ID: 967106083

View in Genome Browser
Species Human (GRCh38)
Location 3:186256089-186256111
Sequence GCTGATCTGCAGAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967106083_967106087 -9 Left 967106083 3:186256089-186256111 CCATCCACCCTCTGCAGATCAGC 0: 1
1: 0
2: 0
3: 39
4: 297
Right 967106087 3:186256103-186256125 CAGATCAGCTTTTCCTTCCTTGG 0: 1
1: 0
2: 1
3: 76
4: 376
967106083_967106088 -2 Left 967106083 3:186256089-186256111 CCATCCACCCTCTGCAGATCAGC 0: 1
1: 0
2: 0
3: 39
4: 297
Right 967106088 3:186256110-186256132 GCTTTTCCTTCCTTGGCTCCCGG 0: 1
1: 0
2: 6
3: 34
4: 421
967106083_967106089 1 Left 967106083 3:186256089-186256111 CCATCCACCCTCTGCAGATCAGC 0: 1
1: 0
2: 0
3: 39
4: 297
Right 967106089 3:186256113-186256135 TTTCCTTCCTTGGCTCCCGGAGG 0: 1
1: 0
2: 0
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967106083 Original CRISPR GCTGATCTGCAGAGGGTGGA TGG (reversed) Intronic
900431690 1:2605812-2605834 GCTGGACTGGAGAGGGTGGCGGG + Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901722033 1:11206758-11206780 GGCGATCAGCAGTGGGTGGATGG - Intronic
902264798 1:15255647-15255669 GAGGATCTGCAGAGCCTGGATGG + Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904266406 1:29320716-29320738 GGTGCTCTGCAGCGGGTGCAGGG - Exonic
905210474 1:36370561-36370583 GGTGGTCTGCAGAGCGTGGGTGG - Intronic
905408778 1:37754175-37754197 GCTGCACTGCGGAGGGTGGGGGG - Intronic
905452909 1:38068501-38068523 GCTGCTCTACTGAGGGGGGAGGG - Intergenic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905786019 1:40758248-40758270 GATGATCTGCCCAGGCTGGATGG - Exonic
906244244 1:44262061-44262083 GCTGGGCTGCGGTGGGTGGAGGG - Intronic
907400193 1:54220470-54220492 GCTGATCTGCAAAGTGGGGCAGG + Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912428791 1:109617544-109617566 GCTGGTATGGAGTGGGTGGAGGG + Exonic
915127754 1:153678127-153678149 GCTAATCTGCACAGTCTGGAAGG + Intergenic
917791651 1:178502987-178503009 GGTCATCTGCATAGTGTGGATGG - Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
918393880 1:184094469-184094491 GCGGCTGTGCAGAGGATGGAAGG + Intergenic
918655961 1:187027101-187027123 TCTGATCCCAAGAGGGTGGATGG - Intergenic
920467918 1:206203803-206203825 GGAGATTTGGAGAGGGTGGAGGG - Intronic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
922239646 1:223747304-223747326 GCGGACCTTCAGAGGGTGGAGGG - Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
922507272 1:226133804-226133826 GCTGTGCTGCAGAGACTGGATGG + Intergenic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
1063095749 10:2907470-2907492 GCAGATCTGCAGAGGGGAGGGGG - Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1065865453 10:29911154-29911176 GGTGAGGTGCAGAGCGTGGAAGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066762300 10:38767066-38767088 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1066959291 10:42205404-42205426 GTTAATCTTCAGAGGGTGAAAGG - Intergenic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1068773443 10:60847259-60847281 GGGGAACTGCAGAGGGTGGTTGG + Intergenic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1071038552 10:81278056-81278078 GCTGATCCCCAGGGGGTGAATGG + Intergenic
1073603518 10:104870501-104870523 GCTGAGGTGCAAGGGGTGGATGG - Intronic
1073854273 10:107656729-107656751 GCTGAACTGAAGAGGGTGGTTGG - Intergenic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076560693 10:131361446-131361468 GGTGATCAGCAGAGTATGGAAGG - Intergenic
1077184981 11:1231850-1231872 GCTTATCTGCAGAGGGTTCTGGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081575652 11:44317203-44317225 ACCGATCTGCAAAGGGTGGACGG - Intergenic
