051508 ACTAGGGAAGAGTGGGCTACTGG + Intronic
957005886 3:74946341-74946363 TCTAGGAATTACTGGGACATAGG + Intergenic
960444790 3:117734431-117734453 ACTAGGGAAGAGAAGGAAATGGG + Intergenic
960514720 3:118590685-118590707 AGTACAGAATCGTGGGACATGGG + Intergenic
965997830 3:174908337-174908359 ACTATGGGAAAGTGGGACAAAGG + Intronic
966059328 3:175735363-175735385 ACTGGGAAATAGGGAGACATTGG - Intronic
966933100 3:184688486-184688508 GCTATGGACTGGTGGGACATGGG + Intergenic
967105757 3:186253821-186253843 ACTAGGGAATAGTGGGACATTGG + Intronic
972946549 4:44263939-44263961 ACTGGGGAACAGTGGGAGATTGG - Intronic
973658894 4:53081824-53081846 AGTAGAGAAGAGAGGGACATGGG - Intronic
973916823 4:55642369-55642391 AGCAGTGAATAGTAGGACATTGG - Intergenic
976415938 4:84774599-84774621 ACTAGTGAATAGTAGAATATTGG - Intronic
983058012 4:163122480-163122502 AATATGTACTAGTGGGACATAGG - Intronic
985149697 4:186933995-186934017 ACTAGGGAATAGTATAACAAGGG + Intergenic
987246666 5:16055965-16055987 ACAAGGGAAGAGTGGGAAGTGGG - Intergenic
992897078 5:81254690-81254712 ACTAGGGAAGGGTTGGTCATTGG + Intronic
994215108 5:97129042-97129064 AAGAGAGAATAGTGAGACATAGG - Intronic
994322054 5:98405535-98405557 ACTAAGGAATAGAGTGCCATGGG - Intergenic
995088042 5:108138710-108138732 ACTAGGCAACAGGGAGACATTGG + Intronic
996224745 5:120977975-120977997 ACTAGGGATTACTGGGGCAAAGG - Intergenic
996851385 5:127957029-127957051 ACTAGGGAATACTGGGTAAATGG + Intergenic
997895540 5:137712786-137712808 ACTAGAGAGTGGTGGGACAGAGG - Intronic
1004890432 6:20095893-20095915 ACTAGGAAATAGAGAGCCATAGG + Intergenic
1007154305 6:39727006-39727028 ACTGGGGAAAACTGGGAGATGGG + Intergenic
1007861045 6:44908881-44908903 AATAGGTAATAGTGGAAAATTGG + Intronic
1008201585 6:48597762-48597784 ACTATTGAATATTGGGACTTTGG - Intergenic
1008708194 6:54189101-54189123 ACTAGGGAGCAGGGGGAAATGGG + Intronic
1009619948 6:66063062-66063084 ACTAGGTAATAGGCAGACATTGG + Intergenic
1012096145 6:94964729-94964751 ACCAGGGCCTATTGGGACATAGG - Intergenic
1012978437 6:105804964-105804986 ATAAGGGAATAGAGAGACATTGG - Intergenic
1013766605 6:113581378-113581400 ACTAGGAAGTGGTGGGACTTTGG - Intergenic
1016314161 6:142768592-142768614 ATGATGGAAGAGTGGGACATAGG - Intronic
1029158157 7:98532003-98532025 ACAAGGGAGTGGTGGGGCATGGG - Intergenic
1029629166 7:101739718-101739740 ACTTGGGAGTACTGGGACTTAGG - Intergenic
1031420442 7:121545153-121545175 AAAAAGGAATAATGGGACATTGG - Intergenic
1033247468 7:139729925-139729947 AGTAGTGAATGGAGGGACATTGG - Intronic
1034819006 7:154199381-154199403 ACTAGGGAATAGTGGAAACCAGG - Intronic
1044587899 8:93885085-93885107 ATTATGGAATAGTGGGATAAAGG + Intronic
1045147098 8:99358356-99358378 ACCAATGAATAGTGGGACACTGG - Intronic
1045178385 8:99752278-99752300 ACTAGGGAATAGTTCTCCATGGG - Intronic
1045354137 8:101370266-101370288 ACTGGGGGATAGTGAGAAATAGG - Intergenic
1053606362 9:39664403-39664425 GCTAGGGAAGAGGGGGAAATGGG + Intergenic
1053864285 9:42421021-42421043 GCTAGGGAAGAGGGGGAAATGGG + Intergenic
1054247180 9:62678020-62678042 GCTAGGGAAGAGGGGGAAATTGG - Intergenic
1054561298 9:66712552-66712574 GCTAGGGAAGAGGGGGAAATTGG - Intergenic
1062189515 9:135240633-135240655 CCTTGGGAATAGTCGGACATTGG - Intergenic
1190506889 X:51135368-51135390 AGTAGGAATTCGTGGGACATAGG + Intergenic
1196421944 X:115531821-115531843 ATTAGGGAATTGAGGGATATGGG - Intergenic