1082008907 11:47437565-47437587 GCTGACGTGCAGTGGGTGGGAGG - Intergenic
1083487421 11:62992333-62992355 GCTGTTCTGCTGTGGCTGGAGGG + Intronic
1083882814 11:65556941-65556963 GCTGAACTGGGGAGGGTGTAGGG + Intronic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085313849 11:75531554-75531576 GGTGATGTGCATAGGGTGGGAGG + Intergenic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1085921540 11:80963690-80963712 GTTGACCTGCAGATGGTGCAAGG - Intergenic
1088541567 11:110919043-110919065 GCTGGTCTCCAGAGGCAGGAGGG + Intergenic
1088649951 11:111948718-111948740 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1088675377 11:112187557-112187579 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1089508384 11:118979949-118979971 GCTGATCTTCAGAGGATGGTGGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG + Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090704367 11:129323109-129323131 GCTGATCTGCAGAGGCACGCAGG + Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098381982 12:69879279-69879301 GGTGCTCTGCAGCGGGTGCATGG - Intronic
1099222649 12:79934069-79934091 GCTGATCTGCACCGGCTGAAAGG - Intronic
1100136132 12:91555852-91555874 GCTGCTCTGCAAAAGGTGGGAGG + Intergenic
1102588551 12:113940346-113940368 GCAGCTCTGCAGAGGGGGTAAGG + Intronic
1102677474 12:114668415-114668437 GCTGATGGGCGGGGGGTGGAGGG - Intergenic
1103309370 12:119991970-119991992 GCTGACCTGCAGAGGAATGAAGG - Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1110611356 13:77491584-77491606 GCAGATGTGGAGAAGGTGGAGGG + Intergenic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1114218983 14:20680520-20680542 GCGTATCTGGAGAGGGCGGAGGG - Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116166632 14:41341975-41341997 GCTGAACTGAGGAGGGTGAATGG + Intergenic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119800924 14:77444500-77444522 GCTGAACTAGAGAGGGTGGTGGG - Intronic
1119850114 14:77861096-77861118 GCTAATCGGCAGGGGGTGGAGGG - Intronic
1121703039 14:95970600-95970622 GCTAATCTCCAGAGCGTGGTTGG - Intergenic
1122425943 14:101605286-101605308 GCTGGTCACCAGTGGGTGGAGGG - Intergenic
1122504909 14:102226324-102226346 GGTGCTCAGCAGAGGGTTGAGGG + Intronic
1122786964 14:104168364-104168386 GCTGCCCTGGAGAGGTTGGAGGG - Intronic
1202933634 14_KI270725v1_random:63319-63341 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1123988393 15:25665248-25665270 GTTTATCTGAAGAGGGTGGCAGG + Intergenic
1124659979 15:31539292-31539314 GCTGATCTGCACAGTCTGTAGGG - Intronic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1129198735 15:73986105-73986127 GCAGCTCTGGCGAGGGTGGAGGG + Intronic
1129524065 15:76203055-76203077 GCTGACCTACAGAGGGTGCAGGG - Intronic
1130078497 15:80710474-80710496 GCTGATATGTCGAGGGAGGAAGG + Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1132331469 15:101015052-101015074 GCTGGTCTCCAGAGGCTGGCTGG - Intronic
1132462046 16:60363-60385 GCTGTGGTGCAGAGGGTGTAGGG - Intronic
1132842759 16:1986258-1986280 GCTGAACTGCAGGGGAGGGAAGG + Exonic
1133384117 16:5354961-5354983 TGTGATCAGCAGAGGTTGGAAGG + Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1135247414 16:20868992-20869014 GCTGATGTGCAGAGGAGGGAGGG - Intronic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1138645976 16:58425294-58425316 GCAGTTCTACAGAGGGTGGTCGG + Intergenic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1139916475 16:70431317-70431339 GCTGACCTGCTGAGGCTGGGGGG + Intronic
1141778113 16:86137963-86137985 CCTGACCTGCAAAGGATGGAGGG + Intergenic
1142314290 16:89333721-89333743 GATGTCCTGCAGAGGGTGAATGG - Intronic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1143001734 17:3798992-3799014 GCTGGCCTGGAGAGAGTGGAAGG + Intronic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1143963116 17:10736995-10737017 CATGAACTGGAGAGGGTGGAAGG + Intergenic
1144667224 17:17110216-17110238 GCTGCTCTACTCAGGGTGGAAGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1148912605 17:50950894-50950916 GGTGACCTGCGGAGGGAGGAGGG - Intergenic
1151422056 17:74005164-74005186 GCTGGGCTTCAGAGGGTGGGTGG - Intergenic
1151581134 17:74979639-74979661 GCTGTTCTGCAGAGAGTAGGTGG - Intergenic
1152803451 17:82342936-82342958 GGTGATCTGCGGAGGTGGGAGGG + Intergenic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1153928662 18:9858903-9858925 GCTGATGAGCGGAGGCTGGATGG + Intronic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1155190010 18:23421498-23421520 GCAGATCTGCTGGGGCTGGATGG - Intronic
1158306377 18:56110455-56110477 GCTCTTCTGCAGAGGGTTCAAGG - Intergenic
1158619728 18:59022586-59022608 GCTGAGCTGACGTGGGTGGATGG + Intergenic
1158868508 18:61661284-61661306 GTAGATCTGCAGAGGGTGAAGGG - Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1160352857 18:78199914-78199936 GATGACCTGCAGAGGATGGAAGG + Intergenic
1160913996 19:1488087-1488109 GCTGTTCTGCAGGGGGAGGCGGG + Exonic
1161651098 19:5485576-5485598 GCTGATCTGCAGATGTGAGAAGG + Intergenic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1163714964 19:18868242-18868264 GATAAACTGCAGGGGGTGGAGGG + Intergenic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165088455 19:33368324-33368346 GCTGCTCTGGAGAGGTTGGCAGG - Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1166111445 19:40625752-40625774 GCTGATAGGCAGAGGGTGCCTGG + Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
1167632281 19:50632524-50632546 GCAGCTCAGCAAAGGGTGGATGG + Exonic
1168692465 19:58385421-58385443 GCTACTCTGCACAGGATGGAGGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925707203 2:6698060-6698082 GCTGACCTGATGAGCGTGGAGGG - Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926194688 2:10755648-10755670 GTGGCTCTGGAGAGGGTGGAGGG - Intronic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930978853 2:57497378-57497400 GCTGTTCTGGAAAGAGTGGAAGG + Intergenic
932585519 2:73025675-73025697 GCAATGCTGCAGAGGGTGGAAGG + Intronic
934325613 2:92011681-92011703 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934463968 2:94242311-94242333 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934686032 2:96322250-96322272 AGTGATCTTCTGAGGGTGGAGGG - Intergenic
935977761 2:108595950-108595972 GGTTATCTGTGGAGGGTGGAAGG + Intronic
936135376 2:109888479-109888501 GGTTATCTGTGGAGGGTGGAAGG + Intergenic
936209321 2:110483006-110483028 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
936428508 2:112438245-112438267 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
936698462 2:114981020-114981042 GCTGTTCTGCAGTGAGTGTATGG + Intronic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
938324380 2:130388440-130388462 GCTGCTCTCCAGAGAGTGGGTGG + Intergenic
940000569 2:148963039-148963061 GCTGACATGCAGTGGGTGGGTGG + Intronic
940427447 2:153546087-153546109 GCTTATCTCCTGAGGGTGCAAGG - Intergenic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
946033726 2:216725277-216725299 TCCAACCTGCAGAGGGTGGAGGG + Intergenic
947082597 2:226415408-226415430 GATGAACAGCAGTGGGTGGAAGG - Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948478864 2:238238598-238238620 GCAGCTCTGGAGTGGGTGGAGGG - Exonic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
1169251207 20:4062817-4062839 GCTGATTGGCAGGGGGTGGAGGG + Intergenic
1169419100 20:5444904-5444926 GCTGTTCTCCAGAGGGTAGTTGG - Intergenic
1169906059 20:10605233-10605255 GCTGATCTCCAGAGACTAGAAGG - Intronic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171345090 20:24459900-24459922 GTTGATCTGGAGAGGCTGAAAGG + Intergenic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174313387 20:49677326-49677348 GATGGTGTGCAGAGGGTGGTTGG - Intronic
1174380185 20:50151291-50151313 GCTGTTCTTCAGAGAGTGAAGGG + Intronic
1174971323 20:55278952-55278974 GGTACTCTGCTGAGGGTGGAGGG - Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1175323723 20:58107930-58107952 GATGCTCTGTAGAGGATGGAGGG - Intergenic
1176595034 21:8685475-8685497 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1179771845 21:43625702-43625724 GCTGATTTGCAGAGGCTTGGGGG - Intronic
1179966142 21:44807176-44807198 GCTGAGCTGCAGTGAGGGGACGG - Intronic
1180277887 22:10662633-10662655 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180585121 22:16881466-16881488 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181179218 22:21055409-21055431 GCTGCTCTGCTGAAGGTGGCTGG + Intronic
1182245642 22:28955466-28955488 GCTGATCCACAGAGGCTGCAAGG - Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949509417 3:4755247-4755269 TCTGATCCACACAGGGTGGAGGG + Intronic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950677577 3:14563984-14564006 GCAGGTCTGGTGAGGGTGGAGGG - Intergenic
951538776 3:23763220-23763242 GCTGCTTTGCAGAGGGTCGTGGG + Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
957484713 3:80843982-80844004 GATGATCTTCAGAGGATGAAAGG + Intergenic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
962847949 3:139287508-139287530 TCTGTTCTGCAGGGAGTGGAAGG - Intronic
965423360 3:168490258-168490280 GCTTATCTTCATAGGGTGAATGG - Intergenic
965632411 3:170746802-170746824 GATTATTTGCTGAGGGTGGAGGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG + Intronic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
970674073 4:18428621-18428643 GTCGACCTGCACAGGGTGGATGG + Intergenic
972389954 4:38605110-38605132 GGTGTTCTGGAAAGGGTGGAGGG - Intergenic
972716031 4:41646925-41646947 GCTGAACTCCAGGGAGTGGATGG + Intronic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
975654992 4:76632577-76632599 GCTGAACTGCAGTGGGTTGAAGG + Intronic
980740121 4:136939358-136939380 GCTGATCAGCAGAAGCTGGCAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
985999610 5:3620227-3620249 GCGGATCACCAGAGGCTGGAGGG - Intergenic
986404219 5:7409221-7409243 GCCTATCTGAGGAGGGTGGAGGG + Intronic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
986986563 5:13506939-13506961 GCAGATTTGCACAGGGAGGAGGG + Intergenic
990528366 5:56650628-56650650 GCCGTGCTGCAGAGGGTGGGAGG - Intergenic
990719832 5:58681966-58681988 GCTGATTTGCTGTGGGTCGAAGG + Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991254504 5:64599454-64599476 GCAGCTCAGCAGAAGGTGGAGGG + Intronic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997013769 5:129906262-129906284 GCTGAACTGTAGCGGCTGGAAGG - Intronic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1001206975 5:169773086-169773108 TCAGATCTCCAGAGTGTGGAAGG - Intronic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1003494470 6:6652256-6652278 GCTGACCTGCAGCCGGTGTAGGG - Intronic
1006154559 6:32007252-32007274 GCTCTCCTGCAGAGGGTGAAAGG - Intergenic
1006160870 6:32039988-32040010 GCTCTCCTGCAGAGGGTGAAAGG - Exonic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1007252902 6:40508428-40508450 TCTGATCAGCAGTGGGTGGTGGG + Intronic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1019025822 6:168962304-168962326 GCTCATCTGCACAGGGTTGGTGG - Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1019706437 7:2499280-2499302 GCTGAGCCGCAGAGGAGGGATGG + Intergenic
1020508781 7:9025715-9025737 ATTGATTTGCAGAGGGTGCATGG - Intergenic
1022552681 7:31256366-31256388 GCAAACCTGCAGAGGGTGAAGGG - Intergenic
1023702293 7:42904721-42904743 GCTGATTTGCTGGTGGTGGAAGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1027346306 7:77263190-77263212 GCTCAACTGCAAAGGGTGCAAGG - Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1035810783 8:2489333-2489355 GCTAACCTTCAGAGGGTGAAGGG + Intergenic
1036284806 8:7434788-7434810 GCAGAACTGCAGAGGAGGGAGGG - Intergenic
1036336668 8:7876742-7876764 GCAGAACTGCAGAGGAGGGAGGG + Intergenic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1039801065 8:40954788-40954810 GCAGATCTCCAGAGGAGGGAGGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1045429293 8:102098262-102098284 GAAGGACTGCAGAGGGTGGAGGG + Intronic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049657982 8:143807207-143807229 ACTGCTCTGCAGAGCGTGGTGGG + Intronic
1049699804 8:144005252-144005274 GATGAGCTGCTGAAGGTGGATGG + Intronic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1053694059 9:40619109-40619131 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1053941049 9:43249528-43249550 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054270776 9:63021018-63021040 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054305304 9:63418333-63418355 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054404051 9:64742322-64742344 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054437672 9:65227822-65227844 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054492731 9:65794145-65794167 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056792586 9:89635673-89635695 GCAGATCACCCGAGGGTGGAAGG + Intergenic
1057964196 9:99487599-99487621 GCTGACCGGCACAGGGTGGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059338486 9:113583842-113583864 GCAGATCTTGACAGGGTGGAAGG - Exonic
1059408389 9:114116560-114116582 ACAGAGCTGCAGAGGATGGATGG - Intergenic
1060603165 9:124891348-124891370 GCTGCTTTGAAGAGCGTGGATGG + Intronic
1061876980 9:133548942-133548964 GCTGAACTGCAGCTGGTGTAGGG + Intronic
1186196099 X:7111461-7111483 GCTGACCTGCAGAGCGGGGGTGG + Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186786590 X:12961887-12961909 GCTGATCTACAGGGTATGGAGGG - Intergenic
1187031311 X:15491287-15491309 GCTGAGCTGTAGAGGATGGAGGG + Exonic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1190300618 X:49054891-49054913 GAAGATCTGAACAGGGTGGAGGG - Intronic
1190485112 X:50916303-50916325 GCTGATTTGGAAAGGGTGGAGGG - Exonic
1190753573 X:53382031-53382053 GCTGAGCAGATGAGGGTGGATGG + Intronic
1192187078 X:68954814-68954836 GTGGATCTGGGGAGGGTGGATGG - Intergenic
1192326014 X:70133174-70133196 GCTGAAGGGCACAGGGTGGAAGG + Intergenic
1195382592 X:104284833-104284855 GCTGCTCTGCAAAGGGGAGATGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198634676 X:138682945-138682967 GGTGATCTGAAGTGAGTGGAAGG + Intronic
1198777368 X:140194488-140194510 GCTGGTCTGATGAGGGTGGATGG + Intergenic
1201191830 Y:11450662-11450684 GGTAATCTTCAGAGGGTGAAAGG + Intergenic